RPA primer probe for legionella pneumophila detection, nucleic acid composition and application thereof, and legionella pneumophila detection method

Abstract

The invention provides an RPA primer probe for legionella pneumophila detection, a nucleic acid composition, application of the nucleic acid composition and a detection method of legionella pneumophila, and relates to the technical field of biology. The RPA primer probe for detecting the legionella pneumophila, provided by the invention, is high in specificity, the sensitivity is 6.0 * 10 < 1 > Cpies / reaction, and the RPA primer probe can be used for detecting the legionella pneumophila. The nucleic acid composition for detecting the legionella pneumophila is used for detecting the legionella pneumophila, the sensitivity of the nucleic acid composition is 1.2 * 10 < 1 > Cpies / reaction, and compared with an RPA primer probe, the nucleic acid composition has higher detection sensitivity and good application potential.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an RPA primer probe, a nucleic acid combination and an application thereof for detecting Legionella pneumophila, and a method for detecting Legionella pneumophila. Background Art

[0002] Legionella pneumophila ( Legionella pneumophila Legionnaires' disease (Legionellosis) is a Gram-negative, aerobic bacillus that primarily causes Legionnaires' disease, including the severe pneumonic form (Legionnaires' disease) and the non-pneumonic form (Pontiac fever). Legionella pneumophila is the most important cause of Legionnaires' pneumonia. Legionella bacteria are found in water and soil and are often inhaled through water supplies, air conditioning, and aerosol inhalation, causing respiratory infections that can also occur in small outbreaks. The disease is more common in middle-aged and elderly people, as well as those with chronic heart, lung, or kidney disease, diabetes, blood disorders, malignancies, AIDS, or those taking inhibitors. The mortality rate for these opportunistic infections is as high as 45%.

[0003] Traditional detection methods include colony-forming unit (CFU) culture enumeration, heterotrophic plate counts, optical density measurement by spectrophotometry, and flow cytometry. While simple to perform, these methods require bacterial enrichment and are time-consuming. Commonly used molecular biology techniques, such as multiplex polymerase chain reaction (PCR) and real-time PCR, have also been used for bacterial quantification and detection. However, these methods require cumbersome instruments with thermal cycling capabilities and can take approximately three hours to complete.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The first object of the present invention is to provide an RPA primer probe for detecting Legionella pneumophila to solve the above technical problems.

[0006] The second object of the present invention is to provide use of the above-mentioned RPA primer probe for Legionella pneumophila detection in the preparation of a product for Legionella pneumophila detection.

[0007] The third object of the present invention is to provide an RPA detection method for Legionella pneumophila.

[0008] A fourth object of the present invention is to provide a nucleic acid combination for detecting Legionella pneumophila.

[0009] A fifth object of the present invention is to provide use of the above-mentioned nucleic acid combination for detecting Legionella pneumophila in preparing a product for detecting Legionella pneumophila.

[0010] The sixth object of the present invention is to provide an RPA-CRISPR / Cas12b detection method for Legionella pneumophila.

[0011] In order to achieve the above object, the following technical scheme is adopted:

[0012] In a first aspect, the present application provides an RPA primer probe for detection of Legionella pneumophila, comprising an upstream primer, a downstream primer and a probe.

[0013] The nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1.

[0014] The nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2.

[0015] The nucleic acid sequence of the probe is shown as SEQ ID NO. 5, wherein the base N in the nucleic acid sequence is replaced with a tetrahydrofuran residue THF.

[0016] As a further technical solution, the upstream and downstream of the THF site in the nucleic acid sequence of the probe are labeled with a fluorescent group and a quenching group, respectively; the quenching group is used for quenching the fluorescent group.

[0017] In a second aspect, the present application provides the use of the above-mentioned RPA primer probe for detection of Legionella pneumophila in the preparation of a product for detection of Legionella pneumophila.

[0018] In a third aspect, the present application provides an RPA detection method for Legionella pneumophila, comprising the following steps:

[0019] The DNA of the sample to be tested is used as an amplification template, and the RPA primer probe is used in an RPA reaction system for RPA amplification reaction, and then the product obtained by RPA amplification reaction is analyzed.

[0020] As a further technical solution, the temperature of the RPA amplification reaction is 39-42℃.

[0021] The concentration of the primer in the RPA reaction system is 1.25-10µmol / L.

[0022] In a fourth aspect, the present application provides a nucleic acid combination for detection of Legionella pneumophila, comprising an upstream primer, a downstream primer, an sgRNA and a probe.

[0023] The nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1.

[0024] The nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2.

[0025] The nucleic acid sequence of the sgRNA is shown as SEQ ID NO. 7.

[0026] The nucleic acid sequence of the probe is shown as SEQ ID NO. 10.

[0027] As a further technical solution, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

[0028] In a fifth aspect, the application provides use of the above-mentioned nucleic acid combination for detection of Legionella pneumophila in preparation of a product for detection of Legionella pneumophila.

[0029] In a sixth aspect, the application provides a RPA-CRISPR / Cas12b detection method for Legionella pneumophila, comprising the following steps:

[0030] The DNA of the sample to be tested is used as an amplification template, and the upstream primer and the downstream primer are used in the RPA reaction system to perform an RPA amplification reaction, and then the sgRNA and the probe are used to perform a target sequence cleavage reaction on the product of the RPA amplification reaction in the CRISPR system, and then the product after the target sequence cleavage reaction is analyzed; the RPA reaction system contains Cas12b protein.

[0031] As a further technical solution, the temperature of the RPA amplification reaction is 37-42℃, and the time is 20-30min;

[0032] The temperature of the target sequence cleavage reaction is 37-42℃, and the time is 20-30min.

[0033] Compared with the prior art, the application has the following beneficial effects:

[0034] The RPA primer probe for detection of Legionella pneumophila provided by the application has high specificity, and the sensitivity of Legionella pneumophila DNA detection is 6.0x10 1 copies / reaction, and can be used for detection of Legionella pneumophila.

[0035] The nucleic acid combination for detection of Legionella pneumophila provided by the application is used for detection of Legionella pneumophila, and the sensitivity of Legionella pneumophila DNA detection is 1.2x10 1 copies / reaction, and the sensitivity based on Legionella pneumophila bacteria is 5.3x10 1 CFU / reaction, which has higher detection sensitivity than the RPA primer probe and has good application potential. BRIEF DESCRIPTION OF DRAWINGS

[0036] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings required to be used in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0037] Figure 1 is a map of the mip gene;

[0038] Figure 2 is an electropherogram of RPA amplification with different RPA primer pairs (from left to right 1-4 are primer pairs mip-B1-F / R, mip-B2-F / R, negative control mip-B1-F / R, negative control mip-B2-F / R, respectively);

[0039] Figure 3 is the fluorescence intensity of different RPA primer pairs;

[0040] Figure 4 is the fluorescence intensity of different RPA probes;

[0041] Figure 5 is the fluorescence intensity of RPA detection system at different temperatures;

[0042] Figure 6 is the fluorescence intensity of RPA detection system at different primer concentrations;

[0043] Figure 7 is the DNA-based sensitivity of RPA detection system (the curves from top to bottom are 1.2x10 4 copies / reaction, 1.2x10 3 copies / reaction, 1.2x10 2 copies / reaction, 6.0x10 1 copies / reaction, 3.0x10 1 copies / reaction and negative control);

[0044] Figure 8 Figure 8 is the specificity of RPA detection system;

[0045] Figure 9 is the fluorescence intensity of different sgRNAs;

[0046] Figure 10 is the fluorescence intensity of RPA-CRISPR / Cas12b detection system at different temperatures;

[0047] Figure 11 is the DNA-based sensitivity of RPA-CRISPR / Cas12b detection system (the curves from top to bottom are 1.2x10 4 copies / reaction, 1.2x10 3 copies / reaction, 1.2x10 2Copies / reaction, 1.2x10 1 Copies / reaction, 1.2x10 0 Copies / reaction and negative controls);

[0048] Figure 12 shows the sensitivity of the RPA-CRISPR / Cas12b detection system based on Legionella pneumophila (the curves from top to bottom are 5.3x10 4 CFU / reaction, 5.3x10 3 CFU / reaction, 5.3x10 2 CFU / reaction, 5.3x10 1 CFU / reaction, 5.3x10 0 CFU / reaction and negative control);

[0049] Figure 13 shows the specificity of the RPA-CRISPR / Cas12b detection system; DETAILED DESCRIPTION

[0050] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be understood by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or the conditions recommended by the manufacturer. Reagents or instruments used are not specified by the manufacturer and are conventional products that can be purchased commercially.

[0051] In a first aspect, the present invention provides an RPA primer probe for detecting Legionella pneumophila, comprising an upstream primer, a downstream primer, and a probe;

[0052] The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.1:

[0053] GCGGATGAAAATAAAGTAAAAGGGGAAGCC (SEQ ID NO. 1);

[0054] The nucleic acid sequence of the downstream primer is shown in SEQ ID NO.2:

[0055] TCTGTCCATCCAGGGATAACTTGTGAAAACC (SEQ ID NO.2);

[0056] The nucleic acid sequence of the probe is shown in SEQ ID NO.5:

[0057] GGAAATGGTGTTAAACCCGGAAAATCGGATNCAGTCACTGTCGAATAT (SEQ ID NO. 5);

[0058] wherein the base N in the nucleic acid sequence is replaced with a tetrahydrofuran residue THF.

[0059] The RPA primer probe for detecting Legionella pneumophila provided by the application has high specificity and a sensitivity of 6.0x10 1 Copies / reaction, which can be used for the detection of Legionella pneumophila.

[0060] In some optional embodiments, the nucleic acid sequence of the probe is labeled with a fluorescent group and a quencher group upstream and downstream of the THF site, respectively; and the quencher group is used for quenching the fluorescent group.

[0061] In the second aspect, the application provides application of the above-mentioned RPA primer probe for detecting Legionella pneumophila in the preparation of a product for detecting Legionella pneumophila.

[0062] The RPA primer probe provided by the application has high specificity and high sensitivity, and can be used for the preparation of a Legionella pneumophila detection product.

[0063] In the third aspect, the application provides a RPA detection method for Legionella pneumophila, comprising the following steps:

[0064] DNA of a sample to be detected is used as an amplification template, and the RPA primer probe is used in a RPA reaction system to perform a RPA amplification reaction, and then a product obtained by the RPA amplification reaction is analyzed.

[0065] The detection method is simple and convenient, has high sensitivity, and can realize the detection of Legionella pneumophila within 30 minutes.

[0066] In some optional embodiments, the temperature of the RPA amplification reaction is 39-42℃, and is preferably 42℃.

[0067] The concentration of the primer in the RPA reaction system is 1.25-10µmol / L, and is preferably 10µmol / L.

[0068] In the fourth aspect, the application provides a nucleic acid combination for detecting Legionella pneumophila, comprising an upstream primer, a downstream primer, an sgRNA and a probe.

[0069] The nucleic acid sequence of the upstream primer is shown in SEQ ID NO. 1.

[0070] The nucleic acid sequence of the downstream primer is shown in SEQ ID NO. 2.

[0071] The nucleic acid sequence of the sgRNA is shown in SEQ ID NO.7:

[0072] GUCUAAAGGACAGAUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCAC CCAAGUGGUUUGCAAUACAA (SEQ ID NO.7);

[0073] The nucleic acid sequence of the probe is shown in SEQ ID NO.10:

[0074] TTTTTTT (SEQ ID NO. 10).

[0075] The nucleic acid combination for detecting Legionella pneumophila provided by the present invention is used for detecting Legionella pneumophila, and the sensitivity of Legionella pneumophila DNA detection is 1.2x10 1 Copies / reaction, based on the sensitivity of Legionella pneumophila bacteria is 5.3x10 1 CFU / reaction, which has higher detection sensitivity than RPA primer probe and has good application potential.

[0076] In some optional embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

[0077] In a fifth aspect, the present invention provides the use of the aforementioned nucleic acid combination for Legionella pneumophila detection in the preparation of a product for Legionella pneumophila detection. The nucleic acid combination provided by the present invention has strong specificity and high sensitivity and can be used to prepare a product for Legionella pneumophila detection.

[0078] In a sixth aspect, the present invention provides an RPA-CRISPR / Cas12b detection method for Legionella pneumophila, comprising the following steps: using the DNA of a sample to be tested as an amplification template, performing an RPA amplification reaction in an RPA reaction system using the upstream primer and the downstream primer, then performing a target sequence cleavage reaction on the product of the RPA amplification reaction in a CRISPR system using the sgRNA and the probe, and then analyzing the product after the target sequence cleavage reaction;

[0079] The RPA reaction system contains Cas12b protein.

[0080] This detection method is simple, convenient, highly sensitive, and can detect Legionella pneumophila within 60 minutes.

[0081] In some alternative embodiments, the RPA amplification reaction has a temperature of 37-42°C, preferably 42°C, and a time of 20-30 min, preferably 30 min; and the target sequence cleavage reaction has a temperature of 37-42°C, preferably 42°C, and a time of 20-30 min, preferably 30 min.

[0082] The application will be further described in the following with specific examples. It should be understood, however, that these examples are only used for a more detailed description and should not be understood as limiting the application in any form.

[0083] Example 1

[0084] 1. Materials and equipment

[0085] 1.1 Strain source

[0086] The strains used in the experiment and the culture method are shown in Table 1.

[0087] Table 1 Strains used in the experiment

[0088] Strain Source Culture condition reference ATCC 33152 ISO 11731:2017 ATCC 35292 ISO 11731:2017 ATCC 33297 ISO 11731:2017 ATCC 17802 GB 4789.7-2013 ATCC 6535 GB 4789.10-2016 CMCC 51105 GB 4789.31-2013 ATCC 43888 GB 4789.3-2025 CMCC 50041 GB 4789.31-2013 ATCC 27853 SN / T 5523-2023

[0089] 1.2 Main experimental reagents

[0090] The main reagents used in the experiment are shown in Table 2.

[0091] Table 2 Main experimental reagents

[0092] Reagent name Manufacturer DNA constant temperature rapid amplification kit (fluorescent type) Amplilab (Changzhou) Biotechnology Co., Ltd. DNA constant temperature rapid amplification kit (test strip type) Amplilab (Changzhou) Biotechnology Co., Ltd. Bacterial genomic DNA extraction kit Tiangen Biotech (Beijing) Co., Ltd. DNA maker DL2000 Takara ddH2O Hualvnnnibao Beverage China Co., Ltd. Agar powder Shanghai Maikelin Biochemical Technology Co., Ltd. Trypticase Beijing Aobos Technology Co., Ltd. Sodium chloride Shanghai Yinn Chemical Technology Co., Ltd. Glucose Beijing Aobos Technology Co., Ltd. 50xTAE Beijing Solaybao Technology Co., Ltd. Tris balanced phenol Shanghai Sunny Biotech Co., Ltd. Phenol Shanghai Sunny Biotech Co., Ltd. Chloroform Shanghai Sunny Biotech Co., Ltd. Isoamyl alcohol Shanghai Sunny Biotech Co., Ltd. Anhydrous ethanol Tianjin Fuyu Fine Chemical Co., Ltd.

[0093] 1.3 Main experimental equipment

[0094] The main instruments used in the experiment are shown in Table 3.

[0095] Table 3 Main experimental instruments

[0096] Instrument name Manufacturer Loop-mediated isothermal amplification instrument Genie II Beijing Shengtai Bolun Technology Co., Ltd. Electrophoresis instrument Beijing Liu Yi Biological Technology Co., Ltd. Gel imaging analyzer Beijing Liu Yi Biological Technology Co., Ltd. Clean bench Beijing Donglian Haer Instrument Manufacturing Co., Ltd. Vortex shaker USA Cellogic Co. High-temperature high-pressure steam sterilization pot Shanghai Boxin Industrial Co., Ltd. Medical Equipment Factory Constant temperature and humidity incubator Shanghai Yiheng Scientific Instruments Co., Ltd. High-speed centrifuge USA Thermo Company

[0097] 1.4 Preparation of main culture medium and reagents

[0098] Tryptone soy broth medium (TSB): weigh 17 g of tryptone, 5 g of Nacl, 3 g of yeast extract powder and 2.5 g of glucose on an electronic balance, then add 1 L of pure water, mix well and sterilize in a sterilized pot, and store at room temperature after cooling.

[0099] Luria-Bertani medium (LB): weigh 10 g of tryptone, 10 g of Nacl and 5 g of yeast extract powder on an electronic balance, then add 1 L of pure water, mix well and sterilize in a sterilized pot, and store at room temperature after cooling.

[0100] Nutrient Agar Medium (NA): 3g beef extract, 10g peptone, 5g Nacl and 15g agar were weighed by electronic balance, mixed with 1L of pure water, and then sterilized by high-temperature sterilization with a sterilization pot. After cooling, it was stored at room temperature.

[0101] 1xTAE buffer: Take 20ml of 50xTAE buffer, add pure water to 1L, mix well and store at room temperature.

[0102] 1% agarose gel: 0.3g agarose was added to a 100mL beaker, 30mL 1xTAE buffer was added, and the microwave oven was used for heating and waiting for complete dissolution before adding the nucleic acid staining agent. After mixing well, pour into the agarose gel plate and use after cooling and solidification.

[0103] 2 Experimental method

[0104] 2.1 Construction of standard plasmid of Legionella pneumophila

[0105] According to the Legionella pneumophila mip gene fragment (Gene ID: S42595.1), a puc57-mip standard plasmid with a length of 702bp was synthesized by Beijing Genesee Biotechnology Co., Ltd. The map of the mip gene fragment is shown in Figure 1 .

[0106] 2.2 RPA primer design and synthesis

[0107] According to the requirements of primer design, the RPA primer was designed using Primer 5.0 at the selected sequence position. Two upstream primers and two downstream primers were designed, and the designed primers are shown in Table 4, which were synthesized and purified by Beijing Genesee Biotechnology Co., Ltd.

[0108] Table 4 RPA primer sequence

[0109] Sequence name Sequence (5'-3') mip-B1-F GCGGATGAAAATAAAGTAAAAGGGGAAGCC (SEQ ID NO. 1) mip-B1-R GCGGAAAACCGGGCCGAGGCCAACCGTTTC (SEQ ID NO. 2) mip-B2-F CTGCAACCGATGCCACATCATTAGCTACAG (SEQ ID NO. 3) mip-B2-R CCCTTTTACTTTATTTTCATCCGCTTTCTT (SEQ ID NO. 4)

[0110] 2.3 RPA probe design and synthesis

[0111] The designed RPA primers were used to design and synthesize the probes using Oligo and SnapGene software. The designed RPA probes are shown in Table 5, which were synthesized and purified by Beijing Genesee Biotechnology Co., Ltd.

[0112] Table 5 RPA probe sequence

[0113] Sequence name Sequence (5'-3') Probe P1 GGAAATGGTGTTAAACCCGGAAAATCGGAT[FAM-dT]N[BHQ1-dT]CAGTCACTGTCGAATAT-C3spacer (SEQ ID NO. 5) Probe P2 CATGCAAGACGCTATGAGTGGCGCTCAATT[FAM-dT]N[BHQ1-dT]GCTTTAACCGAACAGCA-C3spacer (SEQ ID NO. 6)

[0114] Note: In the sequence table, THF is modified as N.

[0115] 2.4 RPA primer screening

[0116] The upstream and downstream primers were diluted to 10 μM, respectively, and the target fragment was amplified using the SynSor DNA / RNA isothermal rapid amplification kit (XS-R-101) from Beijing Xunsi Technology Co., Ltd. The specific operation steps are as follows:

[0117] 1. Add 25 µL of amplification buffer A to each lyophilized ball reaction tube.

[0118] 2. Add 2 µL of upstream primer and 2 µL of downstream primer to each reaction tube, respectively.

[0119] 3. Add 2 µL of nucleic acid template to the reaction tube.

[0120] 4. Add 17 µL of ddH2O to the reaction tube.

[0121] 5. Finally, add 2.0 µL of magnesium acetate to the inside of the reaction tube cap and invert it 8-10 times to mix thoroughly.

[0122] 6. After mixing, spin (or centrifuge quickly) the reaction solution to the bottom of the tube, and immediately place the reaction tube in a metal bath at 42°C for incubation for 30 min.

[0123] 7. After the reaction is completed, take 5 µL of supernatant and add 1 µL of 6xloading buffer loading buffer for agarose gel electrophoresis detection. Then select probe P1 for testing according to the experimental method in section 2.5, and finally select the best performing RPA primer pair for subsequent experiments by combining electrophoresis and fluorescence intensity.

[0124] 2.5 RPA detection method

[0125] The DNA isothermal rapid amplification kit (fluorescent type WLE8202KIT) from Ampure Future (Changzhou) Biotechnology Co., Ltd. was used to amplify and detect the target fragment, and the specific operation steps are as follows:

[0126] 1. Add 29.4 μL of A buffer to each dry powder reaction tube;

[0127] 2. Add 2 μL of upstream primer, 2 μL of downstream primer, and 0.6 μL of RPA fluorescent probe to each reaction tube, respectively;

[0128] 3. Add 5 μL of nucleic acid template and 8.5 μL of ddH2O to the reaction tube, respectively;

[0129] 4. Finally, add 2.5 μL of B buffer to the reaction tube and mix thoroughly;

[0130] 5. After mixing, spin (or quick centrifuge) the reaction solution to the bottom of the tube, immediately put the reaction tube into the loop-mediated isothermal amplification instrument for incubation at 42°C for 30 min, and read the fluorescence value every 1 min.

[0131] 2.6 RPA probe screening

[0132] According to the designed two RPA probes P1 and P2, detection was carried out in combination with the screened optimal RPA primers, and the experimental temperature and primer probe concentration were controlled. The experimental method in section 2.5 was followed, the performance of the two probes was judged according to the fluorescence intensity value after the reaction, and the best one was selected for subsequent experiments.

[0133] 2.7 RPA reaction condition optimization

[0134] 2.7.1 RPA temperature optimization

[0135] The reaction temperature range of RPA amplification is 37-42°C, while the recommended reaction temperature range of DNA constant temperature rapid amplification kit (fluorescent type) is 39-42°C. Therefore, 39°C, 40°C, 41°C and 42°C were selected to explore the best reaction temperature of the RPA detection system. The best RPA amplification primer pair and the best probe were used to prepare and detect the RPA detection system, and a group of negative controls with ddH2O as the template was set. After the reaction, the most suitable reaction temperature for the two reaction systems was selected according to the fluorescence intensity value for subsequent experiments.

[0136] 2.7.2 RPA primer concentration optimization

[0137] The concentration of RPA primers may affect the product content and efficiency of RPA amplification, thereby affecting the performance and sensitivity of the entire RPA detection. Therefore, the concentration of RPA primers is also one of the factors to be considered. After synthesis, the initial concentration of RPA primers was 10 μM. The selected best RPA primer pair was diluted by two times to make the concentration reach 10 μM, 5 μM, 2.5 μM and 1.25 μM. At the same time, a group of negative controls with ddH2O as the template was set. The preparation was carried out according to the detection system in section 2.5. After the reaction, the most suitable primer concentration for the reaction system was selected according to the fluorescence intensity value for subsequent experiments.

[0138] 2.8 Sensitivity test

[0139] The copy number of Legionella pneumophila plasmid was calculated, and after multiple dilutions, it was 1.2x10 4 copies / reaction, 1.2x10 3 copies / reaction, 1.2x10 2Copies / reaction, 6.0 x 10 1 Copies / reaction, 3.0 x 10 1 Copies / reaction, 5 concentrations, ddH2O as negative control, detection system in section 2.5 was configured with the best reaction condition and placed in the loop-mediated isothermal amplification instrument to read the fluorescence intensity, and the sensitivity of the RPA detection method was judged by the fluorescence intensity.

[0140] 2.9 Bacterial strain recovery and genomic DNA extraction

[0141] The pathogenic bacteria in section 1.1 were cultured according to the culture conditions, and the genomic DNA was extracted using the Tian Gen bacterial genomic DNA extraction kit (DP302).

[0142] 2.10 Specific detection

[0143] The pathogenic bacteria in section 1.1 were cultured according to the culture conditions, and the genomic DNA was extracted using the Tian Gen bacterial genomic DNA extraction kit (DP302).

[0144] 3 Experimental results

[0145] 3.1 Legionella pneumophila RPA primer screening

[0146] Two groups of RPA primers were designed for the Legionella pneumophila target gene mip, and the two groups of RPA primers were respectively amplified for target gene, each with two repeats. After amplification, the amplification products were detected by gel electrophoresis, and the results are shown in Figure 2. The mip-B1-F / R and mip-B2-F / R combinations all showed obvious amplification bands. Further fluorescence detection found that the fluorescence intensity of the mip-B1-F / R combination was significantly higher than that of the mip-B2-F / R combination, so the mip-B1-F / R primer pair was selected for subsequent experiments. Figure 3

[0147] 3.2 Legionella pneumophila RPA probe screening

[0148] The optimal RPA primer pair mip-B1-F / R selected in the previous screening was combined with probes P1 and P2, respectively, to form two different RPA detection systems. The standard plasmid of Legionella pneumophila was used as a template for testing. The detection system was placed in the loop-mediated isothermal amplification instrument, and the fluorescence signal was collected every 1 min using the FAM channel at 42°C for 30 min. Each different probe was repeated three times, and the results were analyzed. The results are shown in Figure 3. Figure 4 ​As shown, both probes appeared fluorescence signal within 20 min, but by comparing the results, it was found that the fluorescence intensity value of probe P1 was more than 51000 and significantly higher than the fluorescence intensity value of about 32000 when using probe P2, so the performance of probe P1 was higher than that of probe P2, and finally probe P1 was determined as the best probe and used in subsequent experiments.

[0149] 3.3. RPA reaction condition optimization

[0150] 3.3.1 RPA temperature optimization

[0151] In order to study the optimal temperature range of RPA reaction, four temperature points of 39℃, 40℃, 41℃ and 42℃ were selected for experiment, and the prepared detection system was placed in a loop-mediated isothermal amplification instrument. The fluorescence signal was recorded once every minute for 20 minutes through the FAM channel. At each temperature, the experiment was repeated three times, and then the data obtained was analyzed.

[0152] The results are shown in Figure 5 As shown, within 30 min of reaction time, the fluorescence intensity value of the RPA detection system gradually increased with the gradual increase of the amplification temperature. After 30 min of reaction at 42℃, the fluorescence intensity value was more than 50000, which was significantly higher than that of the other three temperatures. This may be due to the better RPA amplification efficiency at 42℃ than at other temperatures, thus showing the most obvious fluorescence signal, so 42℃ was selected as the optimal reaction temperature of the RPA detection system.

[0153] 3.3.2 RPA primer concentration optimization

[0154] The initial concentration of RPA primer was 10µmol / L, and the change of primer concentration would affect the amplification efficiency and amplification product quantity of RPA. The selected optimal RPA upstream and downstream primers were diluted by two times repeatedly, and the concentration was diluted to 10µmol / L, 5µmol / L, 2.5µmol / L and 1.25µmol / L, respectively, with ddH2O as negative control. The detection system of RPA was configured with each different concentration of primer and placed in a loop-mediated isothermal amplification instrument, and the fluorescence signal was recorded once every minute for 30 minutes through the FAM channel. At each primer concentration, the experiment was repeated three times, and then the data obtained was analyzed.

[0155] The results are shown in Figure 6As shown in the figure, within the 30-min reaction time, as the RPA primer concentration increased, the fluorescence intensity value of the detection system also increased, and when the RPA primer concentration was 10µmol / L, the fluorescence intensity value reached a maximum point close to 60,000, slightly higher than the 2.5µmol / L and 5µmol / L groups. Taking into account time costs and other reasons, the RPA primer concentration of 10µmol / L was selected for subsequent experiments.

[0156] 3.4RPA Sensitivity Test

[0157] In order to verify the sensitivity of the RPA detection system, the plasmid of Legionella pneumophila was diluted several times to 1.2x10 4 Copies / reaction, 1.2x10 3 Copies / reaction, 1.2x10 2 Copies / Reaction, 6.0x10 1 Copies / Reaction, 3.0x10 1 Copies / reactions were performed at five different concentrations, with ddH2O used as a negative control. The RPA detection system was configured separately and placed in a loop-mediated isothermal amplification instrument. The reaction was performed through the FAM channel for 30 minutes, and the fluorescence signal was recorded once per minute. The experiment was repeated three times at each DNA concentration, and the resulting data were then analyzed.

[0158] The results are as follows Figure 7 As shown, the concentration is 3.0x10 1 There was no obvious specific amplification curve for the templates and negative controls in the copies / reactions. However, a significant increase in the fluorescence amplification curve was observed for templates at other concentrations. The onset of the fluorescence signal was also delayed as the template concentration decreased. Repeated experiments revealed almost identical results, demonstrating that the detection limit of the RPA detection system based on DNA was 6.0x10 1 Copies / Reactions.

[0159] 3.5RPA specificity detection

[0160] Extract positive strains Legionella pneumophila , 2 strains of Legionella Legionella anisa, Legionella gormanii and 6 other pathogenic bacteria Vibrio parahaemolyticus, Staphylococcus aureus, Shigella dysenteriae, Escherichia coli, Salmonella Enteritidis Pseudomonas aeruginosa and Figure 8 The genomic DNA was used to test the specificity of the RPA detection system. Reagent nameAs shown, the fluorescence intensity of the L. pneumophila genomic DNA as a template was more than 80000, while the fluorescence intensity of the other 8 kinds of bacterial genomic DNA as a template had no significant difference with the negative control, thus indicating that the specificity of the RPA detection method was good.

[0161] Example 2

[0162] 1. Materials and equipment

[0163] 1.1 Strain source

[0164] The main strains used and their sources are the same as those in section 1.1 of Example 1.

[0165] 1.2 Main experimental reagents

[0166] The main reagents used in this experiment are shown in Table 6, and other reagents are the same as those in section 1.2 of Example 1.

[0167] Table 6 Main experimental reagents

[0168] Manufacturer RNA / DNA constant temperature rapid amplification kit (basic type) Beijing Xunshi Technology Co., Ltd. AaCas12b Beijing Xunshi Technology Co., Ltd. AaCas12b Buffer Beijing Xunshi Technology Co., Ltd. Bacterial genomic DNA extraction kit Tiangen Biotech (Beijing) Co., Ltd. ddH2O China Resources Yihao Beverage Co., Ltd. Sequence name

[0169] 1.3 Main experimental equipment

[0170] The electric heating constant temperature water bath used in this experiment is from Shanghai Zilang Instrument Technology Co., Ltd., and other experimental equipment is the same as that in section 1.3 of Example 1.

[0171] 2. Experimental method

[0172] 2.1 Construction of L. pneumophila standard plasmid

[0173] The constructed and synthesized L. pneumophila standard plasmid is the same as that in section 2.1 of Example 1.

[0174] 2.2 Design and synthesis of sgRNA

[0175] Three sgRNAs were designed according to the requirements and synthesized by Beijing Xunsi Technology Co., Ltd.

[0176] Table 7 sgRNA sequence

[0177] Sequence (5'-3') sgRNA370 GTCTAAAGGACAGATTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAACTTCAAGCGAAGTGGCACCCAAGTGGTTTGCAATACAA (SEQ ID NO. 7) sgRNA166 GTCTAAAGGACAGATTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAACTTCAAGCGAAGTGGCACCGGATTAACATCTATGCCTT (SEQ ID NO. 8) sgRNA289 GTCTAAAGGACAGATTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAACTTCAAGCGAAGTGGCACAATAAGAAAGCGGATGAAAA (SEQ ID NO. 9) Sequence name

[0178] 2.3 Design and synthesis of ssDNA

[0179] The synthesized ssDNA fluorescent probe sequences are shown in Table 8, which were synthesized by Beijing Xunsi Technology Co., Ltd.

[0180] Table 8 ssDNA probe sequence used in the experiment

[0181] Sequence (5'-3') ssDNA 5'-FAM-TTTTTTT-BHQ1-3' (SEQ ID NO. 10) Figure 9

[0182] 2.4RPA amplification and CRISPR detection system one-tube two-step method

[0183] Use Beijing Xunsi Technology Co., Ltd. SynSor DNA / RNA constant temperature rapid amplification kit (XS-R-101) and CRISPR / Cas12b protein for target fragment amplification and detection. The specific operation steps are as follows:

[0184] 1. Mix the isothermal amplification freeze-dried ball with 25 µL amplification buffer A thoroughly;

[0185] 2. Take 12 µL of the liquid after dissolving the freeze-dried ball and place it on the eight-way tube cap, and add 1.6 µL of nucleic acid template;

[0186] 3. Add 2 µL (10 μM) of upstream primer and 2 µL (10 μM) of downstream primer to the eight-way tube, respectively;

[0187] 4. Add 1.0 µL (350 mM) magnesium acetate to the reaction tube and cover the tube cap;

[0188] 5. According to the instructions of Xunsi AaCas12b protein, configure 10 µL of CRISPR system, which contains 1 µL AaCas12b, 2.5 µL 10xAaCas12b Buffer, 1 µL (100 ng / µL) sgRNA and 0.5 µL (100 uM) ssDNA, and the rest is filled with ddH2O to 10 µL. Add the configured CRISPR system to the new eight-way tube cap;

[0189] 6. Place the capped eight-way tube in step 4 in the centrifuge, and centrifuge for a moment to make all components fall to the bottom of the tube. Vortex for 10 s to mix thoroughly;

[0190] 7. Discard the eight-way tube cap in step 6, and replace it with the eight-way tube cap with the CRISPR system. Avoid dropping the CRISPR system into the tube. Do not centrifuge, and immediately place the reaction tube in a constant temperature device for incubation at 42℃ for 30 min;

[0191] 8. After the RPA process is completed, centrifuge for a moment to mix the RPA system with the CRISPR system, vortex for 10 s to mix thoroughly, and place it in a loop-mediated isothermal amplification instrument for incubation at 42℃ for 30 min, reading every 1 min.

[0192] 2.5sgRNA screening

[0193] Perform RPA amplification using the optimal primer pair, mip-B1-F / R. Configure the detection system as described in 2.4, add different sgRNAs, and use fluorescence intensity to select the optimal sgRNA for subsequent experiments.

[0194] 2.6 CRISPR / Cas12b reaction temperature optimization

[0195] The typical reaction temperature for Cas12b used in this study is 37-55°C. However, considering the need for integration with RPA, the RPA temperature range is 37-42°C. Six temperatures (37°C, 38°C, 39°C, 40°C, 41°C, and 42°C) were selected to explore the optimal reaction temperature for CRISPR-Cas12b. Using the optimal RPA amplification primers mip-B1-F / R and the optimal sgRNA370, the system described in 2.4 was prepared and tested. A negative control using ddH2O as the template was also set up. After the reaction, the optimal reaction temperature for each reaction system was selected based on the fluorescence intensity values ​​for subsequent experiments.

[0196] 2.7 Sensitivity Test

[0197] 2.7.1 DNA-based sensitivity

[0198] The constructed Legionella pneumophila plasmid was used as a template to calculate the DNA copy number and then gradiently diluted to 1.2x10 4 Copies / reaction, 1.2x10 3 Copies / reaction, 1.2x10 2 Copies / reaction, 1.2x10 1 Copies / reaction, 1.2x10 0 Copies / reaction samples are DNA templates. Prepare the Legionella pneumophila detection system according to the reaction system described in Section 2.4. Also, set up a negative control using ddH2O as the template. Place the sample in a loop-mediated isothermal amplification instrument and determine the DNA-based sensitivity of the RPA-CRISPR / Cas12b detection system by fluorescence intensity.

[0199] 2.7.2 Sensitivity based on bacteria

[0200] The Legionella pneumophila was cultured, and 100 μL of the second-generation bacterial solution was gradient diluted. 10 μL of the diluted solution was uniformly coated on the plate culture medium, and 3 plates were coated for each dilution gradient. According to the culture characteristics and culture conditions of Legionella pneumophila, the appropriate gradient plate was selected for colony counting after 72 h of culture at 37°C. The number of viable bacteria in the original second-generation bacterial solution was calculated according to the dilution gradient and the amount of coating bacterial solution. Legionella pneumophila was diluted to 5.3 x 10 4 CFU / ml, 5.3 x 10 3 CFU / ml, 5.3 x 10 2 CFU / ml, 5.3 x 10 1 CFU / ml, 5.3 x 10 0 CFU / ml, and 1 ml of each bacterial solution was used to extract DNA. The extracted Legionella pneumophila DNA was used as a template to select the best reaction conditions according to the detection system in section 2.4. A negative control group was set with ddH2O as a template, and the fluorescence intensity was read in a loop-mediated isothermal amplification instrument.

[0201] 2.8 Specific detection

[0202] The pathogenic bacteria in section 1.1 were subjected to bacterial genomic DNA extraction. The extracted DNA was used instead of Legionella pneumophila standard plasmid to select the best reaction conditions. The Legionella pneumophila detection system was configured according to the reaction system in section 2.4, and the specificity of the RPA-CRISPR / Cas12b detection system was determined by fluorescence intensity.

[0203] 2.9 DNA extraction from water samples

[0204] Traditional SDS method was used for DNA extraction from water.

[0205] 2.10 Actual sample detection

[0206] 2.10.1 RPA, RPA-CRISPR / Cas12b detection

[0207] The Legionella pneumophila standard plasmid was replaced by the DNA extracted from the 20 artificially contaminated water samples. The RPA method optimized in section 3.3 of Example 1 and the RPA-CRISPR / Cas12b detection system optimized in section 2.4 of Example 2 were used to configure the reaction system with the best reaction conditions and to read the fluorescence intensity in a loop-mediated isothermal amplification instrument to determine the detection results of RPA and RPA-CRISPR / Cas12b for actual samples.

[0208] 2.10.2 Filter membrane method detection

[0209] Legionella pneumophila in water samples was detected according to the Detection Standard of Legionella pneumophila in Water (ISO 11731:2017), and the main pretreatment method of water sample detection was filter membrane method.

[0210] 3 Experimental results

[0211] 3.1 Screening of sgRNA of Legionella pneumophila

[0212] Three sgRNAs were designed and synthesized according to the mip gene sequence of Legionella pneumophila. After the target gene was amplified by the RPA primer pair mip-B1-F / R, three sgRNAs were used to configure the CRISPR detection system. The prepared detection system was placed in a loop-mediated isothermal amplification instrument, and the fluorescence signal was recorded every minute for 30 minutes through the FAM channel. Each sgRNA was repeated three times, and the data was analyzed. The results are shown in Figure 10 The fluorescence curve increased fastest when sgRNA370 was added, and the fluorescence intensity value of the detection system could reach 180000 at 30min, which was much higher than that of sgRNA166 and sgRNA289. Therefore, sgRNA370 was selected for subsequent experiments.

[0213] 3.2 CRISPR temperature optimization

[0214] In order to study the optimal temperature range of RPA-CRISPR / Cas12b reaction, six temperature points of 37℃, 38℃, 39℃, 40℃, 41℃ and 42℃ were selected for experiment. At each temperature point, ddH2O was used as negative control, and the prepared detection system was placed in a loop-mediated isothermal amplification instrument. The fluorescence signal was recorded every minute for 30 minutes through the FAM channel. Each temperature was repeated three times, and the data was analyzed.

[0215] The results are shown in Figure 11 At 42℃, the fluorescence curve increased fastest and the fluorescence intensity value could exceed 180000 after 30min, which was significantly higher than that of the other five temperatures. This may be due to the highest activity of Cas12b protein with thermophilic properties at 42℃, thus showing the most obvious fluorescence signal. Therefore, 42℃ is the optimal reaction temperature of RPA-CRISPR / Cas12b detection system.

[0216] 3.3 Sensitivity test

[0217] 3.3.1 DNA-based sensitivity

[0218] First, the Legionella pneumophila standard plasmid was gradient diluted to 1.2x104 Copies / reaction, 1.2 x 10 3 Copies / reaction, 1.2 x 10 2 Copies / reaction, 1.2 x 10 1 Copies / reaction, 1.2 x 10 0 Copies / reaction, 1.2 x 10 Figure 12 Copies / reaction, 1.2 x 10 1 Copies / reaction, 1.2 x 10 1 Copies / reaction, 1.2 x 10

[0219] 3.3.2 Bacterial-based sensitivity

[0220] Using the extracted L. pneumophila DNA as template, RPA amplification was performed, and the optimized CRISPR system was used to detect the amplification product. The prepared detection system was placed in a loop-mediated isothermal amplification instrument, and the fluorescence signal was recorded once per minute. The experiment was repeated three times at each bacterial concentration, and the data obtained was analyzed. The results are shown in Legionella pneumophila 1 CFU / reaction, and the detection result was determined to be positive. Therefore, the detection limit of this detection system based on L. pneumophila bacteria was 5.3 x 10 1 CFU / reaction.

[0221] 3.4 Specific detection

[0222] The positive strains Legionella anisa, , 2 strains of Legionella ​ Legionella gormanii and 6 other pathogenic bacteria Vibrio parahaemolyticus, Staphylococcus aureus, Shigella dysenteriae, Escherichia coli, Salmonella Enteritidis Pseudomonas aeruginosa and Figure 13 ​The genomic DNA of the bacteria was extracted as the sample to be detected, and the genomic DNA was subjected to RPA amplification according to the detection system of RPA-CRISPR / Cas12b, and then the amplification products were subjected to CRISPR / Cas12b cleavage detection. The fluorescence signal was recorded once per minute. Each pathogenic bacterium was repeated three times, and then the data obtained was analyzed. The detection results are shown in Table 8. Legionella pneumophila As shown in Table 8, the first tube containing Legionella pneumophila (L. pneumophila) showed a positive fluorescence intensity result that was significantly higher than the fluorescence intensity values of the other nine groups, thus proving that the detection system has good specificity. Sample ID

[0223] 3.5 Actual sample detection

[0224] In order to compare the RPA, RPA-CRISPR / Cas12b and traditional detection methods established in this study, 20 water samples were artificially contaminated to different degrees, and the DNA of the entire 20 water samples was extracted by the SDS method and then detected by the three methods. The detection results are shown in Table 9. Among the 20 actual samples, 8 positive samples and 12 negative samples were detected by the RPA method, and 10 positive samples and 10 negative samples were detected by the RPA-CRISPR / Cas12b and ISO detection methods, with a coincidence rate of 100%. This indicates that the RPA-CRISPR / Cas12b detection method established in this study is feasible, and the detection rate is consistent with the traditional detection method.

[0225] Table 9 Detection results of RPA-CRISPR / Cas12b detection method in actual samples

[0226] RPA S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 ISO 11731 :2017 + + + - + + + - + + RPA-CRISPR / Cas 12b + + + + + + + + + + Sample ID + + + + + + + + + + RPA S11 S12 S13 S14 S15 S16 S17 S18 S19 S20 ISO 11731 :2017 - - - - - - - - - - RPA-CRISPR / Cas 12b - - - - - - - - - - ​ - - - - - - - - - -

[0227] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can modify the technical solutions described in the foregoing embodiments, or make equivalent substitutions for part or all of the technical features. Such modifications or substitutions do not cause the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.​

Claims

1. An RPA primer probe for detecting Legionella pneumophila, characterized in that: including upstream primers, downstream primers and probes; The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.1; The nucleic acid sequence of the downstream primer is shown in SEQ ID NO.2; The nucleic acid sequence of the probe is shown in SEQ ID NO. 5, wherein the base N in the nucleic acid sequence is replaced with tetrahydrofuran residue THF.

2. The RPA primer probe for detecting Legionella pneumophila according to claim 1, characterized in that: In the nucleic acid sequence of the probe, the upstream and downstream of the THF site are respectively labeled with a fluorescent group and a quenching group; the quenching group is used to quench the fluorescent group.

3. Use of the RPA primer probe for detecting Legionella pneumophila according to claim 1 or 2 in the preparation of a product for detecting Legionella pneumophila.

4. A RPA detection method for Legionella pneumophila, characterized in that: The following steps are involved: Using the DNA of the sample to be tested as an amplification template, an RPA amplification reaction is performed in an RPA reaction system using the RPA primer probe described in claim 1 or 2, and then the product obtained by the RPA amplification reaction is analyzed.

5. The RPA detection method for Legionella pneumophila according to claim 4, characterized in that: The temperature of the RPA amplification reaction is 39-42°C; The concentration of the primers in the RPA reaction system is 1.25-10 μmol / L.

6. A nucleic acid combination for detecting Legionella pneumophila, characterized in that: Including upstream primers, downstream primers, sgRNA and probes; The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.1; The nucleic acid sequence of the downstream primer is shown in SEQ ID NO.2; The nucleic acid sequence of the sgRNA is shown in SEQ ID NO.7; The nucleic acid sequence of the probe is shown in SEQ ID NO.

10.

7. The nucleic acid combination for detecting Legionella pneumophila according to claim 6, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

8. Use of the nucleic acid combination for detecting Legionella pneumophila according to claim 6 or 7 in the preparation of a product for detecting Legionella pneumophila.

9. A RPA-CRISPR / Cas12b detection method for Legionella pneumophila, characterized in that: The following steps are involved: Using the DNA of the sample to be tested as an amplification template, an RPA amplification reaction is performed in an RPA reaction system using the upstream primer and downstream primer described in claim 6 or 7. Then, the product of the RPA amplification reaction is subjected to a target sequence cleavage reaction in a CRISPR system using the sgRNA and probe described in claim 6 or 7, and the product after the target sequence cleavage reaction is analyzed; The RPA reaction system contains Cas12b protein.

10. The RPA-CRISPR / Cas12b detection method according to claim 9, characterized in that The temperature of the RPA amplification reaction is 37-42° C., and the time is 20-30 min; the temperature of the target sequence cleavage reaction is 37-42° C., and the time is 20-30 min.

Images