TaqMan fluorescent probe for detecting relative expression quantity of target gene

Abstract

The invention discloses a TaqMan fluorescent probe for detecting the relative expression quantity of a target gene, and relates to the technical field of molecular biology detection, and the TaqMan fluorescent probe for detecting the relative expression quantity of the target gene utilizes a pGEX-4T-1 vector; the method comprises the following steps: constructing riemerella anatipestifer antibiotic resistance gene positive plasmids: tetracycline TetM gene, aminoglycoside aphh (3 ') IIa, quinolone qnrS gene and amido alcohol positive plasmids, and detecting four channels of FAM, VI C, ROX and CY5. The invention establishes a fluorescent quantitative PCR (Polymerase Chain Reaction) method aiming at the four genes. The TaqMan fluorescent probe has the technical advantages of rapidness, high sensitivity and strong specificity, and is suitable for monitoring epidemic conditions of drug-resistant genes ah (3 ') IIa, TetM, qnrS and FloR in clinical and livestock breeding industries.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology detection, and particularly relates to a TaqMan fluorescent probe for detecting the relative expression amount of a target gene. BACKGROUND

[0002] Riemerella anatipestifer is one of the main pathogenic bacteria that endanger the duck industry, which can cause acute or chronic septicemia and serositis in ducklings, and the mortality rate is as high as 80%. In recent years, due to the abuse of antibiotics, the drug resistance of the bacteria is becoming more and more serious. Studies have shown that the drug resistance rates of Riemerella anatipestifer in some areas of China to tetracycline, aminoglycosides, quinolones and amphenicol drugs have reached 67.8%, 52.3%, 45.6% and 38.9% respectively. Among them, TetM, aph(3')IIa, qnrS and FloR are the most common drug resistance genes. Traditional drug sensitivity test has a long cycle (2-3 days) and cannot distinguish the drug resistance mechanism. Single-plex PCR can detect drug resistance genes, but has low throughput and high cost.

[0003] Real-time fluorescence quantitative PCR (Quantitative Real-time PCR) is a method that calculates the initial DNA concentration by detecting the change of fluorescence intensity in each cycle during the PCR cycle. It has the advantages of high sensitivity and strong specificity, but a single reaction can only detect one gene. Multiple qPCR can detect multiple genes through multiple fluorescence channels, which can significantly improve the detection efficiency, but high-quality positive plasmid is needed as a standard.

[0004] The theoretical basis of probe qPCR is the use of fluorescence resonance energy transfer phenomenon. There is a pair of fluorescence resonance energy transfer groups on the probe. By using some processes (enzyme cutting, hybridization, etc.) in PCR reaction, the distance between the two groups changes, so that the fluorescence intensity or fluorescence type in the system changes. This change is directly related to the type and amount of PCR product. By detecting this change, we can detect the type and amount of product in the PCR reaction system.

[0005] TaqMan probe method is the most classic probe method, a probe which can be complementary hybridized with amplification product is designed, a fluorescent group (donor) is labeled at the 5' end of the probe, and a quencher group (acceptor) is labeled at the 3' end of the probe, when the probe is complete, the fluorescent group and the quencher group are very close (the length of the probe) due to fluorescence resonance energy transfer, the fluorescent group does not emit fluorescence under the excitation of incident light. When the PCR reaction is carried out, the probe is hybridized on the amplification product, when the primer-mediated extension reaction reaches the position of the probe, because the taq enzyme has 5'-3' exonuclease activity, the probe is cut (hydrolyzed) from the 5' end, so that the 5' end fluorescent group and the 3' end quencher group are separated, and their spacing is more than 10 nm, which is beyond the range of fluorescence resonance energy transfer, so that the fluorescent group can emit fluorescence of its own wavelength under the action of suitable incident light. When the specific probe is hybridized with the corresponding allele, the DNA polymerase is active, the probe is cut and hydrolyzed, and fluorescence is emitted.

[0006] A patent with the patent publication number CN114891864A discloses a TaqMan probe real-time fluorescent quantitative PCR detection composition, and the technical solution points of the patent are as follows: a reverse transcription primer, a downstream primer and a TaqMan probe sequence composition are provided, an upstream primer is designed according to a target gene, and the composition is used together to be used for different gene detection.

[0007] However, the above-mentioned technology often has the following defects: the probe is single detection, the throughput is low, and only clinical samples or synthetic oligonucleotides are used as positive controls, which has a pollution risk and low quantitative accuracy. In actual application, for multiple drug-resistant bacteria, multiple independent reactions need to be carried out, and the detection efficiency is low and the cost is high.

[0008] Therefore, the present application constructs a pGEX-4T-1 positive plasmid containing TetM, aph(3') IIa, qnrS and FloR, which can simultaneously detect four channels of FAM, VIC, ROX and CY5. The four-channel multiplex qPCR platform based on the Bio-Rad PCR instrument can realize "one tube four detection", which meets the rapid diagnosis demand. SUMMARY

[0009] The purpose of the present application is to solve the above-mentioned technical problems, and to provide a TaqMan fluorescent probe for detecting the relative expression amount of a target gene, and the purpose of the present application is to:

[0010] This method addresses the technical bottleneck of simultaneous detection of multiple drug-resistance genes. Traditional single-plex PCR or real-time fluorescence quantitative PCR (qPCR) can only detect one gene at a time, and detecting multiple resistance genes requires several independent reactions, which is time-consuming and labor-intensive. This method optimizes primer concentration ratios and probe quencher group combinations to establish a quadruple qPCR system, enabling simultaneous detection of four genes in a single tube, shortening detection time and reducing costs. The pGEX-4T-1 recombinant positive plasmid was constructed, which has high copy number stability and can be used as a template for quantitative standard curves.

[0011] The technical solution adopted by the present invention to solve the technical problem is: a TaqMan fluorescent probe for detecting the relative expression level of a target gene, wherein the TaqMan fluorescent probe is a probe designed and synthesized based on the specific sequence of the drug-resistant gene;

[0012] The drug-resistant genes in the positive plasmids were detected by multiplex real-time fluorescence quantitative PCR technology, wherein the PCR technology for detecting drug-resistant genes includes detection of four channels: FAM, VIC, ROX and CY5;

[0013] The FAM channel detects the aph(3')Ⅱa gene;

[0014] The VIC channel detects the TetM gene;

[0015] The ROX channel detects the qnrS gene;

[0016] The CY5 channel detects the FloR gene.

[0017] A further improvement of the present invention is that the positive plasmid comprises a pGEX-4T-1 vector backbone and an inserted Riemerella anatipestifer TetM, aph(3')Ⅱa, qnrS or FloR gene sequence to obtain a DNA template.

[0018] A further improvement of the present invention is that the multiplex real-time fluorescence quantitative PCR technique is used to detect drug-resistant genes in positive plasmids, further comprising the following steps:

[0019] S1. Design specific primers and probes for TetM, aph(3')Ⅱa, qnrS and FloR genes;

[0020] S2. Mix the primers, probe, recombinant DNA molecule and Fast qPCR Mix suitable for the probe method in proportion to form a fluorescent quantitative PCR reaction system;

[0021] S3. Performing fluorescent quantitative PCR amplification on the PCR reaction system, and judging the presence of drug-resistant genes in the DNA template according to the amplification curve and CT value of each channel.

[0022] The further improvement of the present application is that in the S1, when the target gene is aph(3')IIa gene, the upstream primer aph(3')IIa-F is selected as GGCAGGAGCAAGGTGAGATGAC, and the downstream primer aph(3')IIa-R is selected as GTGCTCGACGTTGTCACTGAAG.

[0023] The further improvement of the present application is that in the S1, when the target gene is TetM gene, the upstream primer TetM-F is selected as GATTATATGGTTGGAATGTGACGG, and the downstream primer TetM-R is selected as TCTAAAGGCTTGCTCCAGTA CAATAG.

[0024] The further improvement of the present application is that in the S1, when the target gene is qnrS gene, the upstream primer qnrS-F is selected as TGATGCAAGTTTCCAACAATGC, and the downstream primer qnrS-R is selected as TAAATCACACGCACGGAACTC.

[0025] The further improvement of the present application is that in the S1, when the target gene is FloR gene, the upstream primer FloR-F is selected as GCCCTATCGCCGGAGTATTG, and the downstream primer FloR-R is selected as GCATCGCCAGTATAGCCAAAG.

[0026] The further improvement of the present application is that in the S1, when the target gene is aph(3')IIa gene, the sequence of the probe aph(3')IIa-P is 5'-CTGGCTGCTATTGGGCGAAGTGC-3', the 5' end is labeled with FAM, and the 3' end is labeled with BHQ1.

[0027] The further improvement of the present application is that in the S1, when the target gene is TetM gene, the sequence of the probe TetM-P is 5'-TCCGAAAATCTGCTGGAGTACTAACAGG-3', the 5' end is labeled with VIC, and the 3' end is labeled with BHQ1.

[0028] The further improvement of the present application is that in the S1, when the target gene is qnrS gene, the sequence of the probe qnrS-P is 5'-TACCGTAGCAATTGGCATTACTGAAGTT-3', the 5' end is labeled with ROX, and the 3' end is labeled with BHQ2.

[0029] The further improvement of the present application is that in the S1, when the target gene is FloR gene, the sequence of the probe FloR-P is 5'-CTGGCTGCTATTGGGCGAAGTGC-3', the 5' end is labeled with CY5-M, and the 3' end is labeled with BHQ2.

[0030] The further improvement of the application is that in the S2, the reaction system of the fluorescent quantitative PCR is: 10 muL of Fast qPCR Mix suitable for the probe method, 0.7 muL of an upstream primer, 0.7 muL of a downstream primer, 0.6 muL of a probe, 1 muL of a DNA template and 7 muL of double-distilled water.

[0031] The further improvement of the application is that in the S3, the reaction procedure of the fluorescent quantitative PCR amplification is: 95 DEG C pre-denaturation for 30 s, 95 DEG C denaturation for 5 s, 60 DEG C annealing / extension for 10 s, and a total of 40 cycles, and the fluorescence signal is collected at the 60 DEG C stage.

[0032] The further improvement of the application is that in the S3, the Probe qPCR SuperMix E401-01A containing UDG is used for rapid amplification.

[0033] The beneficial effects of the application are as follows:

[0034] 1. The application breaks through the limitation of traditional probe detection of a single gene by constructing a duck Riemerella anatipestifer multiple drug resistance gene positive plasmid, realizes synchronous and accurate detection of multiple genes, develops TaqMan fluorescent probes for target genes, inserts drug resistance genes such as TetM and aph(3')IIa into the pGEX-4T-1 vector, creates a standardized positive plasmid template, avoids the complicated process of multiple probe design and synthesis, reduces the interference of experimental system differences through a unified vector framework, and provides a more efficient tool for rapid screening of pathogenic drug resistance genes by using specific primers and real-time fluorescent PCR system in the "one-pot multi-detection" mode.

[0035] 2. In the actual detection scene, the TaqMan fluorescent probes for target genes constructed by the application can be used to detect the relative expression of target genes or to do copy number analysis for absolute quantification. The positive plasmid can stably provide multiple target gene references, help laboratories quickly verify the effectiveness of the detection system, and greatly simplify the standardized PCR process. The application adapts to the detection needs of primary and high-throughput detection, accurately identifies drug resistance genes through CT value and amplification curve double determination, provides accurate data support for duck Riemerella anatipestifer drug resistance monitoring and epidemiological investigation, and promotes the popularization and application of veterinary clinical detection technology, and helps upgrade the disease prevention and control system of the breeding industry. BRIEF DESCRIPTION OF DRAWINGS

[0036] The application will be further described below with reference to the drawings.

[0037] Figure 1is the agarose gel electrophoresis map of plasmid DNA restriction enzyme verification; Figure 1 A is aph(3') IIa gene; B is TetM gene; C is qnrS gene; D is FloR gene;

[0038] Figure 2 is the amplification curve of aph(3') IIa gene plasmid quadruple TaqMan fluorescent quantitative PCR experiment;

[0039] Figure 3 is the amplification curve of TetM gene plasmid quadruple TaqMan fluorescent quantitative PCR experiment;

[0040] Figure 4 is the amplification curve of qnrS gene plasmid quadruple TaqMan fluorescent quantitative PCR experiment;

[0041] Figure 5 is the amplification curve of FloR gene plasmid quadruple TaqMan fluorescent quantitative PCR experiment;

[0042] Figure 6 is the standard curve; Figure 6 A is drug resistance gene aph(3') IIa; Figure 6 B is drug resistance gene TetM; Figure 6 C is drug resistance gene qnrS; Figure 6 D is drug resistance gene FloR. DETAILED DESCRIPTION

[0043] In order to make the technical means, creative features, purposes and effects of the present application easy to understand, the present application is further described below in combination with specific embodiments.

[0044] A TaqMan fluorescent probe for detecting the relative expression amount of a target gene is a probe designed and synthesized according to the specific sequence of a drug resistance gene, and the drug resistance gene in a positive plasmid is detected by a multiplex real-time fluorescent quantitative PCR technique, and the drug resistance gene is detected by a PCR technique, including detection of four channels of FAM, VIC, ROX and CY5; the FAM channel detects the aph(3') IIa gene; the VIC channel detects the TetM gene; the ROX channel detects the qnrS gene; and the CY5 channel detects the FloR gene.

[0045] Further comprising the following steps:

[0046] S1, designing specific primers and probes for TetM, aph(3') IIa, qnrS and FloR genes;

[0047] S2, the primer, probe, recombinant DNA molecule and Fast qPCR Mix suitable for probe method are mixed in proportion to form a fluorescent quantitative PCR reaction system;

[0048] S3, the PCR reaction system is subjected to fluorescent quantitative PCR amplification, and the presence of the drug-resistant gene in the DNA template is determined according to the amplification curve and CT value of each channel.

[0049] In S1, when the target gene is aph(3')IIa gene, the upstream primer aph(3')IIa-F is selected as GGCAGGAGCAAGGTGAGATGAC, the downstream primer aph(3')IIa-R is selected as GTGCTCGAC GTTGTCACTGAAG; when the target gene is TetM gene, the upstream primer TetM-F is selected as GATTATATGGTTGGAATGTGACGG, the downstream primer TetM-R is selected as TCTAAAGGCTTGCTCCAGTA CAATAG; when the target gene is qnrS gene, the upstream primer qnrS-F is selected as TGATGCAA GTTTCCAACAATGC, the downstream primer qnrS-R is selected as TAAATCACACGCACGGAACTC; when the target gene is FloR gene, the upstream primer FloR-F is selected as GCCCTATCGCCGGAGTATTG, and the downstream primer FloR-R is selected as GCATCGCCAGTATAGCCAAAG.

[0050] In S1, when the target gene is aph(3')IIa gene, the sequence of the probe aph(3')IIa-P is 5'-CTGGCTGCTATTGGGCGAAGTGC-3', the 5' end is labeled with FAM, and the 3' end is labeled with BHQ1; when the target gene is TetM gene, the sequence of the probe TetM-P is 5'-TCCGAAAATCTGCTGGAGT ACTAACAGG-3', the 5' end is labeled with VIC, and the 3' end is labeled with BHQ1; when the target gene is qnrS gene, the sequence of the probe qnrS-P is 5'-TACCGTAGCAATTGGCATTACTGAAGTT-3', the 5' end is labeled with ROX, and the 3' end is labeled with BHQ2; when the target gene is FloR gene, the sequence of the probe FloR-P is 5'-CTGGCTGCTATTGGGCGAAGTGC-3', the 5' end is labeled with CY5-M, and the 3' end is labeled with BHQ2.

[0051] In S2, the reaction system of the fluorescent quantitative PCR is: 10 μL of Fast qPCR Mix suitable for the probe method, 0.7 μL of the upstream primer, 0.7 μL of the downstream primer, 0.6 μL of the probe, 1 μL of the DNA template, and 7 μL of double-distilled water.

[0052] In S3, the reaction procedure of the fluorescent quantitative PCR amplification is: 95 °C pre-denaturation for 30 s, 95 °C denaturation for 5 s, 60 °C annealing / extension for 10 s, 40 cycles in total, and the fluorescence signal is collected at the 60 °C stage.

[0053] In S3, the Probe qPCR SuperMix E401-01A containing UDG is used for rapid amplification. If the amplification curve of a certain channel of the specimen is in a typical "S" shape, and the CT value is < 35, the corresponding fluorescence is used to determine that the drug resistance gene is positive, and the positive means that the drug resistance gene exists.

[0054] Further, in order to facilitate the description of the technical scheme of the present application, the following provides specific embodiments:

[0055] Embodiment one: design and preparation of primers

[0056] A large number of sequence analysis and comparison are performed to obtain several primers for detecting the drug resistance genes aph(3')IIa / TetM / qnrS / FloR. The primers are pre-tested, and the performances such as sensitivity and specificity are compared, and finally the probe and primer group for detecting the drug resistance genes are obtained, which are specifically shown in Table 1.

[0057] Table 1: probe and primer information table of aph(3')IIa / TetM / qnrS / FloR genes

[0058]

[0059]

[0060] The primer aph(3')IIa-F and the primer aph(3')IIa-R constitute primer pair I;

[0061] The primer TetM-F and the primer TetM-R constitute primer pair II;

[0062] The primer qnrS-F and the primer qnrS-R constitute primer pair III;

[0063] The primer FloR-F and the primer FloR-R constitute primer pair IV.

[0064] Embodiment two: construction of positive plasmid standard

[0065] The four plasmid standards are as follows: Figure 1Lane 1: uncut plasmid DNA; Lane 2: cut information missing; Lane M: DNA Marker (molecular weight standard) for estimating the fragment size of the sample DNA. The molecular weight of the two markers (DL5000 and 1 kb DNA Ladder) is marked on the right side of the figure, and the length of the sample fragment can be determined according to the position of the band.

[0066] 1. As shown in A of the Figure 1 The positive plasmid containing the aph(3')IIa drug resistance gene of Riemerella anatipestifer was constructed, the vector was pGEX-4T-1, and the target gene (729 bp in length) was inserted through the BamHI+EcoRI enzyme cutting site;

[0067] 2. As shown in B of the Figure 1 The positive plasmid containing the TetM drug resistance gene of Riemerella anatipestifer was constructed, the vector was pGEX-4T-1, and the target gene (669 bp in length) was inserted through the BamHI-EcoRI enzyme cutting site;

[0068] 3. As shown in C of the Figure 1 The positive plasmid containing the qnrS drug resistance gene of Riemerella anatipestifer was constructed, the vector was pGEX-4T-1, and the target gene (429 bp in length) was inserted through the BamHI-EcoRI enzyme cutting site;

[0069] 4. As shown in D of the Figure 1 The positive plasmid containing the FloR drug resistance gene of Riemerella anatipestifer was constructed, the vector was pGEX-4T-1, and the target gene (380 bp in length) was inserted through the BamHI-EcoRI enzyme cutting site;

[0070] The plasmid integrity and enzyme cutting were verified by electrophoresis, indicating that the four plasmids were successfully constructed.

[0071] Example Three: Primer verification of positive plasmid standard

[0072] Test sample: plasmid standard prepared in Example Two.

[0073] Using the test sample as the template, primer pair I to primer pair IV in Example One were subjected to PCR amplification, respectively.

[0074] PCR amplification reaction system (20 μL): 10 μL of Fast qPCR Mix suitable for probe method, 0.7 μL of upstream primer (10 uM), 0.7 μL of downstream primer (10 uM), 0.6 μL of probe (10 uM), 1 μL of DNA template, and 7 μL of double distilled water.

[0075] The negative control is prepared by adding only Fast qPCR Mix, primers, probes and other reagents without adding the sample to be tested.

[0076] PCR amplification reaction procedure: 95℃ pre-denaturation for 30s, 95℃ denaturation for 5s, 60℃ annealing / extension for 10s, a total of 40 cycles, and the fluorescence signal is collected at 60℃ stage.

[0077] The results show that, as shown in Figure 2 , primer pair I can achieve specific amplification of aph(3')IIa plasmid standard, and cannot achieve amplification of the remaining drug resistance gene plasmid standard. As shown in Figure 3 , primer pair II can achieve specific amplification of TetM plasmid standard, and cannot achieve amplification of the remaining drug resistance gene plasmid standard. As shown in Figure 4 , primer pair III can achieve specific amplification of qnrS plasmid standard, and cannot achieve amplification of the remaining drug resistance gene plasmid standard. As shown in Figure 5 , primer pair IV can achieve specific amplification of FloR plasmid standard, and cannot achieve amplification of the remaining drug resistance gene plasmid standard.

[0078] Example Four: Establishment of Standard Curve

[0079] 1. Calculate the copy number of the plasmid standard, and the calculation formula is: copy number = 6.02 x 10 23 x plasmid concentration / (660 x plasmid length)

[0080] 2. Dilute the plasmid standard into different concentration gradients (10 3 , 10 4 , 10 5 , 10 6 , 10 7 times).

[0081] 3. Perform fluorescent quantitative PCR on aph(3')IIa plasmid standard of different concentrations using primer pair I; perform fluorescent quantitative PCR on TetM plasmid standard of different concentrations using primer pair II; perform fluorescent quantitative PCR on qnrS plasmid standard of different concentrations using primer pair III; perform fluorescent quantitative PCR on FloR plasmid standard of different concentrations using primer pair IV.

[0082] 4. As shown in Tables 2, 3, 4 and 5, after dilution of the positive plasmid standard, real-time fluorescent quantitative PCR detection is performed using different concentrations of the standard as the template, primers and probes. After the detection is completed, the standard curve is drawn by fitting the linear regression equation with the log value of the standard copy number as the X axis and the average Ct value as the Y axis.

[0083] Table 2 Construction of aph(3')IIa gene standard curve and amplification efficiency

[0084]

[0085]

[0086] Table 3 Standard curve construction and amplification efficiency of TetM gene

[0087]

[0088]

[0089] Table 4 Standard curve construction and amplification efficiency of qnrS gene

[0090]

[0091]

[0092] Table 5 Standard curve construction and amplification efficiency of FloR gene

[0093]

[0094]

[0095] The standard curve of the fluorescence quantitative PCR detection of the plasmid standard is shown in Table 5. Figure 6 Table 5 Standard curve construction and amplification efficiency of FloR gene Figure 6 Among them, A is the standard curve of aph(3')IIa gene (the standard curve equation is y = -3.2897x + 40.824), B is the standard curve of TetM gene (the standard curve equation is y = -3.378x + 43.138), C is the standard curve of qnrS gene (the standard curve equation is y = -3.4156x + 42.79), and D is the standard curve of FloR gene (the standard curve equation is y = -3.5627x + 43.506). The four standard curves and equations provide a reliable benchmark for the qPCR quantitative analysis of the four drug resistance genes aph(3')IIa, TetM, qnrS and FloR, and the copy number of the above drug resistance genes in the sample can be accurately detected through these curves.

[0096] The above results show that the positive plasmid for Riemerella anatipestifer TetM, aph(3') IIa, qnrS and FloR drug resistance genes is constructed by innovation, and the TaqMan fluorescent probe for the target gene is developed, so that the probe can be used for detecting the relative expression amount of the target gene or for absolute quantification for copy number analysis. The defects of low detection efficiency, high cost and complicated operation of the existing probe detection technology are successfully overcome. The system realizes the synchronous and accurate detection of the four drug resistance genes through the synergistic effect of specific primer design and multi-channel fluorescence detection, not only greatly shortens the detection period and reduces the design and synthesis cost, but also improves the stability and reliability of the detection results by virtue of the application of the standardized positive plasmid template. From sample nucleic acid extraction to result determination based on amplification curve and CT value, the whole process is suitable for conventional laboratory conditions, which provides efficient, economical and practical technical support for rapid screening, epidemiological monitoring and clinical prevention and control of Riemerella anatipestifer multidrug resistance, and has important academic value and application prospect.

[0097] The basic principles, main features and advantages of the present application are shown and described above. Those skilled in the art should understand that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. A TaqMan fluorescent probe for detecting the relative expression level of a target gene, characterized in that: The TaqMan fluorescent probe is designed and synthesized according to the specific sequence of the drug-resistant gene, and the drug-resistant gene in the positive plasmid is detected by multiple real-time fluorescence quantitative PCR technology. The PCR technology for detecting drug-resistant genes includes the detection of FAM, VIC, ROX and CY5; The FAM channel detects the aph(3')Ⅱa gene; The VIC channel detects the TetM gene; The ROX channel detects the qnrS gene; The CY5 channel detects the FloR gene.

2. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 1, wherein: The positive plasmid comprises a pGEX-4T-1 vector skeleton and inserted Riemerella anatipestifer TetM, aph(3')Ⅱa, qnrS and FloR gene sequences to obtain a DNA template.

3. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 1, wherein: The multiplex real-time fluorescence quantitative PCR method for detecting drug-resistant genes in positive plasmids further comprises the following steps: S1. Design specific primers and probes for TetM, aph(3')Ⅱa, qnrS and FloR genes; S2, mixing the primers, probe, recombinant DNA molecule and Fast qPCR Mix suitable for the probe method to form a fluorescent quantitative PCR reaction system; S3. Performing fluorescent quantitative PCR amplification on the PCR reaction system, and judging the presence of drug-resistant genes in the DNA template according to the amplification curve and CT value of each channel.

4. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 3, wherein: The S1 also includes the following settings: When the target gene is aph(3')Ⅱa, the upstream primer aph(3')Ⅱa-F is selected as GGCAGGAGCAAGGTGAGATGAC; the downstream primer aph(3')Ⅱa-R is selected as GTGCTCGACGTTGTCA CTGAAG; When the target gene is TetM gene, the upstream primer TetM-F is selected as GATTATATGGTT GGAATGTGACGG; the downstream primer TetM-R is selected as TCTAAAGGCTTGCTCCAGTACAATAG; When the target gene is qnrS gene, the upstream primer qnrS-F is selected as TGATGCAAGTTTCCAACAATGC; the downstream primer qnrS-R is selected as TAAATCACACGCACGGAACTC; When the target gene to be detected is the FloR gene, the upstream primer FloR-F is selected as GCCCTATCGCGGAGTATTG; the downstream primer FloR-R is selected as GCATCGCCAGTATAGCCAAAG.

5. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 3, wherein: Said S1 also includes the following settings: When the target gene is aph(3')Ⅱa, the sequence of the probe aph(3')Ⅱa-P is 5'-CTGGCTGCTATTGGGCGAAGTGC-3', with FAM labeled at the 5' end and BHQ1 labeled at the 3' end; When the target gene is TetM, the sequence of the probe TetM-P is 5'-TCCGAAAATCTGCTGGAGTACTAACAGG-3', with VIC labeled at the 5' end and BHQ1 labeled at the 3' end; When the target gene is qnrS gene, the sequence of the probe qnrS-P is 5′-TACCGTAGCAATTGGCATTACTGAAGTT-3′, with ROX labeled at the 5′ end and BHQ2 labeled at the 3′ end; When the target gene is FloR, the sequence of the probe FloR-P is 5'-CTGGCTGCTAT TGGGCGAAGTGC-3', with the 5' end labeled with CY5-M and the 3' end labeled with BHQ2.

6. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 3, wherein: In S2, the reaction system of fluorescent quantitative PCR is: 10 μL Fast qPCR Mix suitable for the probe method, 0.7 μL upstream primer, 0.7 μL downstream primer, 0.6 μL probe, 1 μL DNA template, and 7 μL double-distilled water.

7. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 3, wherein: In S3, the reaction procedure of fluorescence quantitative PCR amplification is: 95°C pre-denaturation for 30s, 95°C denaturation for 5s, 60°C annealing / extension for 10s, a total of 40 cycles, and the fluorescence signal is collected at the 60°C stage.

8. The TaqMan fluorescent probe for detecting the relative expression level of a target gene according to claim 3, wherein: In S3, UDG-containing Probe qPCR SuperMix E401-01A was used for amplification. If the channel amplification curve of the sample was S-shaped and the CT value was less than 35, the presence of the drug-resistant gene was determined based on the corresponding fluorescence.

Images