Specific dCAPS primer pair of SNP closely linked with capsaicin substance content and application of specific dCAPS primer pair
By developing SNP-specific dCAPS primer pairs that are tightly linked to the content of capsaicinoids, and using PCR detection and enzyme cutting technology, the problem of screening the content of capsaicinoids in pepper materials was solved, and the efficiency of pepper breeding was improved.
Patent Information
- Application Number
- CN202510925902.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies make it difficult to efficiently screen and identify the content of capsaicinoids in pepper materials, which affects the efficiency of pepper molecular genetic breeding.
A specific dCAPS primer pair for a SNP closely linked to the content of capsaicinoids was developed. The capsaicinoid content was determined based on the size of the amplified fragment through PCR detection and BsmI digestion. Specific primers Pun1-BsmI-F and Pun1-BsmI-R were designed for screening pepper seedlings.
It has achieved the rapid screening of different capsaicinoid contents at the pepper seedling stage, reduced the workload of determining the content of capsaicinoids, and improved the efficiency of screening spiciness materials, which has important significance for molecular marker-assisted selection breeding.
Smart Images

Figure CN120796544A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of agricultural biotechnology, in particular to a specific dCAPS primer pair of SNP closely linked to capsaicinoid content and application thereof. BACKGROUND
[0002] At present, the recombination inbred lines of shrub pepper 'acc.2814-6' and Chinese pepper 'NuMex RNA KY' have been used as a population, phenotypic measurement is carried out on the population, and a high-density EST genetic map is constructed, the phenotypes and the genetic map are linked, and QTL sites related to each trait are located, 12 QTL sites related to capsaicin content level. It has been reported that the SSR marker CAMS-142 is found to be significantly related to the levels of capsaicin and dihydrocapsaicin on chromosome 1; two QTL sites of capsaicin content (qcap3.1 and qcap6.1) are detected on LG3 and LG6 chromosomes, two QTL sites related to dihydrocapsaicin content (qhdc2.1 and qhdc2.2) are detected on LG2 chromosome; a major QTL is located on chromosome 6, and a total of 15 QTLs of capsaicin content are found on chromosomes 3, 6 and 1. It can be seen that the molecular marker with high phenotypic correlation plays a very important role in breeding, gene and QTL positioning and breeding. SUMMARY
[0003] The present application aims to provide a specific dCAPS primer pair of SNP closely linked to capsaicinoid content.
[0004] The present application further aims to provide the application of the above-mentioned specific dCAPS primer pair of SNP closely linked to capsaicinoid content.
[0005] The specific dCAPS primer pair of SNP closely linked to capsaicinoid content according to the present application comprises the following primers:
[0006] The forward primer is Pun1-BsmI-F: 5' ATGATCAAACCTCGTCTACCACGGAAT 3',
[0007] The reverse primer is Pun1-BsmI-R: 5' TGGCAGTTTCCCTTCTCTCA 3'.
[0008] The method for identifying the capsaicinoid content of pepper material according to the present application comprises the step of performing PCR detection on the pepper material to be tested by using the following primer pair:
[0009] The forward primer is Pun1-BsmI-F: 5' ATGATCAAACCTCGTCTACCACGGAAT 3',
[0010] The reverse primer is Pun1-BsmI-R: 5' TGGCAGTTTCCCTTCTCTCA 3'.
[0011] The method for identifying the capsaicinoid content of pepper material according to the present application,
[0012] The amplified fragment size is 207 bp, the endonuclease is BsmI, the enzyme cutting site is GAATGCN↓ / CTTAC↑GN, the fragment size after enzyme cutting is 207 bp for "PI152225" and 179 bp for "PBC932". In the selfing line of the pepper homozygous natural population, the marker is used for detection, and the pungency value of the pepper homozygous natural population is determined according to the size of the amplified fragment. In the F2 population of "PBC932" x "PI152225", when the amplified fragment size is 207 bp, the pungency value is less than 100000 SHU, and when the amplified fragment size is 179 bp, the probability pungency value is greater than 100000 SHU.
[0013] By using the technical scheme of the present application, different capsaicinoid content peppers can be screened in the pepper seedling stage, the capsaicinoid content determination work is reduced, the screening of different pungency materials is accelerated, and the molecular genetic breeding of different pungency peppers has a very important role.
[0014] Since the marker is inside the gene Cchi02g002095 and has a very high identification rate of the gene, it has important significance for molecular marker assisted selection breeding. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 The results of typing by using the marker of the present application are shown, wherein a figure: gene typing, marker Pun1-BsmI agarose electrophoresis figure, M: marker D50; b figure: marker dCAPS. Pun1. BsmI agarose electrophoresis figure, the length of the PCR amplified product is 179 bp and 207 bp. DETAILED DESCRIPTION
[0016] Marker development and screening material: high pungency material "PBC932" and low pungency material "PI152225", "PBC932" x "PI152225" F1 population;
[0017] Marker application verification material: using high pungency material "PBC932" and low pungency material "PI152225", an F2 population is constructed, and the F2 population is used for QTL positioning. The phenotype is identified by high performance liquid chromatography.
[0018] In the following examples, with PBC932 as the reference genome (Zhang et al., 2025, https: / / ngdc.cncb.ac.cn / gwh / ), there is a single base mutation at 150448409 bp on chromosome 2 in PI152225 plant material, and this mutation is inside the gene Cchi02g002095 (Pun1). A molecular marker is designed based on this mutation, which is named marker dCAPS_Pun1, with an amplification fragment size of 207 bp, endonuclease: Bsm I, enzyme cleavage site: GAATGCN↓ / CTTAC↑GN, fragment size after enzyme cleavage, "PI152225" is 207 bp, and "PBC932" is 179 bp. This marker is applied to F2 for verification application.
[0019] Example 1: Development of SNP closely linked to capsaicinoid content
[0020] Marker development and screening materials: "PBC932" (highly pungent material) and "PI152225" (low pungent material), F1 of "PBC932" x "PI152225".
[0021] Establishment process of genetic map: alignment of differential sites of parents, whole genome resequencing of single plants of F2 population, conversion of single plant genotypes after exporting F2 resequencing results as vcf files, genotypes identical to "PI152225" are assigned a value of "0", genotypes identical to "PBC932" are assigned a value of "2", and genotypes identical to "F1" are assigned a value of "1", genotype data of F2 population is sorted, and a chromosome genetic linkage map is constructed using QTL IciMapping, setting regions with LOD values exceeding 3.0 as QTL sites, and establishing a genetic linkage map.
[0022] Process and results of phenotype-genotype association analysis: phenotypic identification of F2, measurement of capsaicinoids in single plants of F2 using high performance liquid chromatography, mapping based on genetic linkage map and bip files of genotypes and phenotypes using QTL IciMapping, and calculation of phenotypic contribution rate (PVE) of each site. After initial determination, InDel markers are designed based on the initial positioning results to verify the initial positioning results, and finally a major QTL, qCC2.1, is determined on chromosome 2, at 150426785-152434591 bp, with a contribution rate of 24.20%.
[0023] The main QTL of capsaicin content is located to chromosome 2 150426785-152434591 bp (reference genome PBC932, Zhang et al., 2025, https: / / ngdc.cncb.ac.cn / gwh / ), and there is a single base mutation at 150448409 bp. In the F2 population, 236 single plants are counted, and the correlation coefficient between the marker and the capsaicin content reaches 0.504**qCC2.1 (near gene Cchi02g002095). It is named dCAPS_Pun1, and a dCAPs marker specific primer is designed:
[0024] The forward primer is Pun1-BsmI-F: 5' ATGATCAAACCTCGTCTACCACGGAAT 3',
[0025] The reverse primer is Pun1-BsmI-R: 5' TGGCAGTTTCCCTTCTCTCA 3'.
[0026] Analysis result: The marker is applied to "PI152225" and "PBC932", "PBC932" x "PI152225" F1, and agarose gel electrophoresis detection is performed. The amplified fragment size is 207 bp. After being digested by endonuclease BsmI, the fragment size is 207 bp for "PI152225", 179 bp for "PBC932", and two bands, 207 bp and 179 bp, for F1 (a figure in the middle). Figure 1
[0027] It is indicated that the marker can genotype high-pungency materials and low-pungency materials. The agarose gel electrophoresis result of high-pungency materials is 179 bp, and the agarose gel electrophoresis result of low-pungency materials is 207 bp.
[0028] Example 2 Application of specific primer of molecular marker linked to capsaicinoid content of the application in breeding
[0029] The marker is applied to F2 for verification application. The following system and procedure are used for agarose gel electrophoresis detection of the F2 population. Run 3% agarose gel electrophoresis for 1 h 40 min.
[0030] The detection result is counted, and after counting, the genotype is assigned. The genotype of "A" (the same as the parent "PI152225", the phenotype is low pungency) is assigned as "1", the genotype of "B" (the same as the parent "PBC932", the phenotype is high pungency) is assigned as "3", and the genotype of "H" (the same as F1) is assigned as "2". The SPSS software is used for correlation analysis.
[0031] Analysis result: in F2 population, 236 single plants are analyzed, the correlation coefficient of the marker and the capsaicin content reaches 0.504**, when the threshold value is 100000 SHU, 91.94% of the materials less than 100000 SHU have A at the site except the heterozygote, and 74.54% of the materials greater than 100000 SHU have G at the site except the heterozygote. Figure 1 Fig. 2
[0032] The above examples are only for understanding the technical solutions of the present application, and do not limit the protection scope of the present application.
Claims
1. A dCAPS primer pair specific for a SNP closely linked to the capsaicinoid content, characterized in that: The specific dCAPS primer pair for the SNP closely linked to the capsaicinoid content includes the following primers: The forward primer is Pun1-BsmI-F: 5'ATGATCAAACCTCGTCTACCACGGAAT3', The rear primer was Pun1-BsmI-R: 5'TGGCAGTTTCCCTTCTCTCA3'.
2. Use of the dCAPS primer pair specific for the SNP tightly linked to the capsaicinoid content according to claim 1 for screening the capsaicinoid content of pepper materials.
3. A method for assisting in screening the capsaicinoid content of pepper materials at the pepper seedling stage, characterized in that: The method comprises the following steps: Extracting genomic DNA from pepper materials to be tested; The following primers were used to perform PCR amplification on the genomic DNA of the pepper material to be tested: The forward primer is Pun1-BsmI-F: 5'ATGATCAAACCTCGTCTACCACGGAAT3', The rear primer was Pun1-BsmI-R: 5′TGGCAGTTTCCCTTCTCTCA3′; PCR products were detected by electrophoresis.
4. The method for assisting in screening the capsaicinoid content of pepper materials at the pepper seedling stage according to claim 3, wherein: When the amplified fragment size is 207 bp, the spiciness value is less than 100,000 SHU. When the amplified fragment size is 179 bp, the probability spiciness value is greater than 100,000 SHU.