KASP molecular marker primer for detecting recessive epigenic male sterility BnMs3 and Bnms3 of brassica napus as well as application and method of KASP molecular marker primer

Abstract

The invention belongs to the field of genetic breeding, and relates to molecular breeding, in particular to a KASP molecular marker primer for detecting recessive epigenic male sterility BnMs3 and Bnms3 of cabbage type rape as well as application and a method of the KASP molecular marker primer. The KASP molecular marker primer comprises a specific primer X, a specific primer Y and a universal primer; wherein the sequence of the specific primer X is as shown in SEQ ID No. 1, the sequence of the specific primer Y is as shown in SEQ ID No. 2, and the sequence of the universal primer is as shown in SEQ ID No. 3. Based on the difference site, the KASP marker is developed for distinguishing the genotypes of the Bnms3 and the BnMs3, a good distinguishing effect is achieved, and high-efficiency, low-cost and high-throughput identification of the purity of the rape hybrid and auxiliary selective breeding can be realized.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic breeding, and relates to molecular breeding, in particular to a method for genotyping by using sequence differences of alleles. BACKGROUND

[0002] Male sterility is an important way for Brassica napus hybrid utilization. The recessive epistatic cytoplasmic male sterility system of Brassica napus is a nuclear sterile system controlled by the interaction of recessive sterile genes and recessive epistatic inhibition genes (Chen et al., Crop Science, 1998, 24(4):431-438). The system is obtained by hybridization of homozygous "two-type lines" and "temporary preservation lines", and then hybridization of the full sterile line and "restoration lines" (any ordinary variety) to produce F1 hybrid "three-line" utilization mode (Patent No.: 97125803.1). The system has high sterility and stable sterility, and ordinary rapeseed varieties are its natural restoration lines, which overcomes the disadvantages of traditional recessive nuclear sterile "two-line method" for seed production, i.e. the need for artificial removal of 50% fertile plants. Since the system was proposed, many breeding units have applied it, and so far, several hybrid rapeseed varieties have been successfully bred for production. With the wide application of the sterile system and the increasing amount of seed production, rapid and accurate identification of hybrid seed purity has become a problem for those skilled in the art. The traditional identification method requires planting seeds to the flowering stage, observing the morphological characteristics (such as leaf color, shape), plant type, flower color and other characteristics of seedlings, relying on long-term experience accumulation and subjective experience of professional personnel, and the identification standards of different batches are easily affected by subjective judgment and planting methods. Moreover, with the increase of planting area and seed demand, it is urgent to explore a fast and accurate purity identification method to meet the rapid detection needs before the seeds are put on the market. SUMMARY

[0003] The present application provides a KASP molecular marker primer for detecting recessive epistatic nuclear sterile BnMs3 and Bnms3, and an application and method thereof, which solves the problem of using KASP markers to distinguish the genotypes of Bnms3 and BnMs3 and then identify the heterozygosity of seeds.

[0004] The technical solution of the present application is as follows:

[0005] The present application develops related KASP molecular marker primers based on the sequence differences of recessive epistatic nuclear sterile genes BnMs3 and Bnms3:

[0006]

[0007] wherein GAAGGTGACCAAGTTCATGCT FAM is a fluorescent linker sequence; HEX is a fluorescent linker sequence.

[0008] The application also provides a genotyping method based on the above KASP molecular marker primer, and the steps are as follows:

[0009] (1) PCR amplification is carried out with the KASP molecular marker primer as a primer;

[0010] (2) After the PCR amplification is completed, the fluorescence signal of the reaction system is scanned;

[0011] (3) The scanning data of step (2) are analyzed and genotyped.

[0012] The PCR amplification system is as follows:

[0013] Final concentration Actual amount used 100 μΜ Primer C 0.375 μΜ 0.0030 μΐ 100 μΜ Primer X 0.15 μΜ 0.0012 μΐ 100 μΜ Primer Y 0.15 μΜ 0.0012 μΐ 2 x KASP Master Mix 1× 0.4 μΐ Ultra-pure water 0.3946 μΐ DNA (dry) 10 ng - 20 ng Total volume 0.8 μΐ

[0014] The extraction method of DNA (dry) in the system is as follows: the cotyledon is taken into a 96 deep well plate, 2 stainless steel beads are added, the extraction solution is added and grinded on an automatic grinder for 3 min, and then the tissue and the extraction solution are separated by centrifugation in a horizontal centrifuge; then the supernatant is taken into a new 96 deep well plate, precipitated with ice ethanol, placed at -20℃, centrifuged, the supernatant is discarded, washed with 75% ethanol, dried, and then dissolved with ddH2O, diluted to 10-30 ng / μL for standby.

[0015] The PCR amplification program is as follows:

[0016]

[0017] After the PCR reaction is completed, the fluorescence signal of the reaction system is scanned by ARAYA; then data analysis and genotyping are carried out by INTELLICS.

[0018] The samples are genotyped into three clusters in the KASP marker verification, which are A type, B type and hybrid genotype (see Figure 1 ). The A type genotyping indicates that the sample contains a homozygous A allele genotype at the KASP marker site (marked as red in the genotyping graph, located at the upper left corner of the graph), the B type genotyping indicates that the sample contains a homozygous B allele genotype at the KASP marker site (marked as blue in the genotyping graph, located at the lower right corner of the graph), and the hybrid genotyping indicates that the sample contains A and B hybrid allele genotypes at the KASP marker site (marked as purple in the genotyping graph, located at the 45° axis center of the coordinate axis).

[0019] The above genotyping method is applied in breeding of Brassica napus recessive dominant nuclear sterile system sterile lines and restorer lines.

[0020] The homozygous A-type allele genotype corresponding to the red cluster in the figure is located in the upper left corner of the figure; the sterile plant of the "two-type system" in the sterile system has a homozygous B-type allele genotype corresponding to the blue cluster in the figure, which is located in the lower right corner of the figure; the fertile plant of the "two-type system" has a heterozygous genotype corresponding to the purple cluster in the figure, which is located near the 45° axis center of the coordinate axis.

[0021] The present application has the following beneficial effects:

[0022] The primers and methods provided by the present application can be used for molecular marker assisted selection in the breeding process, identify the purity of parents, and replace the traditional hybrid purity planting identification method, quickly detect the purity of hybrid, complete the detection of thousands of samples in one day, greatly improve the detection efficiency, reduce the time and labor cost, realize the batch, automation and standardization of experimental operation, and have wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can be obtained without creative labor on the basis of these drawings.

[0024] Figure 1 Genotype grouping diagram of KASP marker. DETAILED DESCRIPTION

[0025] The technical solutions of the present application will be described in detail below with reference to the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0026] The experimental methods used in the following experimental examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials available from commercial channels unless otherwise specified.

[0027] Utilization of cell nucleus male sterility is an important way for utilization of hybrid vigor of rapeseed. In the recessive epistatic nuclear sterile line, Linbao line and restorer line of Brassica napus, BnMs3 / Bnms3 (BnC9.Tic40 / BnC9.tic40) and Bnms4 a / Bnms4 b / Bnms4 cThese are two key and independent loci. b Rf b or Bnms3Bnms3Rf b Rf c The temporary line maintains the genotype of Bnms3Bnms3Rf c Rf c All lines with BnMs3 allele are fertile. b Rf b The production of is very important, usually BnMs3Bnms3Rf b Rf b Self-pollination or cross-pollination with Bnms3Bnms3Rf b Rf b The separation ratios of hybridization were 1:2:1 and 1:1, respectively. The separation of BnMs3 / Bnms3 was consistent with the separation of fertility. b Rf b It is used to prepare hybrid seed parents with the Linbao line in the future. At the same time, in the production of hybrid seeds, due to various reasons such as mixing, the hybrid F1 generation seeds may not reach 100% purity. The hybrid F1 generation produced by this system contains the BnMs3 allele and can be completely fertile. b Allele-specific bud death is generally severe, leading to yield reduction. Therefore, it is crucial to identify the purity of F1 seeds. Developing molecular markers based on the sequence differences between BnMs3 and Bnms3 is one of the most economical and effective approaches for identifying hybrid fertility and heterozygosity. Sequence divergence analysis of BnMs3 and Bnms3 revealed the presence of SNPs or INDELs. Primers were designed targeting these variants. These primers were screened using restorer lines, sterile lines, and F1 hybrids from the same system. Validation was achieved using segregating populations, ultimately leading to the development of the KASP marker for distinguishing Bnms3 from BnMs3 genotypes. This marker demonstrated excellent discrimination and has been successfully applied to hybrid purity identification and molecular-assisted selection in the recessive epistatic male sterile system of Brassica napus.

[0028] Example 1: Genotyping method

[0029] (1) Primer design

[0030] Based on the reference genome information, the copy number and GC content of the sequence were analyzed, and KASP primers were designed using Bactprimer 3 software. Each set of KASP markers consists of two specific primers and one universal primer. A fluorescent linker sequence ( GAAGGTGACCAAGTTCATGCTFAM fluorescent linker sequence HEX fluorescent linker sequence), the labeling information is shown in Table 1.

[0031] Table 1. KASP marker information

[0032]

[0033] (ii) Genotyping detection

[0034] KASP marker detection was performed on the Array Tape system of Douglas Scientific. NEXAR was used for PCR system assembly, and the PCR reaction system is shown in Table 2:

[0035] Table 2. KASP reaction system

[0036]

[0037]

[0038] PCR amplification was performed using SOELLEX, and the Touch down PCR amplification conditions are as follows:

[0039]

[0040] (Note: PCR according to the appropriate number of cycles of genotyping)

[0041] After the completion of the PCR reaction, the reaction system fluorescence signal scanning was performed using ARAYA; then INTELLICS was used for data analysis and genotyping.

[0042] In the field, 69 samples of restorer lines, sterile lines and hybrid varieties were phenotyped and KASP marker verified, and in the KASP marker verification, the genotyping was divided into three clusters, namely, class A, class B and heterozygous genotype (see Table 1), which was consistent with the field phenotype, and could accurately distinguish the dominant pure and recessive pure hybrid in the hybrid. Figure 1

[0043] Typical KASP marker genotyping is shown in Table 1, wherein class A genotyping indicates that the sample contains homozygous A allele at this KASP marker site (marked as red in the genotyping diagram, located at the upper left corner of the graph), class B genotyping indicates that the sample contains homozygous B allele at this KASP marker site (marked as blue in the genotyping diagram, located at the lower right corner of the graph), and the heterozygous genotyping indicates that the sample contains A and B heterozygous alleles at this KASP marker site (marked as purple in the genotyping diagram, located at the 45° axis center of the coordinate axis). Figure 1

[0044] ​​The detailed detection results of 69 samples are shown as follows:

[0045]

[0046]

[0047]

[0048] Table 1 is the genotype of the sample of the application; G:G in the detection result represents the A type (BnMs3) homozygous sample, A:A in the detection result represents the B type homozygous (Bnms3) sample, and G:A in the detection result represents the AB type heterozygous (BnMs3 and Bnms3 hybrid offspring) sample, which proves the feasibility of the above KASP marker.

[0049] Application Example

[0050] Fenghua You 790 is a recessive nuclear sterile three-line hybrid rapeseed variety selected by Hunan Crop Research Institute, the female parent is H119A (genotype Bnms3Bnms3, recessive homozygous), and the male parent is H86R (genotype BnMs3 BnMs3, dominant homozygous). In 2024, hybrid seed production was carried out in Zhangye rapeseed seed production base in Gansu in summer. After seed harvesting, germination was carried out, and single plant sampling was carried out. The marker was used for indoor molecular identification, and the calculation formula of the purity of hybrid seeds is as follows:

[0051] Pur (%) = F / (A + B + F) * 100 %;

[0052] Wherein, Pur is the purity of hybrid seeds; A is the number of dominant homozygous single plants; B is the number of recessive homozygous single plants; and F is the number of single plants of heterozygous genotype.

[0053] Using the above calculation formula of hybrid seed purity, the purity of Fenghua You 790 hybrid seeds was calculated, and the results are as follows:

[0054] Combination name Same genotype as paternal parent (line) Same genotype as maternal parent (line) Heterozygous single (line) Purity F1 2 5 185 96.35％

[0055] From the above table, the purity of the batch of Fenghua You 790 hybrid seeds is 96.35%, which proves that the method of the application is economical and effective.

[0056] The above only describes the preferred embodiments of the application and is not intended to limit the application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the application shall be included in the protection scope of the application.

Claims

1. KASP molecular marker primers for detecting recessive epistatic male sterility BnMs3 and Bnms3 in Brassica napus, characterized by: The KASP molecular marker primers include a specific primer X, a specific primer Y and a universal primer; wherein the sequence of the specific primer X is shown in SEQ ID No. 1, the sequence of the specific primer Y is shown in SEQ ID No. 2, and the sequence of the universal primer is shown in SEQ ID No.

3.

2. The use of the KASP molecular marker primer according to claim 1, characterized in that: The application is selected from any one of the following: (1) Distinguish the Bnms3 and BnMs3 genotypes of rapeseed seeds or plants; (2) Identify the purity of rapeseed seeds or plants.

3. The use of the KASP molecular marker primer according to claim 2, characterized in that: The male genotype of the rapeseed seeds or plants is BnMs3 BnMs3, and the female genotype is Bnms3 Bnms3.

4. A method for identifying the purity of hybrid seeds, characterized in that: The method is implemented based on the KASP molecular marker primers described in claim 1.

5. The method for identifying the purity of hybrid seeds according to claim 4, wherein Here are the steps: (1) Extracting genomic DNA from the sample to be tested from a single plant, and performing PCR amplification using the KASP molecular marker primers described in claim 1; (2) Scan the fluorescence signal of the reaction system after the PCR amplification is completed; (3) Perform data analysis and genotyping on the scanned data from step (2).

6. The method for identifying the purity of hybrid seeds according to claim 5, wherein: The PCR amplification system is as follows: 0.15 μM specific primer X, 0.15 μM specific primer Y, 0.375 μM universal primer, 0.4 μl 1×KASP Master Mix, 10 ng-20 ng of the sample DNA to be tested, and the balance is ultrapure water.

7. The method for identifying the purity of hybrid seeds according to claim 6, wherein: The PCR amplification program was as follows: 94°C, 15 min, 95°C, 20 s, 65°C-56°C, 60 s as one annealing cycle, repeated 10 annealing cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C, 20 s, 57°C, 60 s as one cycle, repeated 30 cycles.

8. The method for identifying the purity of hybrid seeds according to claim 7, wherein: The data analysis and genotyping are achieved based on the analysis of the typing diagram obtained by INTELLICS software.

9. The method for identifying the purity of hybrid seeds according to claim 8, wherein: The genotyping results include homozygous A allele type, homozygous B allele type and heterozygous genotype; for each sample, if the genotype result of the marker is dominant homozygous, the sample is determined to be the paternal type; if it is recessive homozygous, the sample is determined to be the maternal type; if the genotype result of the marker is heterozygous, the sample is determined to be a hybrid The dominant homozygous allele type is located in the upper left corner of the typing diagram and is marked in red; the recessive homozygous allele type is located in the lower right corner of the typing diagram and is marked in blue; the heterozygous genotype is located near the 45° axis of the coordinate axis and is marked in purple.

10. The method for identifying the purity of hybrid seeds according to any one of claims 4 to 9, characterized in that: The calculation formula of the hybrid seed purity is: Pur (%) = F / (A + B + F) × 100%; Where Pur is the purity of hybrid seeds; A is the number of dominant homozygous plants; B is the number of recessive homozygous plants; and F is the number of heterozygous genotype plants.

Images