Method for detecting gene editing efficiency in broccoli and application thereof
By inserting a fluorescent protein gene into the broccoli gene editing vector and expressing it from the same promoter as the Cas enzyme, and combining fluorescence observation and sequencing, the problem of rapid and accurate detection of broccoli gene editing efficiency was solved, efficient multi-target parallel analysis was achieved, and detection efficiency and accuracy were improved.
Patent Information
- Application Number
- CN202511065135.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-10-17
AI Technical Summary
The existing technology lacks a fast and accurate method for detecting the efficiency of broccoli gene editing. In particular, parallel analysis of multiple targets is difficult, and the application efficiency of the CRISPR/Cas system in broccoli is low, making it difficult to meet the needs of efficient verification and rapid detection.
A method for detecting gene editing efficiency in broccoli was designed. A fluorescent protein gene and Cas enzyme were inserted into the gene editing vector and expressed from the same promoter. Fluorescence was used to observe cellular expression, and combined with PCR amplification and sequencing, the gene editing efficiency was calculated, simplifying the method to a rapid detection of broccoli protoplast editing efficiency.
It achieves rapid and accurate detection of broccoli gene editing efficiency, significantly improves screening efficiency and accuracy, simplifies the verification process, and is suitable for protoplast editing efficiency detection of broccoli.
Smart Images

Figure CN120796554A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of gene editing, and relates to a method for detecting gene editing efficiency in broccoli and application thereof. BACKGROUND
[0002] Brassica oleracea var.italica belongs to Brassica oleracea var.italica and is an important cruciferous vegetable, which has important edible and economic value in the world. In recent years, the molecular genetic basis of Brassica oleracea var.italica has made some progress, but due to its low genetic transformation efficiency and complex tissue culture system, the CRISPR / Cas system in Brassica oleracea var.italica still seriously restricts the efficient verification and rapid application. For the research of gene editing of Brassica oleracea var.italica, there is still a lack of a set of highly reproducible, efficient detection methods for editing efficiency evaluation and multi-target comparison
[0003] In addition, the current gene editing research of Brassica oleracea var.italica mostly relies on Agrobacterium-mediated transformation, which has the limitations of long cycle, low efficiency, easy to produce chimeras and transgenic residues, and is not suitable for rapid high-throughput detection of gRNA or CRISPR tool performance.
[0004] It is worth noting that in the CRISPR / Cas9 system, the design of single guide RNA (sgRNA) has a decisive influence on the final editing efficiency. Different target sequences will cause significant differences in the cutting efficiency of Cas9 endonuclease due to factors such as sequence characteristics and PAM site selection. In addition, different splice variants of the same gene or homologous genes (such as BoARF7a and BoARF7b) often need to be designed with multiple sgRNAs for editing to achieve the expected knockout or functional interference effect. Therefore, before formal plant stable transformation, it is a key step to use protoplast system to quickly and parallelly evaluate the editing efficiency of multiple sgRNAs, which can improve the success rate of gene editing and reduce the workload of genetic transformation.
[0005] CN117737215A discloses a method for rapidly evaluating plant CRISPR / Cas9 target point editing efficiency, comprising the following steps: 1) selecting a suitable reference genome of plant material, designing a gene editing target point in the CDS region of the target gene, and identifying off-target sites in the whole gene range to screen out a gene editing target point with the least potential off-target site as the best target point; 2) preparing a protoplast sample using a specific plant material, carrying out gene editing protoplast transient transfection, and obtaining a gene editing protoplast; 3) performing high-throughput deep sequencing on the DNA library of the gene editing protoplast, obtaining genomic sequencing data after quality control, and aligning the genomic sequencing data to the reference genome; 4) extracting the alignment results of the target point region and the potential off-target site region from the alignment results of step 3), typing each read in the extracted alignment results, and counting the number of gene editing reads of each type of target point; 5) calculating the gene editing target point editing efficiency according to the number of reads of the target point gene editing event.
[0006] However, the current sequencing-based detection method still has the limitations of low visualization degree and high difficulty in parallel analysis of multiple target points, and there are few reports on the detection method of broccoli gene editing efficiency. Therefore, it is of great significance to develop a new gene editing efficiency detection method. SUMMARY
[0007] In view of the deficiencies of the prior art and actual needs, the present application provides a method for detecting the gene editing efficiency in broccoli and its application, in order to realize rapid and accurate detection of the gene editing efficiency in broccoli.
[0008] To achieve the above purpose, the technical scheme adopted by the present application is as follows:
[0009] In a first aspect, the present application provides a method for detecting the gene editing efficiency in broccoli, which comprises:
[0010] The protoplast of broccoli is taken, a gene editing vector is transfected into the protoplast for gene editing, the expression of protoplast fluorescent protein is detected, PCR amplification is carried out, the amplified fragments are sequenced, and the gene editing efficiency is calculated based on the sequencing results; the gene editing vector contains the genes of guide RNA, Cas enzyme and fluorescent protein, and the Cas enzyme gene and the fluorescent protein gene are expressed by the same promoter.
[0011] In the present application, a gene editing efficiency detection method is designed for broccoli, a fluorescent protein gene is inserted into the gene editing vector, and is expressed by the same promoter as the Cas enzyme. By observing cell fluorescence, the expression of Cas enzyme can be quickly visualized and confirmed without complex verification processes such as Western blot, which significantly improves the screening efficiency and accuracy. Further combined with sequencing to calculate the gene editing efficiency, it is suitable for rapid detection of protoplast editing efficiency of broccoli, and provides an effective means for broccoli gene editing optimization.
[0012] Preferably, the guide RNA comprises sgRNA.
[0013] Preferably, the target gene of the sgRNA comprises BoARF7a gene and / or BoARF7b gene.
[0014] Preferably, the nucleic acid sequence of the sgRNA of the BoARF7a gene comprises the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0015] Preferably, the nucleic acid sequence of the sgRNA of the BoARF7b gene comprises the sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.
[0016] Preferably, the Cas enzyme comprises any one of Cas9, Cas12 or Cas13.
[0017] Preferably, the fluorescent protein comprises at least one of green fluorescent protein, red fluorescent protein, blue fluorescent protein or yellow fluorescent protein.
[0018] Preferably, the detection of protoplast fluorescent protein expression comprises observing cell fluorescence by fluorescence microscope.
[0019] Preferably, the primers for PCR amplification comprise primers for amplifying fragments at the gene editing site.
[0020] Preferably, the nucleic acid sequence of the primers comprises the sequence shown in SEQ ID NO. 5-SEQ ID NO. 10.
[0021] Preferably, the extraction method of protoplast comprises taking broccoli for digestion treatment and purification treatment.
[0022] Preferably, the digestion treatment comprises placing the broccoli in an enzyme solution for enzymolysis, the enzyme solution comprising cellulase, lyase, mannitol, KCl, CaCl2, BSA and MES buffer, filtering, collecting the precipitate and mixing with a resuspension solution, the resuspension solution comprising MES buffer, KCl, NaCl, CaCl2, glucose and water.
[0023] Preferably, the purification process comprises mixing the cells obtained from the digestion process with a sucrose solution, adding the resuspension solution to the mixture, centrifuging the mixture, collecting the protoplasts, mixing the protoplasts with the resuspension solution, centrifuging the mixture, and collecting the precipitate.
[0024] The present application is designed for the extraction of Brassica oleracea protoplasts, which is highly repeatable and can efficiently obtain high-quality protoplasts, thereby facilitating subsequent rapid and stable detection.
[0025] Preferably, the treatment part of the Brassica oleracea comprises leaves.
[0026] Preferably, the method of transfection comprises mixing the protoplasts with a gene editing vector and a transfection solution, and performing transfection.
[0027] Preferably, the transfection solution comprises polyethylene glycol, CaCl2, mannitol, and water.
[0028] Preferably, the working concentration of the gene editing vector is 30-50 μg / μL, for example, it can be 35, 40, or 45 μg / μL, etc.
[0029] Preferably, the polyethylene glycol comprises PEG4000.
[0030] Preferably, the content of PEG4000 in the transfection solution is 40-50%, for example, it can be 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, or 49%.
[0031] The present application is designed for the transfection of Brassica oleracea protoplasts, which can achieve stable and efficient transfection, thereby facilitating subsequent rapid and stable detection.
[0032] Preferably, the method of sequencing comprises NGS sequencing.
[0033] Preferably, the method of analyzing the gene editing efficiency comprises extracting the target fragment sequence from the sequencing data, and performing statistical analysis and visualization processing.
[0034] Preferably, the method for analyzing gene editing efficiency specifically comprises: matching and screening the sequencing raw results, extracting the target fragment sequence; then, using a Python program to statistically analyze and visually process the extracted sequence, the analysis content including the type of sequence, the proportion of each type of sequence in the sample, and the length distribution information, etc. The analysis result is displayed in the form of graphs and texts, wherein the first row is usually the target reference sequence, and the following lists the top twenty sequences with the highest frequency screened out, each sequence is identified by a unique ID (such as seq3), and the percentage of each sequence in the current sample is marked. In addition, the base composition of each site is visually displayed, showing the proportion of A, T, G and C four bases at each site, and different font sizes are used to represent the relative frequency of each base, the larger the font size, the higher the proportion of the base at the site, thereby intuitively reflecting the mutation mode and frequency distribution caused by gene editing.
[0035] In a second aspect, the present application provides a broccoli BoARF7 gene CRISPR editing sgRNA, the nucleic acid sequence of the site comprising the sequence shown in SEQ ID NO. 2 or SEQ ID NO. 14.
[0036] In a third aspect, the present application provides the application of the broccoli BoARF7 gene CRISPR editing sgRNA in the second aspect in editing the broccoli BoARF7 gene.
[0037] In a fourth aspect, the present application provides a broccoli BoARF7 gene CRISPR editing method, the editing method comprising expressing the sgRNA in the second aspect and Cas enzyme in the broccoli cell, and performing gene editing.
[0038] Preferably, the efficiency of the broccoli BoARF7 gene CRISPR editing method can be detected by the detection method of the gene editing efficiency of the broccoli in the first aspect.
[0039] Compared with the prior art, the present application has the following beneficial effects:
[0040] The present application designs the overall process of detecting the gene editing efficiency of broccoli, including the targeted design of protoplast extraction and vector transfection process, which has high repeatability, is beneficial to subsequent rapid and stable detection, inserts a fluorescent protein in the gene editing vector to realize preliminary visual judgment, and does not need complex verification processes such as Western blot, thereby significantly improving the screening efficiency and accuracy, and the whole synergy is suitable for rapid detection of protoplast editing efficiency of broccoli, and provides an effective means for optimization of broccoli gene editing. BRIEF DESCRIPTION OF DRAWINGS
[0041] Figure 1 Figure 1 is a morphological observation diagram of broccoli protoplast after enzymolysis.
[0042] Figure 2 Figure 6 is a sucrose density gradient purification diagram of broccoli protoplasts.
[0043] Figure 3 Figure 7 is a diagram of the target site position of the CRISPR / Cas9 vector.
[0044] Figure 4 Figure 8 is a schematic diagram of the structure of the CRISPR / Cas9 vector carrying a GFP tag.
[0045] Figure 5 Figure 9 is a diagram of the subcellular localization of the GFP-labeled expression vector in broccoli protoplasts.
[0046] Figure 6A Figure 10 is a distribution diagram of the editing frequency of each target site in pBoARF7ab-4T in the NGS sequencing results.
[0047] Figure 6B Figure 11 is a distribution diagram of the editing frequency of each target site in pBoARF7a-2T-GFP in the NGS sequencing results.
[0048] Figure 6C Figure 12 is a distribution diagram of the editing frequency of each target site in pBoARF7b-2T-GFP in the NGS sequencing results. DETAILED DESCRIPTION
[0049] The technical solutions of the present application will be further described below in combination with the drawings and through specific embodiments. However, the following examples are only simple examples of the present application, and do not represent or limit the protection scope of the present application, and the protection scope of the present application is subject to the claims.
[0050] If a specific technology or condition is not specified in the examples, it is performed according to the technology or condition described in the literature in the art, or according to the product manual. If the reagent or instrument used is not specified by the manufacturer, it is a conventional product that can be purchased through a regular channel.
[0051] BoARF7 refers to the 7th member of the Auxin Response Factor (ARF) family in Brassica oleracea plants, which is a kind of transcription factor playing a key regulatory role in the auxin signal pathway. The number of ARF family members in different species is different (such as 23 in Arabidopsis thaliana), and the functions are also differentiated. The present application analyzes and finds that there are two homologous copies of BoARF7 genes (BoARF7a, SEQ ID NO. 21 and BoARF7b, SEQ ID NO. 22) in broccoli, and further analyzes and designs sgRNA which can be edited efficiently: BoARF7a: ATCAGTCTGCTTCTGCATTG, PAM: AGG; BoARF7b: ACTGATATCGCTGCCTCCAG, PAM: CGG.
[0052] BoARF7a (SEQ ID NO. 21):
[0053]
[0054] BoARF7b (SEQ ID NO. 22):
[0055]
[0056] Example 1
[0057] This example carries out extraction and purification of broccoli protoplasts.
[0058] 1) Select the middle of the seven-day-old broccoli (Zhongqing No. 16) tissue culture seedlings and cut into thin strips.
[0059] 2) Put the leaves into the enzyme solution for digestion treatment, and the enzyme solution is prepared by mixing 0.3 g of cellulase Cellulase R10, 0.08 g of macerozyme Macerozyme R10, 15 mL of mannitol (0.8 mol / L), 2 mL of MES buffer (0.2 mol / L, pH 5.7) and 0.2 mL of KCl (2 mol / L). After sterilization in a 55°C water bath for 10 minutes, cool down, add 0.2 mL of CaCl2 (1 mol / L) and 0.02 g of BSA, and filter with a 0.22 μm microporous filter.
[0060] 3) After 6 hours of enzyme digestion at 25°C in the dark with slight shaking, the enzyme digestion morphology observation diagram is shown in Figure 1 , filter with a 70 μm filter into a 50 mL round-bottom centrifuge tube.
[0061] 4) Centrifuge at 500 rpm for 3 minutes, discard the supernatant, and resuspend in 3 mL of W5 buffer (W5 formula: MES (0.2 mol / L) 0.5 mL, KCl (2 mol / L) 0.25 mL, NaCl (5 mol / L) 3.08 mL, CaCl2 (1 mol / L) 12.5 mL, glucose (1 mol / L) 0.1 mL, add water to 100 mL, filter with a 0.22 μm microporous filter).
[0062] 5) Transfer the cell suspension to a 14 mL round-bottom centrifuge tube, centrifuge at 500 rpm for 5 minutes, discard the supernatant, and resuspend in 6 mL of 0.55 mol / L sucrose solution.
[0063] 6) Gently add 2 mL of W5 solution to form an interface layer, centrifuge at 500 rpm for 15 minutes for sucrose density purification, and the protoplasts are collected at the interface layer Figure 2 ).
[0064] 7) Transfer to a 50 mL round-bottom tube, add 5 mL of W5 solution, centrifuge again at 500 rpm for 5 minutes, and discard the supernatant.
[0065] 8) Resuspend to 2 x 10 5
[0066] Example 2
[0067] This example is designed to construct a gene editing vector.
[0068] The target points for editing BoARF7a gene and BoARF7b gene are shown in the schematic diagram Figure 3 Each gene selects 4 target points, the gene editing vector contains sgRNA gene, Cas9 enzyme gene and EGFP gene, the CAS9 enzyme gene and the fluorescent protein gene are expressed by the same promoter, a total of 2 vectors are designed, the sgRNA of 2 target points of BoARF7a gene is constructed in pBoARF7a-2T-GFP, and the sgRNA of 2 target points of BoARF7b gene is constructed in pBoARF7b-2T-GFP, as the experimental group; the control group gene editing vector does not express the fluorescent protein gene, and the sgRNA of 4 target points is constructed in one vector pBoARF7ab-4T, as the control group. The schematic diagram of the experimental group gene editing vector plasmid structure is shown in Figure 4 The main difference between the control group gene editing vector and the experimental group gene editing vector is that the EGFP gene is not inserted downstream of the CAS9 enzyme gene. The vector construction is entrusted to Wuhan Boyuan Biotechnology Co., Ltd.
[0069] Specifically, the sequences of the sgRNA of two target points of BoARF7a gene in the experimental group are shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the sequences of the sgRNA of two target points of the control group are shown in SEQ ID NO. 11 and SEQ ID NO. 12. The sequences of the sgRNA of two target points of BoARF7b gene in the experimental group are shown in SEQ ID NO. 3 and SEQ ID NO. 4, and the sequences of the sgRNA of two target points of the control group are shown in SEQ ID NO. 13 and SEQ ID NO. 14.
[0070] SEQ ID NO. 1:
[0071] TGGAGTGTCTCCCAATCCAG TGG.
[0072] SEQ ID NO. 2:
[0073] ATCAGTCTGCTTCTGCATTG AGG.
[0074] SEQ ID NO. 11:
[0075] TGGAGTGTCTCCCAATCCAG TGG.
[0076] SEQ ID NO. 12:
[0077] GCTGGGGGCAACGATATCAA AGG.
[0078] SEQ ID NO. 3:
[0079] CCAGGAAATATCGTACTGGA AGG.
[0080] SEQ ID NO. 4:
[0081] CTGTTGTGCATAGCCGCCGT TGG.
[0082] SEQ ID NO. 13:
[0083] GTTTCTCCAAATCCCCTGGA AGG.
[0084] SEQ ID NO. 14:
[0085] ACTGATATCGCTGCCTCCAG CGG.
[0086] Example 3
[0087] This example performs gene editing vector transfection and visualization analysis.
[0088] The transfection process includes:
[0089] (1) Take the protoplast obtained in Example 1 and the gene editing vector designed in Example 2, prepare the gene editing vector, and mix with 200 μL of protoplast.
[0090] (2) Slowly add 240 μL of PEG solution.
[0091] (3) After mixing, place in a 37°C water bath for 6 minutes, then dark stand for 9 minutes.
[0092] (4) Add 900 μL of W5 buffer to terminate the reaction, centrifuge and discard the supernatant, and resuspend in 1 mL of W5 solution.
[0093] (5) Continue to culture under dark conditions for 48 hours.
[0094] Design and optimize the transfection process of broccoli protoplasts, including gene editing vector concentration and PEG solution formula.
[0095] Regarding the concentration of gene editing vectors, 20 μg, 30 μg, 40 μg and 50 μg of gene editing vectors were used in step (1) respectively, and the PEG solution was prepared by taking 4 g of PEG4000, 2 mL of 1 mol / L CaCl2, 2.5 mL of 0.8 mol / L mannitol and sterile water to 10 mL, and then filtering with a 0.22 μm microporous filter. The final concentration of PEG4000 was about 40 wt%. The transfection experiment was carried out, and the results showed that the transfection efficiency of 40 μg of gene editing vector was better.
[0096] Finally, the optimal scheme for transfecting Brassica oleracea protoplasts was designed, and subsequent transfection experiments were carried out to transfect each gene editing vector into protoplasts. The above transfection was carried out using 35S::GFP (pBI221) positive control vector as a system background transfection efficiency evaluation.
[0097] The GFP signal can be observed by fluorescence microscope after 24 hours of transfection, and the Cas9 expression activity can be preliminarily judged.
[0098] The results are shown in Figure 5 The cells transfected with the gene editing vectors of BoARF7a gene and BoARF7b gene effectively express fluorescent protein, and the effective expression of gene editing vectors in cells can be preliminarily and directly judged.
[0099] Example 4
[0100] In this example, NGS sequencing verification and editing efficiency statistical analysis were carried out.
[0101] The protoplasts transfected in Example 3 were taken, and their genomes were extracted as templates for PCR amplification.
[0102] 1) Design primers to amplify the target region, and add a linker sequence to the 5' end of each pair of primers:
[0103] Forward linker: 5'-CCTACACGACGCTCTTCCGATCT-3'(SEQ ID NO. 19);
[0104] Reverse linker: 5'-GTTCCTTGGCACCCGAGAATTCCA-3'(SEQ ID NO. 20).
[0105] 2) The editing site amplification primer is designed as follows:
[0106] pBoARF7a-2T-GFP-1
[0107] Fwd: CCTACACGACGCTCTTCCGATCTGCTCAGATTTAGAGTTATTA (SEQ ID NO. 5); Rev: GTTCCTTGGCACCCGAGAATTCCAAACTCAACTGAATCTAATCT (SEQ ID NO. 6); pBoARF7a-2T-GFP-2
[0108] Fwd: CCTACACGACGCTCTTCCGATCTTTACTTCCCTCAAGGTCACA (SEQ ID NO. 7); Rev: GTTCCTTGGCACCCGAGAATTCCACAAAAGATACCATACATTCA (SEQ ID NO. 8); pBoARF7b-2T-GFP
[0109] Fwd: CCTACACGACGCTCTTCCGATCTTGAAGAGAGCAATGCCGTGG (SEQ ID NO. 9);
[0110] Rev: GTTCCTTGGCACCCGAGAATTCCACCCCTGGAGGCGTCTGAAAG (SEQ ID NO. 10);
[0111] pBoARF7ab-4T-1 / 2
[0112] Fwd: CCTACACGACGCTCTTCCGATCTGCTCAGATTTAGAGTTATTA (SEQ ID NO. 15);
[0113] Rev: GTTCCTTGGCACCCGAGAATTCCATAACAACATACTTGCTCACT (SEQ ID NO. 16);
[0114] pBoARF7ab-4T-3 / 4
[0115] Fwd: CCTACACGACGCTCTTCCGATCTGGGTTCAGGAGTGAAAGTTT (SEQ ID NO. 17);
[0116] Rev: GTTCCTTGGCACCCGAGAATTCCAAACATACTTGCTCACTGTGG (SEQ ID NO. 18).
[0117] PCR amplification system includes:
[0118] Sterilized water: 21 μL;
[0119] KOD One TM PCR Master Mix: 25 μL;
[0120] Primer: 1.5 μL (each);
[0121] Template DNA: 1 μL;
[0122] Total volume: 50 μL.
[0123] The PCR amplification reaction includes:
[0124] 98 °C, 10 seconds;
[0125] 60 °C, 5 seconds;
[0126] 68 °C, 1 second;
[0127] 35 cycles in total.
[0128] After purification, the PCR amplification product was sent to Shenguo Bioengineering (Shanghai) Co., Ltd. for NGS sequencing and target recognition, mutation frequency statistics, mutation type visualization analysis, and analysis of editing efficiency. The specific analysis method includes: matching and screening the original sequencing results, and extracting the target fragment sequence; then, using Python program to statistically analyze and visually process the extracted sequence, the analysis content includes the type of sequence, the proportion of each type of sequence in the sample, and the length distribution information, etc. The analysis results are displayed in the form of graphs and texts, where the first row is usually the target reference sequence, and the following lists the top twenty sequences with the highest frequency, each sequence is identified by a unique ID (such as seq3) and labeled with its percentage in the current sample. In addition, the base composition of each site is visually displayed, showing the proportion of A, T, G, and C bases at each site, and different font sizes are used to represent the relative frequency of each base, with larger font indicating a higher proportion of that base at that site, thus intuitively reflecting the mutation pattern and frequency distribution caused by gene editing.
[0129] The NGS sequencing results of each target editing frequency distribution are shown in Figures 6A-6C The editing efficiency statistics of each sgRNA target are shown in Table 1. The results show that the CRISPR / Cas9 target editing efficiency in Brassica oleracea protoplasts can be effectively analyzed.
[0130] Table 1
[0131]
[0132] To sum up, the application designs a new gene editing efficiency detection method for broccoli, including the design of protoplast extraction and vector transfection process, which is highly repeatable, beneficial to realize rapid and stable detection, inserts fluorescent protein in the gene editing vector, realizes preliminary visual judgment, does not need complex verification process such as Western blot, significantly improves the screening efficiency and accuracy, and the whole synergy is suitable for the protoplast editing efficiency rapid detection of broccoli, and provides an effective means for broccoli gene editing optimization.
[0133] The applicant declares that the above is only a specific embodiment of the application, but the protection scope of the application is not limited thereto, and those skilled in the art should understand that any change or replacement within the technical scope disclosed by the application can be easily thought of by those skilled in the art in the technical field, and falls within the protection scope and disclosure range of the application.
Claims
1. A method for detecting gene editing efficiency in broccoli, characterized in that: The detection method comprises: Protoplasts of broccoli are taken, a gene editing vector is transfected into the protoplasts for gene editing, the expression of fluorescent protein in the protoplasts is detected, PCR amplification is performed, the amplified fragment is sequenced, and the gene editing efficiency is analyzed based on the sequencing results; The gene editing vector contains a gene for a guide RNA, a gene for a Cas enzyme, and a gene for a fluorescent protein, and the expression of the Cas enzyme gene and the fluorescent protein gene is driven by the same promoter.
2. The method for detecting gene editing efficiency in broccoli according to claim 1, characterized in that: The guide RNA includes sgRNA; Preferably, the target gene of the sgRNA includes the BoARF7a gene and / or the BoARF7b gene.
3. The method for detecting gene editing efficiency in broccoli according to claim 2, characterized in that: The nucleic acid sequence of the sgRNA of the BoARF7a gene includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2; Preferably, the nucleic acid sequence of the sgRNA of the BoARF7b gene includes the sequence shown in SEQ ID NO.3 or SEQ ID NO.
4.
4. The method for detecting gene editing efficiency in broccoli according to any one of claims 1 to 3, characterized in that: The Cas enzyme includes any one of Cas9, Cas12 or Cas13.
5. The method for detecting gene editing efficiency in broccoli according to any one of claims 1 to 4, characterized in that: The fluorescent protein includes at least one of green fluorescent protein, red fluorescent protein, blue fluorescent protein or yellow fluorescent protein.
6. The method for detecting gene editing efficiency in broccoli according to any one of claims 1 to 5, characterized in that: The primers for PCR amplification include primers for amplifying fragments at the gene editing site; Preferably, the nucleic acid sequence of the primer includes the sequence shown in SEQ ID NO.5-SEQ ID NO.10; Preferably, the protoplast extraction method comprises: taking broccoli and performing digestion and purification treatment; Preferably, the digestion treatment comprises: placing the broccoli in an enzymatic hydrolysis solution for enzymatic hydrolysis, wherein the enzymatic hydrolysis solution comprises cellulase, cleavage enzyme, mannitol, KCl, CaCl2, BSA and MES buffer, filtering, collecting the precipitate and mixing it with a resuspension solution, wherein the resuspension solution comprises MES buffer, KCl, NaCl, CaCl2, glucose and water; Preferably, the purification process comprises mixing the cells obtained by the digestion process with a sucrose solution, adding the resuspension to the mixture, centrifuging, collecting protoplasts, mixing with the resuspension, centrifuging, and collecting a precipitate; Preferably, the processed part of broccoli includes leaves.
7. The method for detecting gene editing efficiency in broccoli according to any one of claims 1 to 6, characterized in that: The transfection method comprises mixing protoplasts with a gene editing vector and a transfection solution for transfection; Preferably, the transfection solution comprises polyethylene glycol, CaCl2, mannitol and water; Preferably, the working concentration of the gene editing vector is 0.1-0.25 μg / μL; Preferably, the polyethylene glycol comprises PEG4000; Preferably, the content of PEG4000 in the transfection solution is 40-50%.
8. The method for detecting gene editing efficiency in broccoli according to any one of claims 1 to 7, characterized in that: The sequencing method includes NGS sequencing; Preferably, the method for analyzing gene editing efficiency includes: extracting target fragment sequences from sequencing data, and performing statistical analysis and visualization processing.
9. A broccoli BoARF7 gene CRISPR editing sgRNA, characterized in that The nucleic acid sequence of the sgRNA includes the sequence shown in SEQ ID NO.2 or SEQ ID NO.
14.
10. Use of the CRISPR editing sgRNA for the BoARF7 gene in broccoli according to claim 9 in editing the BoARF7 gene in broccoli.
Citation Information
Patent Citations
Method for rapidly evaluating plant CRISPR / Cas9 target editing efficiency
CN117737215A