Method for extracting retinol from yeast fermentation liquor

Through the low-toxic and efficient purification process of extracting retinol from yeast fermentation broth, the problems of complex chemical synthesis routes and low microbial fermentation efficiency are solved, and the efficient extraction and purification of high-purity retinol is achieved, which is suitable for application in the cosmetics field.

CN120817879APending Publication Date: 2025-10-21HANGZHOU ENHE BIOTECHNOLOGY CO LTD +1
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510462350.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-10-21

AI Technical Summary

Technical Problem

The existing chemical synthesis route of retinol has the problems of long reaction steps, high process technology requirements, high safety risks, low microbial fermentation production efficiency and impure products.

Method used

A low-toxic, efficient purification process for extracting retinol from yeast fermentation broth is adopted, including extraction, concentration and purification steps. Specific extraction agents and silica gel column purification are used to avoid highly toxic solvents, and engineered brewer's yeast is used to improve yield and purity.

Benefits of technology

Efficient extraction and purification of retinol has been achieved, with product quality purity reaching over 65% and a separation and purification yield of up to 60%, making it suitable for application in the cosmetics field and for large-scale commercial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a method for extracting retinol from yeast fermentation liquor. The method comprises the following steps: A, extracting the fermentation liquor to obtain an extraction phase; step B, concentrating the extract phase to obtain concentrated oil; step C, purifying concentrated oil; and optionally step D, concentrating the purified eluent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological extraction of retinol, and in particular to a method for extracting retinol from a fermentation broth of saccharomyces cerevisiae. Background Art

[0002] Retinol, CAS No. 68-26-8, molecular formula C 20 H 30 Retinol, with a molecular weight of 286.452, is a form of vitamin A and a fat-soluble vitamin composed of a β-ionone ring and unsaturated side chains. Retinol is primarily found in animal foods, particularly liver, cod liver oil, dairy products, and egg yolks. Plants do not contain retinol, but they do contain carotenoids that can be converted to retinol in the body. Adequate intake of these foods helps maintain vitamin A levels and supports visual, immune, and skin health.

[0003] Retinol has multiple benefits in cosmetics, including anti-aging, cell renewal, acne treatment, antioxidant properties, moisturizing and repairing, and reducing photoaging. Its wide application and significant skincare benefits make it a core ingredient in many anti-aging and repair skincare products.

[0004] Currently, commercial vitamins are all chemically synthesized products. There are many routes for the artificial synthesis of retinol and its derivatives. The most common one is the Isler route, i.e., C 13 -C 14 -C 20 Citral and acetone undergo aldol condensation under alkaline conditions to obtain pseudoionone, which is then cyclized under the action of sulfuric acid to become ionone, of which β-ionone is the C 13 . C 13 Darzens condensation was used to obtain glycidyl ester, which was then hydrolyzed and decarboxylated to obtain C 14 Then condense with Grignard reagent prepared from C6 alcohol to obtain C 20 , which is the main chain of retinol. After a series of rearrangements, retinol is finally obtained. The traditional chemical synthesis route often has the disadvantages of many reaction raw materials, long reaction steps, high requirements for process technology and equipment, difficult production control, and high safety risks.

[0005] Microbial synthesis offers a new approach to the commercial production of retinol, offering safety, environmental sustainability, and environmental benefits. Retinol production through microbial fermentation has been a key focus in recent years, but the inherent instability of retinol remains a major bottleneck in microbial production, resulting in limited potency. Furthermore, the product is typically a mixture of retinal, retinol, and retinoic acid, requiring purification. Summary of the Invention

[0006] To solve the above problems, the present invention develops a low-toxicity, high-efficiency purification process for extracting retinol from yeast fermentation broth.

[0007] Specifically, the first aspect of the present invention provides a method for extracting retinol from a microbial fermentation broth, characterized in that the method comprises: step A. extracting the fermentation broth to obtain an extract phase; step B. concentrating the extract phase to obtain a concentrated oil; step C. purifying the concentrated oil and optionally step D. concentrating the purified eluate.

[0008] In some embodiments, in step A, the fermentation broth is extracted using extractant 1, and the extracted organic phase is obtained by centrifugation; preferably, the extractant 1 is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the extractant 1 is n-hexane or ethyl acetate; preferably, the amount of the extractant 1 used is 0.3 to 0.5 (W / W); preferably, the amount of the extractant 1 used is 0.3-0.5 (W / W).

[0009] In some embodiments, step A comprises: A1, extracting the fermentation broth using extractant 1; A2, centrifuging the fermentation extract to collect the extracted organic phase 1 and the emulsion layer; A3, extracting the emulsion layer using extractant 2; A4, centrifuging the emulsion layer extract to collect the extracted organic phase 2; and A5, combining the organic phase 1 and the organic phase 2. Extractant 2 is composed of extractant A and extractant B.

[0010] In some embodiments, the extractant 1 is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the extractant 1 is n-hexane or ethyl acetate; preferably, the amount of the extractant 1 used is 0.2 to 1 (W / W), preferably 0.3 to 0.5 (W / W).

[0011] In some embodiments, the extractant 2 consists of extractant A and extractant B.

[0012] In some embodiments, the extractant A is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate. Preferably, the extractant A is n-hexane or ethyl acetate.

[0013] In some embodiments, the extractant A is the same as the extractant 1.

[0014] In some embodiments, the extractant A is different from the extractant 1.

[0015] In some embodiments, the amount of the extractant A used is 0.2 to 1 (W / W), preferably 0.3 to 0.6 (W / W).

[0016] In some embodiments, the extractant B is methanol or ethanol.

[0017] In some embodiments, the amount of the extractant B used is 0 to 0.5 (W / W), preferably 0.15 to 0.3 (W / W).

[0018] In some embodiments, the concentration method in step B is reduced pressure concentration; preferably, the concentration method is rotary evaporation; preferably, the rotary evaporation temperature is 40-50°C (eg, 45°C) and / or the rotary evaporation vacuum degree is 5-100 mba.

[0019] In some embodiments, the purification in step C uses a silica gel column.

[0020] In some embodiments, before loading, the concentrated oil is diluted with an alkane solvent; preferably, the alkane solvent is an alkane solvent of C6 or above; preferably, the alkane solvent is n-hexane.

[0021] In some embodiments, after loading in step C, the sample is washed for the first time with n-hexane containing a stabilizer, washed for the second time with a mixed solution 1 of n-hexane containing a stabilizer and ethyl acetate, and eluted with a mixed solution 2 of n-hexane containing a stabilizer and ethyl acetate to obtain an eluate.

[0022] In some embodiments, the concentration of the stabilizer is 0.002-0.05% (eg, 0.005-0.03%).

[0023] In some embodiments, the volume ratio of n-hexane:ethyl acetate in the mixed solution 1 is 10:1 to 15:1.

[0024] In some embodiments, the volume ratio of n-hexane:ethyl acetate in the mixed solution 2 is 7:1 to 5:1.

[0025] In some embodiments, the flow rate of washing or elution is 1 to 3 ml / min.

[0026] In some embodiments, the stabilizer is selected from vitamin E (VE), butylated hydroxytoluene (BHT) and rosemary extract.

[0027] In some embodiments, the eluate is spotted on a silica gel plate and / or detected by HPLC to confirm qualified components.

[0028] In some embodiments, the concentration method in step D is rotary evaporation.

[0029] In some embodiments, the microorganism is a eukaryote or a prokaryote; preferably, the eukaryote is Saccharomyces cerevisiae or Yarrowia lipolytica; preferably, the prokaryote is Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.

[0030] In some embodiments, the Saccharomyces cerevisiae is an engineered Saccharomyces cerevisiae; preferably, the engineered Saccharomyces cerevisiae comprises an introduced nucleic acid encoding one or more of β-carotene-15,15′-dioxygenase (BCO), retinol dehydrogenase (RDH), geranylgeranyl pyrophosphate synthase (GGPPS), phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase, farnesyl pyrophosphate synthase (ERG20) or an ERG20_GGPPS fusion protein formed by ERG20 and GGPPS, and an ABC transporter.

[0031] In some embodiments, the engineered Saccharomyces cerevisiae comprises a nucleic acid selected from the group consisting of:

[0032] 1) Nucleic acids encoding BCO and RDH;

[0033] 2) nucleic acids encoding BCO, RDH, GGPPS, CarB, and CarRP;

[0034] 3) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, and CarRA;

[0035] 4) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, and ERG20-GGPPS fusion proteins;

[0036] 5) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein, and ABC transporter;

[0037] Preferably, the GGPPS in 2) to 5) and the GGPPS in the ERG20_GGPPS fusion proteins in 4) to 5) are of different origins.

[0038] In some embodiments, the number of copies of the nucleic acid encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein or ABC transporter is one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9), respectively; preferably, the number of copies of the nucleic acid encoding BCO is 1-5 (e.g., 1, 2, 3, 4, 5); preferably, the encoding nucleic acid sequences of different copies encoding the same protein are the same or different.

[0039] In some embodiments, the copy number of GGPPS is 2.

[0040] In some embodiments, the copy number of the BCO is 1, 2, or 3.

[0041] In some embodiments, the copy number of CarRA is 1 or 2

[0042] In some embodiments, the number of copies of the nucleic acids encoding BCO and RDH in 1) is 1; and / or the number of copies of the nucleic acids encoding BCO, RDH, GGPPS, CarB and CarRP in 2) is 1, 1, 2, 1 and 1 respectively; and / or the number of copies of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP and CarRA in 3) is 1, 1, 2, 1, 1 and 1 respectively; and / or the number of copies of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA and ERG20_GGPPS fusion protein in 4) is 1, 1, 2, 1, 1, 1 and 1 respectively; and / or the number of copies of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA and ERG20_GGPPS fusion protein in 5) is 1, 1, 2, 1, 1, 1 and 1 respectively. The number of nucleic acid copies of GGPPS, CarB, CarRP, CarRA, ERG20_GGPPS fusion protein and ABC transporter are 1, 1, 2, 1, 1, 1, 1 and 1, respectively; and / or the number of nucleic acid copies encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20_GGPPS fusion protein and ABC transporter in said 5) are 3, 1, 2, 1, 1, 1, 1 and 1, respectively; and / or the number of nucleic acid copies encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20_GGPPS fusion protein and ABC transporter in said 5) are 3, 1, 2, 1, 1, 1, 2 and 1, respectively.

[0043] In some embodiments, the β-carotene-15,15′-dioxygenase is from uncultured marine bacterium 66A03, halophilic bacterium Salinibacter ruber, or a protein with Uniprot number A0A966R658; and / or, the retinol dehydrogenase is from Yarrowia lipolytica; and / or, the GGPPS is from Phaffia rhodozyma; and / or, the GGPPS in the ERG20_GGPPS fusion protein is from Haematococcus lacustris; and / or, the carB is from Mucor circinelloides f.lusitanicus; and / or, the carRP is from Mucor circinelloides f.lusitanicus; and / or, the carRA is from Phycomyces breckii. blakesleeanus); and / or, the ERG20 in the ERG20_GGPPS fusion protein is derived from Saccharomyces cerevisiae; and / or, the ABC transporter is derived from Saccharomyces cerevisiae.

[0044] In some embodiments, the dioxygenase having β-carotene-15,15' dioxygenase (BCO) activity comprises the amino acid sequence of any one of SEQ ID NOs: 1-3, or comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs: 1-3.

[0045] In some embodiments, the oxidoreductase having retinol dehydrogenase (RDH) activity comprises the amino acid sequence shown in SEQ ID NO: 4 or comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more identity with SEQ ID NO: 4.

[0046] In some embodiments, the GGPPS comprises the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.

[0047] In some embodiments, the GGPPS in the ERG20_GGPPS fusion protein comprises the amino acid sequence shown in SEQ ID NO: 6 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 6.

[0048] In some embodiments, the carB comprises the amino acid sequence of SEQ ID NO: 7 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 7.

[0049] In some embodiments, the carRP comprises the amino acid sequence of SEQ ID NO: 8, or comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 8.

[0050] In some embodiments, the carRA comprises the amino acid sequence of SEQ ID NO: 9 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 9.

[0051] In some embodiments, the ERG20 in the ERG20_GGPPS fusion protein comprises the amino acid sequence shown in SEQ ID NO: 10 or comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10.

[0052] In some embodiments, the ABC transporter comprises the amino acid sequence of SEQ ID NO: 11 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11.

[0053] In some embodiments, ERG20 and GGPPS in the ERG20_GGPPS fusion protein are connected by a linker.

[0054] In some embodiments, the nucleic acid encoding a dioxygenase having β-carotene-15,15' dioxygenase (BCO) activity comprises the nucleotide sequence shown in any one of SEQ ID NOs: 13-16;

[0055] In some embodiments, the nucleic acid encoding the oxidoreductase having retinol dehydrogenase (RDH) activity comprises the nucleotide sequence shown in SEQ ID NO: 17 or comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 17.

[0056] In some embodiments, the nucleic acid encoding GGPPS comprises the nucleotide sequence of SEQ ID NO: 18 or comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 18.

[0057] In some embodiments, the nucleic acid encoding GGPPS in the ERG20_GGPPS fusion protein comprises the nucleotide sequence shown in SEQ ID NO: 19 or comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 19.

[0058] In some embodiments, the nucleic acid encoding carB comprises the nucleotide sequence of SEQ ID NO: 20, or comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 20.

[0059] In some embodiments, the nucleic acid encoding carRP comprises the nucleotide sequence of SEQ ID NO: 21, or comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 21.

[0060] In some embodiments, the nucleic acid encoding carRA comprises the nucleotide sequence of SEQ ID NO: 22 or comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 22.

[0061] In some embodiments, the nucleic acid encoding ERG20 in the ERG20_GGPPS fusion protein comprises the nucleotide sequence shown in SEQ ID NO: 23 or comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 23.

[0062] In some embodiments, the nucleic acid encoding the ABC transporter comprises the nucleotide sequence of SEQ ID NO: 24 or comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 24.

[0063] In some embodiments, the nucleic acid encoding one or more of BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20 or ERG20-GGPPS fusion protein, or ABC transporter is introduced into yeast via one or more vectors; preferably, one integration vector contains nucleic acids encoding one or more (e.g., two or three) of the above proteins; preferably, multiple proteins are expressed in the form of fusion proteins or separately in the same vector.

[0064] In some embodiments, the engineered Saccharomyces cerevisiae is constructed using BOTA02001 as the starting strain, and the BOTA02001 is deposited in the General Microbiology Center of the China Culture Collection Administration, with a deposit date of March 13, 2025, a deposit number of CGMCC No. 33813, and a classification name of Saccharomyces cerevisiae.

[0065] The advantages of the present invention over the prior art are:

[0066] (1) A new process for extracting retinol from microbial fermentation broth is provided.

[0067] (2) The extraction method adopted in the present invention has simple process steps and avoids the use of highly toxic solvents, and is suitable for subsequent large-scale commercial production.

[0068] (3) The technical route provided by the present invention has a product quality purity of >65% (up to 84%), and the separation and purification yield can be up to 60%.

[0069] (4) The technical route provided by the present invention can produce bio-based retinol without chemical synthetic stabilizers and is suitable for the cosmetics field. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 Diagram showing the structures of different vitamin A derivatives.

[0071] Figure 2 The retinol production of recombinant yeasts BOTA02005, BOTA02009, and BOTA02010 is shown.

[0072] Figure 3 Retinol production by different recombinant yeasts is shown.

[0073] Figure 4 The liquid chromatogram of the fermentation endpoint sample is shown. The sample at the fermentation endpoint is detected at a retention time of 4.171 min for retinol, at a retention time of 5.469 min for retinal components, at a retention time of 5.924 min for retinyl acetate components, at a retention time of 8.444 min for β-carotene components, and at other retention time components for other fermentation byproducts.

[0074] Figure 5 The liquid chromatogram of the fermentation broth extract phase is shown. The retention time of 4.153 min is retinol, the retention time of 5.462 min is the retinal component, the retention time of 5.923 min is the retinol acetate component, and the components at other retention times are other fermentation byproducts.

[0075] Figure 6 The liquid chromatogram of the concentrated oil after the extract phase was concentrated is shown. The retention time at 4.174 min is retinol, the retention time at 5.472 min is the retinal component, the retention time at 5.915 min is the retinyl acetate component, and the components at other retention times are other fermentation byproducts.

[0076] Figure 7 Liquid chromatogram showing a concentrated sample of qualified fractions after silica gel purification. DETAILED DESCRIPTION

[0077] The following definitions are provided to facilitate understanding of the present invention by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs. Preferred materials and methods are described herein, but any methods and materials similar to or equivalent to those described herein can be used in the practice of the present invention's testing. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting.

[0078] Definition of terms

[0079] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0080] In order to more readily understand the present disclosure, certain terms are first defined below.

[0081] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0082] As used herein, the terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0083] In this article, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0084] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are appropriately varied in increments of 1.0 or 0.1, or optionally varied (+) or (-) by a variation of + / - 15%, 10%, 5%, or 2%. It should be understood that all numerical designations are preceded by the term "about." It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. When referring to a measurable value such as an amount or concentration, the term "about" as used herein is intended to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0085] As used herein, the term "vitamin A" is a general term for a class of fat-soluble compounds with similar biological activities, primarily including retinol, retinal, retinoic acid, and their derivatives. As an essential nutrient for the human body, vitamin A plays a key role in vision, immune regulation, cell differentiation, and reproductive health.

[0086] As used herein, the term "retinol" is one of the main active forms of vitamin A. Its chemical name is all-trans-retinol, and it is the storage and transport form of vitamin A in animals. Retinol is composed of a β-ionone ring and a polyolefin side chain (tetraterpene structure), and its chemical formula is C 20 H 30 O. It naturally exists in the all-trans configuration and can be converted to the cis isomer by exposure to light or oxidation. Retinol is poorly soluble in water and must be bound to lipoproteins or esterified (e.g., retinyl esters) for transport within the body.

[0087] As used herein, the term "extraction" refers to a separation technique based on the differential distribution of a substance between two phases. It selectively transfers the target compound from the original mixture (the feed liquid or solid matrix) to another phase (the extractant or solvent), thereby achieving component separation or enrichment. Depending on the state of the two phases, extraction can be divided into liquid-liquid extraction and solid-liquid extraction.

[0088] As used herein, the term "extractant" is a chemical reagent or solvent used to selectively dissolve or carry the target substance during the extraction process. Its selection needs to meet the following characteristics: high selectivity, low miscibility, chemical stability and easy recovery.

[0089] As used herein, the term "silica gel column" refers to a column chromatography purification device based on the principle of adsorption chromatography. It uses porous silica gel particles (SiO2·nH2O) as the stationary phase, packed in a glass or plastic column tube. Gradient elution with a mobile phase (solvent or mixed solvent) exploits the differences in adsorption capacity of different components on the silica gel surface to separate mixtures. Its core function is to separate and purify target compounds from complex samples (such as crude organic synthesis products and natural product extracts).

[0090] As used herein, the term "spotting on a silica plate" is a key step in thin-layer chromatography (TLC). It refers to the process of evenly spotting a small amount of sample solution (typically 1-5 μL) onto the surface of a glass or aluminum foil plate (i.e., a silica plate) coated with silica gel (the stationary phase) using a capillary tube or micropipette. After spotting, the plate is placed in a sealed developing tank, where the capillary action of the developing solvent (mobile phase) separates the components of the mixture. The spot location is then analyzed by color development or ultraviolet light detection.

[0091] As used herein, the term "HPLC" or "high performance liquid chromatography" refers to a modern separation and analysis technique based on a mobile phase driven by a high-pressure pump. The principle is to achieve efficient separation using a chromatographic column, utilizing the differences in the distribution coefficients of different components between the stationary phase (chromatographic column packing) and the mobile phase (liquid solvent). The effluent components are then qualitatively and quantitatively analyzed using instruments such as ultraviolet (UV) detectors, fluorescence detectors, or mass spectrometers (MS).

[0092] As used herein, the term "rotary evaporation" refers to rotary evaporation, a commonly used laboratory method for separating and concentrating solutions. The basic principle is to use a rotating flask and condenser, combined with the negative pressure of a vacuum pump, to evaporate the solution during the rotation, effectively concentrating the solution.

[0093] As used herein, the terms "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "nucleotide sequence," and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA / RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0094] As used herein, the terms "protein," "protein," "peptide," "polypeptide," and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs, or peptidomimetics. "Protein," "peptide," "polypeptide," and "amino acid sequence" contain at least two amino acids, and there is no limitation on the maximum number of amino acids. The term "amino acid" as used herein refers to natural and / or unnatural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0095] Equivalents having one or more amino acid modifications compared to the proteins or amino acid sequences described herein are also encompassed within the scope of the present invention, provided that the one or more amino acid modifications do not affect or do not substantially affect the activity of the protein or amino acid sequence. In this article, the amino acid modification may be an amino acid substitution, an amino acid deletion, or an amino acid insertion. Amino acid substitutions may be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions (also known as conservative mutations, conservative substitutions, or conservative variations) are amino acid substitutions in proteins that change a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity, or size). In this article, "conservative substitutions" refer to replacement of an amino acid residue by another biologically similar residue. Examples of conservative substitutions include substitution of one hydrophobic residue such as isoleucine, valine, leucine, or methionine for another; or substitution of one charged or polar residue for another, such as substitution of arginine for lysine, substitution of glutamic acid for aspartic acid, substitution of glutamine for asparagine, and the like. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine, and the like.

[0096] As used herein, the term "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence, or protein. If the nucleic acid sequence is from genomic DNA, expression may include splicing of mRNA in a eukaryotic cell.

[0097] The term "encoding" when applied to a nucleic acid sequence refers to a nucleic acid sequence that, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide. Thus, a "coding sequence" is a nucleic acid sequence, which can be either DNA or RNA (e.g., mRNA), having the aforementioned functions.

[0098] As used herein, a "coding gene" includes a "coding sequence" and may optionally include other nucleotide sequence elements for regulating gene expression, such as a promoter and a terminator, etc. In a "coding gene", the coding sequence and other nucleotide sequence elements are arranged in an appropriate order to promote the correct expression of the encoded protein.

[0099] "Homology" or "identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing positions in each sequence, which can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. Tools for comparing similarity between sequences are well known to those skilled in the art, for example, by importing a nucleic acid or amino acid sequence into ClustalW (available from https: / / genome.jp / toolsbin / clustalw / ) and using ClustalW, the alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be obtained.

[0100] As used herein, the terms "homolog" and "homologous protein" are used interchangeably and refer to proteins that have a higher sequence identity in amino acid sequence or coding sequence than a reference protein, and that have a higher functional similarity, such as being able to perform the same function, such as being able to catalyze the same reaction process. "Homologous protein" includes proteins that have at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a reference protein. Alternatively, "homologous protein" includes proteins encoded by polynucleotides that have at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the coding sequence of the reference protein.

[0101] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and efficiency of transcription of a gene or transgene. Promoters can be, for example, constitutive, inducible, repressible, or tissue-specific. Promoters can contain genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind. Promoters used herein include YEASC.GAL10[-500S:-1S].

[0102] As used herein, the term "terminator" refers to a DNA sequence that signals RNA polymerase to terminate transcription. Terminators can be divided into two categories: one that terminates independently of protein cofactors, and the other that requires protein cofactors. These protein cofactors are called termination factors, often also called rho factors. Both types of terminators share common sequence characteristics. A palindromic sequence precedes the transcription termination point. The two repeating sections of the palindrome (each 7 to 20 bp) are separated by several non-repeating bp segments. The axis of symmetry of the palindrome is generally 16 to 24 bp from the transcription termination point. The terminators used herein include YEASC.HBT1 [1E:426E] and YEASC.NAT1 [1E:439E].

[0103] As used herein, the term "substitution" refers to the replacement of at least one amino acid in an amino acid sequence by a different amino acid. The term "insertion" refers to the insertion of at least one additional amino acid into an amino acid sequence. The "insertion" usually includes 1 or 2 amino acids, and may also include about 3 to 5 or even more amino acids. The above "substituted" amino acids may be conservative or non-conservative. The above "substituted" or "inserted" amino acids may be natural or non-natural. The term "deletion" refers to the removal of at least one amino acid from an amino acid sequence, and the removal may occur at both ends or in the middle of the amino acid sequence, and the deletion may be continuous or non-continuous.

[0104] As used herein, the term "identity" refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by comparison and comparative sequences." percent identity," "percent homology," "sequence identity," or "sequence homology" etc. mean the percentage of identical residues between the amino acid or nucleotide in the compared molecule, and are calculated based on the size of the smallest molecule compared. For example, a sequence A that is "at least 85% identical" to sequence B means that sequence A comprises at least 85% with sequence B, for example at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical residues. For these calculations, preferably, addressing comparisons are performed by specific mathematical model or computer program (i.e., "algorithm") when allowing room. When calculating percent identity, the sequences compared are typically compared in a manner that provides maximum matching between the sequences.

[0105] As used herein, "vector" refers to a DNA molecule that is used in genetic engineering recombinant DNA technology to transfer DNA fragments (target genes) into recipient cells. Vectors can be divided into cloning vectors and expression vectors. Cloning vectors are mainly used to clone and amplify DNA fragments. They mainly include plasmid vectors, phage vectors, phagemid vectors, and viral vectors. In addition to the basic elements of cloning vectors, expression vectors also have the control elements necessary for transcription and translation, such as promoters and terminators.

[0106] As used herein, the term "recombination" refers to the covalent reorganization of genetic information within or between DNA molecules. When applied to specific microorganisms, such as the Saccharomyces cerevisiae described herein, the term "recombination" refers to the process by which, through human intervention, the Saccharomyces cerevisiae possesses certain characteristics distinct from those of the original strain, such as increased retinol production and purity. Common methods of "recombination" include homologous recombination, site-specific recombination, transposon-mediated recombination, virus-mediated recombination, and random integration.

[0107] As used herein, "homologous recombination" is a molecular mechanism that relies on DNA sequence homology, which achieves precise DNA repair, gene integration or chromosome crossing over by pairing and exchanging broken DNA chains with homologous templates. In genetic engineering, this mechanism is widely used for targeted genome editing. The molecular process of homologous recombination includes chain invasion and DNA repair and synthesis. Among them, chain invasion refers to the pairing of single-stranded DNA (ssDNA) with homologous double-stranded DNA to form a D-loop structure. DNA repair and synthesis refers to the repair of double-strand breaks (DSBs) or the insertion of exogenous DNA with a homologous template as a reference. Yeast naturally has efficient homologous recombination ability and can directly integrate linearized vectors without exogenous induced breaks. Therefore, "yeast homologous recombination" can be used for gene knockout and multi-gene metabolic pathway integration. Integration vectors are necessary for yeast homologous recombination.

[0108] As used herein, "integration vector" or "integration plasmid" is a genetic engineering tool vector for stably inserting exogenous DNA fragments into a specific position of the host genome. Its core function is to accurately integrate the target gene or DNA sequence into the predetermined region of the host chromosome through homologous recombination or site-specific recombination mechanism, thereby achieving long-term stable expression of the gene or genome editing (such as gene knockout, knock-in, replacement, etc.). The integration vector has the characteristics of non-autonomous replication, targeted integration and stable inheritance. The integration vector used to integrate yeast generally includes elements such as homologous recombination arms, screening markers, multiple cloning sites (for inserting exogenous genes), reporter genes, etc.

[0109] As used herein, "homologous arms" refer to two DNA fragments (upstream homology arms and downstream homology arms) that are completely or highly homologous to the target genomic sequence. They are usually located at both ends of an integration vector or gene editing tool (such as a CRISPR donor plasmid) and are used to guide the precise integration of exogenous DNA into a specific location in the host genome through homologous recombination. "Homologous arms" can be used for gene knockout, gene knock-in, promoter insertion, and tag (such as GFP) insertion.

[0110] As used herein, the term "Gibson assembly" refers to a seamless DNA cloning technology based on homologous recombination. Developed by Daniel Gibson's team in 2009, it efficiently assembles multiple DNA fragments (with overlapping ends) into a complete vector in a single-tube reaction, eliminating the need for restriction endonucleases and ligases. It is widely used in synthetic biology and genetic engineering. The core principle of Gibson assembly lies in the synergistic action of three enzymes: a 5'→3' exonuclease, which digests the 5' ends of DNA fragments to form single-stranded overlapping regions; a DNA polymerase, which fills single-stranded gaps and extends complementary sequences; and a DNA ligase, which seals the gaps and forms complete double-stranded DNA.

[0111] As used herein, the term "expression" includes any step involved in the production of a polypeptide or protein of interest including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0112] As used herein, the term "host cell" refers to a cell into which a nucleic acid molecule has been introduced using molecular biology techniques. Such molecular biology techniques include transfection with viral vectors, transformation with plasmid vectors, and accelerated introduction of naked DNA using methods such as electroporation, lipofection, and particle guns. Host cells can be eukaryotic or prokaryotic. Eukaryotic cells include, but are not limited to, yeast cells, animal cells, and / or insect cells. Prokaryotic cells include, but are not limited to, Escherichia coli cells. Detailed Description of the Invention

[0114] I. Extraction of retinol from fermentation broth

[0115] The present invention provides a method for extracting retinol from a microbial fermentation broth, the method comprising:

[0116] Step A. extracting the fermentation broth to obtain an extract phase;

[0117] Step B. concentrating the extract phase to obtain concentrated oil;

[0118] Step C. Purification of concentrated oil and

[0119] Step D. The purification eluate was concentrated.

[0120] In some embodiments, in step A, the fermentation broth is extracted using extractant 1, and the extracted organic phase (i.e., the extraction phase) is obtained by centrifugation; wherein the extractant 1 is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the amount of the extractant 1 used is 0.3 to 0.5 (W / W), for example, 0.3 (W / W), 0.4 (W / W), 0.5 (W / W).

[0121] In some embodiments, the above step A includes:

[0122] Step A1, extracting the fermentation broth using extractant 1;

[0123] Step A2, centrifuging the fermentation extract to collect the extracted organic phase 1 and the emulsion layer;

[0124] Step A3, performing emulsion layer extraction using extractant 2;

[0125] Step A4, centrifuging the emulsion extract to collect the extracted organic phase 2; and

[0126] Step A5, combining organic phase 1 and organic phase 2.

[0127] Wherein, the extractant 1 is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the extractant 1 is selected from n-hexane and ethyl acetate; preferably, the amount of the extractant 1 used is 0.2-1 (W / W), preferably 0.3-0.5 (W / W), for example 0.3 (W / W), 0.4 (W / W), 0.5 (W / W).

[0128] Wherein, the extractant 2 is composed of extractant A and extractant B; preferably, the extractant A is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the extractant A is selected from n-hexane and ethyl acetate; preferably, the extractant B is methanol or ethanol. In some embodiments, the amount of the extractant A is 0.2 to 1 (W / W), for example, 0.3 to 0.6 (W / W); in some embodiments, the amount of the extractant B is 0 to 0.5 (W / W), for example, 0.15 to 0.3 (W / W). In some embodiments, the extractant A is of the same type as the extractant 1, and the amount of the extractant A is the same as that of the extractant 1; in some embodiments, the extractant A is of the same type as the extractant 1, but the amount of the extractant A is different from that of the extractant 1; in some embodiments, the extractant A is of a different type from that of the extractant 1.

[0129] In some embodiments, in step A1, the fermentation broth is transferred to an extraction bottle and extracted with stirring at 10-40°C (e.g., about 10°C, about 15°C, about 20°C, about 25°C, about 30°C, about 35°C, about 40°C) for 0.5-3 h.

[0130] In some embodiments, the centrifugation separation factor of the fermentation extract in step A2 is 3000-12000 rcf, the centrifugation temperature is 0-25°C, and the centrifugation time is 5-30 min; preferably, the centrifugation separation factor is 5000-10000 rcf, the centrifugation temperature is 15-25°C, and the centrifugation time is 10-20 min.

[0131] In some embodiments, in step A3, the emulsified layer is transferred to an extraction bottle and extracted with stirring at 10-40° C. for 0.5-3 h.

[0132] In some embodiments, the emulsion layer extract is centrifuged at a separation factor of 3000-12000 rcf, a centrifugal temperature of 0-25°C, and a centrifugal time of 5-30 min in step A4. Preferably, the centrifugal separation factor is 5000-10000 rcf, the centrifugal temperature is 15-25°C, and the centrifugal time is 10-20 min.

[0133] In some embodiments, the concentration method in step B is reduced pressure concentration; preferably, the concentration method is rotary evaporation; preferably, the rotary evaporation temperature is 30-50°C, and the rotary evaporation vacuum is 5-1000mbar; preferably, the rotary evaporation temperature is 35-45°C, and the rotary evaporation vacuum is 20-60mbar.

[0134] In some embodiments, the rotary evaporation in step B is stopped when the liquid no longer drips out for 1-6 hours to obtain concentrated oil.

[0135] In some embodiments, the purification in step C is performed using a silica gel column; preferably, before loading the silica gel column, the concentrated oil obtained in step B is diluted with 0.3-1 (W / W) (preferably 0.4-0.8) of an alkane solvent; preferably, the alkane solvent is an alkane solvent of C6 or above; preferably, the alkane solvent is n-hexane.

[0136] In some embodiments, the loading capacity (retinol / column volume) of the silica gel column is 5 to 30 g / L, preferably 15 to 25 g / L.

[0137] In some embodiments, the silica gel is 200-500 mesh (eg, 200-300 or 300-400 mesh) normal phase silica gel, and the silica gel column is packed with a height-to-diameter ratio of 6:1-10:1 (preferably 7:1-8:1).

[0138] In some embodiments, after loading the sample, the column is washed with a washing solution A containing 0.005% to 0.05% of a stabilizer for 0.5 to 3 times (preferably 1-2 times) of column volume, followed by washing with a washing solution B containing 0.005% to 0.05% of a stabilizer for 2 to 5 times (preferably 3-4 times) of column volume, and finally eluted with an eluent containing 0.005% to 0.05% of a stabilizer for 3 to 8 times (preferably 4-6 times) of column volume, and the eluate is collected in separate bottles.

[0139] In some embodiments, the stabilizer is selected from chemically synthesized BHT, biologically derived VE and rosemary extract; preferably, the stabilizer is VE.

[0140] In some embodiments, the washing solution A is n-hexane containing 0.01% to 0.02% VE.

[0141] In some embodiments, the washing solution B is a mixed solution of n-hexane and ethyl acetate containing 0.01% to 0.02% VE, wherein the volume ratio of n-hexane to ethyl acetate is 10 to 15:1, preferably 12:15 to 1.

[0142] In some embodiments, the eluent is a mixed solution of n-hexane and ethyl acetate containing 0.01% to 0.02% VE, wherein the volume ratio of n-hexane to ethyl acetate is 7 to 5:1, preferably 6 to 5:1.

[0143] In some embodiments, the eluate is collected in separate bottles, qualified components are confirmed by detection and analysis, and qualified components are combined. Preferably, the method for detecting and analyzing qualified components is selected from HPLC or thin layer chromatography.

[0144] In some embodiments, in step D, the purified eluate is concentrated by rotary evaporation.

[0145] In some embodiments, the rotary evaporation temperature is 30-50° C., and the rotary evaporation vacuum is 5-1000 mbar. Preferably, the rotary evaporation temperature is 35-45° C., and the rotary evaporation vacuum is 5-50 mbar.

[0146] In some embodiments, the resulting product is stored away from light.

[0147] In some embodiments, the method for extracting retinol from a microbial fermentation broth is applicable to recombinant Saccharomyces cerevisiae; preferably, the recombinant Saccharomyces cerevisiae is as described in Section II below.

[0148] II. Recombinant Saccharomyces cerevisiae

[0149] The present invention provides a recombinant yeast capable of high-yielding all-trans retinol, comprising an introduced nucleic acid encoding a dioxygenase having β-carotene-15,15' dioxygenase (BCO) activity and a nucleic acid encoding an oxidoreductase having retinol dehydrogenase (RDH) activity.

[0150] The β-carotene-15,15′-dioxygenase (BCO) catalyzes the conversion of β-carotene to retinal. BCO oxidatively cleaves the central 15,15′-double bond of the β-carotene molecule to generate two molecules of retinal.

[0151] In some embodiments, the BCO is from uncultured marine bacterium 66A03, halophilic bacterium Salinibacter ruber, or the BCO is a protein with Uniprot number A0A966R658.

[0152] In some embodiments, the BCO comprises an amino acid sequence as set forth in SEQ ID NO: 1-3 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0153] In some embodiments, the nucleic acid encoding BCO comprises the nucleotide sequence shown in any one of SEQ ID NOs: 13-16, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs: 13-16.

[0154] Among them, the retinol dehydrogenase (RDH) has the function of catalyzing retinal to produce retinol (Y. Lee et al., Biotechnol Bioeng, 119 (2022), pp. 399-410, 10.1002 / bit.28004).

[0155] In some embodiments, the RDH is from Yarrowia lipolytica.

[0156] In some embodiments, the RDH comprises the amino acid sequence of SEQ ID NO: 4 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4.

[0157] In some embodiments, the nucleic acid encoding RDH comprises the nucleotide sequence shown in SEQ ID NO: 17 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 17.

[0158] In some embodiments, the recombinant yeast further comprises an introduced nucleic acid encoding one or more of geranylgeranyl pyrophosphate synthase (GGPPS), phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase, farnesyl pyrophosphate synthase (ERG20) or an ERG20-GGPPS fusion protein formed by ERG20 and GGPPS, and an ABC transporter; wherein, the lycopene cyclase / phytoene synthase includes lycopene cyclase / phytoene synthase CarRP from Mucor circinelloides f.lusitanicus and lycopene cyclase / phytoene synthase CarRA from Phycomyces blakesleeanus.

[0159] In some embodiments, the recombinant yeast further comprises introduced nucleic acids encoding geranylgeranyl pyrophosphate synthase (GGPPS), phytoene dehydrogenase (CarB), and one or more nucleic acids selected from lycopene cyclase / phytoene synthase, farnesyl pyrophosphate synthase (ERG20) or ERG20_GGPPS fusion protein formed by ERG20 and GGPPS, and ABC transporter; wherein the lycopene cyclase / phytoene synthase includes lycopene cyclase / phytoene synthase CarRP from Mucor circinelloides f.lusitanicus and lycopene cyclase / phytoene synthase CarRA from Phycomyces blakesleeanus.

[0160] In some embodiments, the recombinant yeast comprises a nucleic acid selected from the group consisting of:

[0161] 1) Nucleic acids encoding BCO and RDH;

[0162] 2) nucleic acids encoding BCO, RDH, GGPPS, CarB, and CarRP;

[0163] 3) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, and CarRA;

[0164] 4) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, and ERG20-GGPPS fusion proteins;

[0165] 5) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein, and ABC transporter;

[0166] In some embodiments, the GGPPS in 2) to 5) and the GGPPS in the ERG20_GGPPS fusion proteins in 4) to 5) are of different origins.

[0167] In some embodiments, the number of copies of the nucleic acid encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein or ABC transporter is one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9), respectively; preferably, the number of copies of the nucleic acid encoding BCO is 1-5 (e.g., 1, 2, 3, 4, 5); preferably, the encoding nucleic acid sequences of different copies encoding the same protein are the same or different.

[0168] In some embodiments, the copy number of GGPPS is 2.

[0169] In some embodiments, the copy number of the BCO is 1, 2, or 3.

[0170] In some embodiments, the copy number of CarRA is 1 or 2.

[0171] In some embodiments, the copy numbers of the nucleic acids encoding BCO and RDH in 1) are both 1. For example, the recombinant yeast BOTA02002 of the present invention can produce 134 mg / L retinol in a 96-well plate.

[0172] In some embodiments, the copy numbers of the nucleic acids encoding BCO, RDH, GGPPS, CarB and CarRP in 2) are 1, 1, 2, 1 and 1, respectively; for example, BOTA02003 of the present invention can produce 504 mg / L retinol in a 96-well plate.

[0173] In some embodiments, the copy numbers of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP and CarRA in 3) are 1, 1, 2, 1, 1 and 1, respectively. For example, BOTA02004 of the present invention can produce 771 mg / L retinol in a well plate.

[0174] In some embodiments, the copy numbers of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA and ERG20_GGPPS fusion protein in 4) are 1, 1, 2, 1, 1, 1 and 1, respectively; for example, BOTA02005 of the present invention produces 936 mg / L retinol in a well plate.

[0175] In some embodiments, the copy numbers of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein and ABC transporter in 5) are 1, 1, 2, 1, 1, 1, 1 and 1, respectively; for example, the BOTA02006 of the present invention produces 991 mg / L retinol in a well plate; the BOTA02009 strain of the present invention produces 1041 mg / L retinol in a well plate; and the BOTA02010 strain of the present invention produces 925.3 mg / L retinol in a well plate.

[0176] In some embodiments, the copy numbers of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein and ABC transporter in 5) are 3, 1, 2, 1, 1, 1, 1 and 1, respectively; for example, BOTA02007 of the present invention produces 1357 mg / L retinol in a well plate.

[0177] In some embodiments, the copy numbers of the nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein, and ABC transporter in 5) are 3, 1, 2, 1, 1, 1, 2, and 1, respectively. For example, BOTA02008 of the present invention produces 1172 mg / L retinol in a well plate.

[0178] The GGPPS catalyzes the synthesis of geranylgeranyl pyrophosphate. GGPPS belongs to the prenyltransferase family and generates geranylgeranyl pyrophosphate (GGPP) by the stepwise condensation of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP).

[0179] In some embodiments, the GGPPS is derived from Phaffia rhodozyma.

[0180] In some embodiments, the GGPPS in the ERG20_GGPPS fusion protein is derived from Haematococcus lacustris.

[0181] In some embodiments, the GGPPS comprises the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5.

[0182] In some embodiments, the GGPPS in the ERG20_GGPPS fusion protein comprises the amino acid sequence shown in SEQ ID NO: 6 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 6.

[0183] In some embodiments, the nucleic acid encoding GGPPS comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 18.

[0184] In some embodiments, the nucleic acid encoding ERG20 in the ERG20_GGPPS fusion protein comprises the nucleotide sequence shown in SEQ ID NO: 19 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 19.

[0185] Wherein, the carB has the function of catalyzing phytoene to produce lycopene.

[0186] In some embodiments, the carB is derived from Mucor circinelloides f. lusitanicus.

[0187] In some embodiments, the carB comprises the amino acid sequence of SEQ ID NO: 7, or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 7.

[0188] In some embodiments, the nucleic acid encoding carB comprises the nucleotide sequence of SEQ ID NO: 20, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 20.

[0189] The carRP has the functions of catalyzing geranylgeranyl pyrophosphate to produce phytoene and catalyzing lycopene to produce β-carotene.

[0190] In some embodiments, the carRP is derived from Mucor circinelloides f. lusitanicus.

[0191] In some embodiments, the carRP comprises the amino acid sequence of SEQ ID NO: 8, or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 8.

[0192] In some embodiments, the nucleic acid encoding carRP comprises the nucleotide sequence of SEQ ID NO: 21, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 21.

[0193] The carRA has the functions of catalyzing geranylgeranyl pyrophosphate to produce phytoene and catalyzing lycopene to produce β-carotene.

[0194] In some embodiments, the carRA is derived from Phycomyces blakesleeanus.

[0195] In some embodiments, the carRA comprises the amino acid sequence of SEQ ID NO: 9 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 9.

[0196] In some embodiments, the nucleic acid encoding carRA comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 22.

[0197] Wherein, the ERG20 has the function of catalyzing the synthesis of farnesyl pyrophosphate.

[0198] In some embodiments, the ERG20 in the ERG20_GGPPS fusion protein is derived from Saccharomyces cerevisiae.

[0199] In some embodiments, the ERG20 in the ERG20_GGPPS fusion protein comprises the amino acid sequence shown in SEQ ID NO: 10 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10.

[0200] In some embodiments, the nucleic acid encoding ERG20 in the ERG20_GGPPS fusion protein comprises the nucleotide sequence shown in SEQ ID NO: 23 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 23.

[0201] In some embodiments, the ABC transporter is derived from Saccharomyces cerevisiae.

[0202] In some embodiments, the ABC transporter comprises the amino acid sequence of SEQ ID NO: 11 or an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11.

[0203] In some embodiments, the nucleic acid encoding the ABC transporter comprises the nucleotide sequence of SEQ ID NO: 24, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 24.

[0204] In some embodiments, the ERG20_GGPPS fusion protein catalyzes the synthesis of geranylgeranyl pyrophosphate.

[0205] In some embodiments, ERG20 and GGPPS in the ERG20_GGPPS fusion protein are connected by a linker. Preferably, the linker is GGGS (SEQ ID NO: 12).

[0206] In some embodiments, the ERG20 is located at the N-terminus or C-terminus of the ERG20_GGPPS fusion protein.

[0207] In some embodiments, ERG20 shown in SEQ ID NO: 10 is linked to GGPPS shown in SEQ ID NO: 5 via a linker shown in SEQ ID NO: 12 to form an ERG20_GGPPS fusion protein.

[0208] In some embodiments, ERG20 shown in SEQ ID NO: 10 is linked to GGPPS shown in SEQ ID NO: 6 via a linker shown in SEQ ID NO: 12 to form an ERG20_GGPPS fusion protein.

[0209] In some embodiments, the nucleic acid encoding one or more of BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20 or ERG20_GGPPS, and ABC transporters is introduced into yeast via one or more vectors.

[0210] In some embodiments, an integration vector comprises nucleic acids encoding one or more (eg, two or three) of the above proteins.

[0211] In some embodiments, multiple proteins are expressed in the same vector as fusion proteins or separately. For example, ERG20 and GGPPS can be expressed in different integration vectors, or in the same vector, or as fusion proteins.

[0212] In some embodiments, the vector is an integration vector. Preferably, the integration vector comprises a backbone sequence, upstream homology arms, downstream homology arms, and a target nucleic acid expression cassette; preferably, the target protein expression cassette comprises a target protein encoding nucleic acid and a regulatory element selected from a promoter, enhancer, terminator, and the like.

[0213] In some embodiments, the yeast is Saccharomyces cerevisiae or Yarrowia lipolytica.

[0214] In some embodiments, the Saccharomyces cerevisiae strain BOTA02001 was constructed as a starting strain. BOTA02001 was deposited with the General Microbiology Center of the China National Center for Microbiological Culture Collection on March 13, 2025, with accession number CGMCC No. 33813. The starting strain BOTA02001 itself does not have the ability to produce retinol.

[0215] Table 1 below shows the function, source and sequence information of the proteins introduced into the recombinant yeast.

[0216] Table 1. Protein and gene (encoding nucleic acid) information

[0217]

[0218]

[0219]

[0220] Tables 2-5 below show the homology arms used for integration vector construction and the element information in the expression cassette.

[0221] Table 2 Downstream homology arm information

[0222]

[0223] Table 3. Upstream homology arm information

[0224]

[0225]

[0226] Table 4 Terminator information

[0227] name source sequence YEASC.CBR1[1E:407E] Saccharomyces cerevisiae 45 YEASC.HBT1[1E:426E] Saccharomyces cerevisiae 46 YEASC.APL2[1E:423E] Saccharomyces cerevisiae 47 YEASC.LSC2[1E:500E] Saccharomyces cerevisiae 48 YEASC.PRC1[1E:405E] Saccharomyces cerevisiae 49 YEASC.NAT5[1E:414E] Saccharomyces cerevisiae 50 YEASC.NAT1[1E:439E] Saccharomyces cerevisiae 51 YEASC.EBS1[1E:417E] Saccharomyces cerevisiae 52 YEASC.DIT1[1E:434E] Saccharomyces cerevisiae 53

[0228] Table 5 Promoter information

[0229] name source sequence YEASC.GAL1_10[-668S:-1S] Saccharomyces cerevisiae 54 YEASC.GAL1[-500S:-1S] Saccharomyces cerevisiae 55 YEASC.GAL10[-500S:-1S] Saccharomyces cerevisiae 56 YEASC.TEF1[-500S:-1S] Saccharomyces cerevisiae 57

[0230] In some embodiments, the backbone sequence of the integration vector is shown in SEQ ID NO:58.

[0231] Example

[0232] The present invention will be more readily understood with reference to the following examples, which are included merely to illustrate certain aspects and embodiments of the invention and are not intended to limit the invention.

[0233] Unless otherwise stated, all reagents used in this example are commercially available materials or conventional materials.

[0234] Example 1 Construction of recombinant Saccharomyces cerevisiae strains

[0235] 1.1 Experimental methods

[0236] 1.1.1 Vector construction

[0237] The linearized vector of EV1634 was used as a PCR template and primers EV1634-F (GCGATCGCTTTGTTTATTTTTCTAAATACATTC, SEQ ID NO: 59) and EV1634-R (GATAACCGTAGGCGCGCC, SEQ ID NO: 60) were used to amplify the linearized vector DNA fragment required for integration expression. High-Fidelity 2× Master Mix was used. The protocol was as follows: start: 98°C for 30 seconds; 30 cycles: 98°C for 10 seconds, 57°C for 10 seconds, 72°C for 30 seconds / kb; final extension: 72°C for 30 seconds. The amplified PCR product was digested with DpnI and cleaned using the AxyPrep PCR Cleanup Kit. The cleaned DNA fragments were then analyzed by Nanodrop.

[0238] The linearized insert fragments (such as promoters, terminators, genes, upstream homology arms, and downstream homology arms) were obtained by amplifying the linearized DNA template using the same PCR method. The linearized DNA templates were all synthesized by BGI. The linearized insert fragments and linearized vector DNA fragments were inserted into the vector using the Gibson assembly method (https: / / www.nature.com / articles / nmeth.1318). The target plasmid was constructed by combining and ligating the different fragments using the HiFi DNA Assembly (NEB E5520S) kit, following the kit instructions. The constructed plasmid was verified by third-generation sequencing.

[0239] 1.1.2 Chemical transformation

[0240] Yeast cells BOTA02001 (deposited at the General Microbiology Center of China National Committee for the Administration of Microbiological Culture Collection; deposit date: March 13, 2025; deposit number: CGMCC No. 33813) were streaked onto YPD agar plates to prepare fresh colonies. A single colony was inoculated into 50 ml of liquid YPD medium in a 250 ml flask and incubated overnight on a rotary shaker at 200 rpm and 30°C. OD600 was measured and diluted to OD600 = 0.4 (approximately 4 × 10 6 10 cells / ml) in 50 ml or 200 ml of liquid YPD medium. 50 ml and 200 ml of medium are placed in a 200 ml sterile flask and a 1 L sterile flask, respectively. Incubate on a rotary shaker at 200 rpm and 30°C for approximately 4-5 hours until the cell titer is at least 1.6-2 × 10 7 cells / ml (OD600=2). 1 OD*ml cells were used as the primary transformation in the next step.

[0241] Prepare competent cells. Harvest the cells by centrifugation at 3000 g for 5 minutes, resuspend in 25 ml of sterile water, and centrifuge at 3000 g for 5 minutes at 20°C to pellet the cells. Resuspend the cells in another 25 ml of sterile water, centrifuge again to pellet the cells, and repeat the wash.

[0242] 1.1.3 Production of Retinol in Well Plates

[0243] The transformed single clones were picked and transferred to a deep-well plate. After culturing in the initial medium at 800 rpm for 3 days, they were transferred to the production medium and cultured at 800 rpm for 3 days.

[0244] The culture medium used for strain culture was prepared with reference to van Hoek P, de Hulster E, van Dijken JP, Pronk JT. Fermentative capacity in high-cell-density fed-batch cultures of baker's yeast. Biotechnol Bioeng. 2000; 68: 517–523. The strain culture medium was prepared as follows:

[0245] Component 1: 80 g / L potassium dihydrogen phosphate, 150 g / L ammonium sulfate, 61.5 g / L magnesium sulfate heptahydrate; Component 2: 160 mL 0.5 M EDTA solution, 11.5 g / L zinc sulfate heptahydrate, 0.64 g / L anhydrous copper sulfate, 0.64 g / L magnesium chloride tetrahydrate, 0.94 g / L cobalt chloride hexahydrate, 0.96 g / L sodium molybdate dihydrate, 5.6 g / L ferrous sulfate heptahydrate, 5.8 g / L calcium chloride, pH 4.0; Component 3: 0.8 g / L aminobenzoic acid, 4 g / L niacin, 10 g / L inositol, 4 g / L thiamine, 4 g / L pyridoxine hydrochloride, 4 g / L calcium pantothenate, pH 6.5. Combine 25 mL, 1.25 mL, and 0.75 mL of components 1, 2, and 3, respectively, to a volume of 1 L, and filter-sterilize to obtain the initial culture medium.

[0246] 6 g / L succinic acid, 20 g / L glucose, and 2 g / L lysine were added to the strain culture medium to obtain an initial culture medium.

[0247] 6 g / L succinic acid, 40 g / L sucrose, 10% Tween 80, and 0.1 g / L BHT (Butylated hydroxytoluene) were added to the strain culture medium to obtain a production medium.

[0248] 1.1.4 Determination of retinol production in well plate production

[0249] Accurately weigh 10 mg of retinol standard (Sigma, Lot#BCCL1179) and 10 mg each of other intermediate standards (retinal, retinal acetate, and β-carotene). Accurately weigh 5 mg of BHT (Aladdin, Lot#J2320213) and place them in a 100 mL volumetric flask. Add an appropriate amount of ethyl acetate and sonicate for 10 minutes. Once completely dissolved, cool to room temperature, dilute to the mark, and mix thoroughly. Store at -20°C for up to 1 month. Other standards were obtained from the following sources: retinal (Aladdin, Lot#D2307462), retinal acetate (Aladdin, Lot#A2403056), and β-carotene (Aladdin, Lot#L2106741).

[0250] Separately pipette a certain amount of retinol and other intermediates mixed standard solution, and use ethyl acetate solution to prepare a series of standard solutions with retinol and other intermediates contents of 0.1 mg / L, 1 mg / L, 5 mg / L, 10 mg / L, and 50 mg / L, which are used immediately after preparation.

[0251] Pipette 20 μL of the bacterial solution from the well plate, add 780 μL of extraction solution (DMSO:MeOH / EtOAc=2:1:1), mix evenly, sonicate for 25 minutes, observe that the bacterial solution precipitate turns white, place it in a desktop constant temperature mixer and mix for 30 minutes, centrifuge at 3000 rpm for 15 minutes, and dilute the supernatant after centrifugation to the standard series range.

[0252] Turn on the chromatograph and set it to working mode. Once the baseline is stable, inject the standard working solutions listed above into the liquid chromatograph in sequence and measure the corresponding peak areas. Plot a standard curve using the concentration of the standard working solution as the horizontal axis and the peak area as the vertical axis.

[0253] The extracted plate sample is injected into a liquid chromatograph to obtain the corresponding peak area. The concentration of retinol and other intermediates is obtained according to the standard curve and multiplied by the dilution factor to obtain the concentration of retinol and other intermediates in the fermentation broth.

[0254] 1.2 Construction of recombinant yeast

[0255] The construction of integration vector, chemical transformation, plate production and yield determination were carried out according to the method in 1.1 above. 1.2.1 Construction of recombinant yeast expressing β,β-carotene-15,15'-dioxygenase (BCO) and retinol dehydrogenase (RDH)

[0256] By integrating ADD-11543 into BOTA02001 to express β,β-carotene-15,15′-monooxygenase (BCO) and retinol dehydrogenases (RDH), the retinol-producing strain BOTA02002 was generated, which was able to produce 134 mg / L of retinol in a 96-well plate.

[0257] The element composition of the integration plasmid ADD-11543 is shown in Table 7 below

[0258] Table 7 ADD-11543 integration vector element composition

[0259]

[0260]

[0261] 1.2.2 Construction of recombinant yeast cells that further overexpress GGPPS, CarB, and CarRP

[0262] GGPPS, CarB, and CarRP were further overexpressed in the recombinant yeast BOTA02002. GGPPS, CarB, and CarRP were transferred into BOTA02002 using ADD-11901, ADD-11897, and ADD-11105 to generate BOTA02003, which was able to produce 504 mg / L retinol in a 96-well plate.

[0263] Table 8 ADD-11901, ADD-11897, ADD-11105 integration vector component composition

[0264]

[0265]

[0266]

[0267] 1.2.3 Construction of recombinant yeast cells overexpressing CarRA

[0268] CarRA was further overexpressed in the recombinant yeast BOTA02003. Vector construction, chemical transformation, plate-based retinol production, and retinol assays were performed as in Example 1. CarRA was introduced into the BOTA02003 genome via ADD-10812 to generate BOTA02004, which was capable of producing 771 mg / L of retinol.

[0269] Table 9 ADD-10812 integration vector element composition

[0270]

[0271] 1.2.4 Construction of recombinant yeast overexpressing ERG20-GGPPS fusion protein and transporter (ABC)

[0272] Based on BOTA02004, the ERG20-GGPPS fusion protein and / or transporter ABC were further overexpressed. Vector construction, chemical conversion, well-plate production of retinol, and retinol assay methods were the same as in Example 1. The ERG20-GGPPS fusion protein was inserted into the BOTA02004 genome using ADD-11923 to produce BOTA02005, which was capable of producing 936 mg / L of retinol. The ERG20-GGPPS fusion protein was inserted into the BOTA02004 genome using ADD-11923, and the transporter ABC_0010 was inserted into the BOTA02004 genome using ADD-12964 to produce BOTA02006, which was capable of producing 991 mg / L of retinol in well plates.

[0273] Table 10 ADD-11923 and ADD-12964 integration vector element composition

[0274]

[0275]

[0276] 1.2.5 BCO replacement, BCO overexpression, and ERG20-GGPPS overexpression

[0277] Based on the recombinant yeast BOTA02006, BCO_SALRD_Sc_IDT_1 from ADD-14121 was used to replace BCO_UNCMB_Sc_IDT_2 to construct BOTA02009. BCO-LYC_UNCXX_Sc_IDT_2 from ADD-14125 was used to replace BCO_UNCMB_Sc_IDT_2 to construct BOTA02010. BOTA02009 and BOTA02010 can produce 1041 and 925.3 mg / L retinol, respectively. Figure 2 ).

[0278] Two BCOs were inserted into the genome of BOTA02006 via ADD-14010 and ADD-13829, resulting in BOTA02007, which was able to produce 1357 mg / L retinol in a well plate.

[0279] BCO and ERG20-GGPPS fusion proteins were inserted into the BOTA02006 genome via ADD-14009, ADD-13508, and ADD-13828 to generate BOTA02008, which was able to produce 1172 mg / L of retinol in a well plate.

[0280] Table 11 Composition of integration vector elements for ADD-14121, ADD-14125, ADD-14010, ADD-13829, ADD-14009, ADD-13508, and ADD-13828

[0281]

[0282]

[0283]

[0284]

[0285] The yield of retinol produced by different recombinant Saccharomyces cerevisiae well plates in Example 1.2 is as follows: Figure 3 shown.

[0286] Example 2: Fermentation and production of retinol by recombinant Saccharomyces cerevisiae

[0287] The BOTA02008 strain in Example 1 is used to ferment and produce retinol. The preparation of the fermentation broth includes the following steps.

[0288] 1) Preparation of glycerol tubes

[0289] Add the shake flask bacterial solution and 50% glycerol in a 1:1 ratio into a glycerol tube. The OD of the glycerol tube is about 10.

[0290] 2) First-stage 2L shake flask fermentation

[0291] The culture medium formula is: 10 g / L yeast extract, 20 g / L soy peptone, 6.15 g / L magnesium sulfate heptahydrate, 66 g / L glucose, 5 ml / L Bird Trace Metals, 3 ml / L Bird Vitamin, and 2 g / L lysine. Take a glycerol tube and inoculate it into a shake flask at 0.2% (v / v) at 225 rpm at 30°C for 18 hours to obtain a primary shake flask fermentation broth.

[0292] 3) Fermentation and conversion into retinol in a 3L fermentation tank

[0293] The culture medium formulation is: (NH4)2SO4 15g / L, MgSO4·7H2O 6.15g / L, Na2SO4 3.5g / L, KH2PO4 8g / L, Glucose 20g / L, Antifoam-204 0.5ml / L, Soy Peptone 10g / L, Trace Bird Metals 5ml / L, and Bird Vitamin 3ml / L. The inoculum for the primary shake flask fermentation broth was 10% v / v, the stirring speed was 600-1200 rpm, the aeration ratio was 1.5 vvm, and the pH was controlled at 5.5 before the addition of the extractant. After an upward trend, it was maintained at around 6.7. The culture was incubated at 30°C for 118 hours, and the fermentation broth was then collected for retinol extraction.

[0294] Example 3 Extraction of retinol from fermentation broth

[0295] Example 1

[0296] Take 1050g of fermentation liquid (containing 5170mg of retinol, the spectrum is as shown Figure 4 As shown), 315g of n-hexane was added and the mixture was stirred and extracted at room temperature for 30min; then the fermentation extract was centrifuged at 10000rcf at room temperature for 10min, and 324g of the extracted n-hexane phase was collected (containing 3120mg of retinol, as shown in the spectrum). Figure 5 The extracted n-hexane phase was transferred to a rotary evaporator and concentrated at 45°C, 20-100mba until no more liquid was dripped to obtain 31.5g of concentrated oil (containing 3100mg of retinol, as shown in the spectrum). Figure 6 shown);

[0297] Take 21g of concentrated oil and dilute it with 11g of n-hexane, then load it onto a silica gel column [add 200-300 mesh silica gel to n-hexane and stir evenly before loading it into the column. After loading, the outer diameter is 30mm (inner diameter 25mm)*20cm, V=98ml, height-diameter ratio=8:1, and the loading capacity is 21g / L]. After loading, wash 100ml with n-hexane containing 0.01% VE, then wash 300ml with n-hexane containing 0.01% VE:ethyl acetate (15:1), and finally elute 400ml with n-hexane containing 0.01% VE:ethyl acetate (5:1) at a flow rate of 1.5-2.5ml / min; collect the eluate in separate bottles, spot on a silica gel plate and detect with HPLC to confirm the qualified components; combine the qualified components, transfer to a rotary evaporator, and concentrate at 45°C and 10-50mba until no more liquid drips to obtain 2.3g of the product (containing 1757mg of retinol, as shown in the spectrum). Figure 7 As shown), the retinol content is as high as 76.4%, and the downstream purification yield reaches 50%.

[0298] Example 2

[0299] Take 1050g of fermentation liquid (containing 5170mg of retinol, the spectrum is as shown Figure 1 315 g of ethyl acetate was added, and the mixture was stirred and extracted at room temperature for 30 min; the fermentation extract was then centrifuged at 10,000 rcf for 10 min at room temperature to collect 180.6 g of extract phase-1 (containing 2,596 mg of retinol) and 101 g of an emulsion layer (containing 1,220 mg of retinol); 100 g of ethyl acetate was added to the emulsion layer, and the mixture was stirred and extracted at room temperature for 30 min, and then centrifuged at 10,000 rcf for 10 min at room temperature to collect 107.4 g of extract phase-2 (containing 600 mg of retinol); the extract phase-1 and extract phase-2 were combined and transferred to a rotary evaporator and concentrated at 45° C. and 20-100 mbar until no more liquid dripped, to obtain 39.5 g of concentrated oil (containing 3,295 mg of retinol);

[0300] Take 24.6g of concentrated oil and dilute it with 12.3g of n-hexane, then load it onto a silica gel column [add 200-300 mesh silica gel to n-hexane, stir evenly, and then load it into the column. After loading, the outer diameter is 30mm (inner diameter 25mm)*20cm, V=98ml, height-diameter ratio=8:1, and the loading capacity is 20g / L]. After loading, wash 100ml with n-hexane containing 0.01% VE, and then wash 300ml with n-hexane containing 0.01% VE:ethyl acetate (15:1). Finally, 400 ml of the product was eluted with n-hexane:ethyl acetate (5:1) containing 0.01% VE at a flow rate of 1.5-2.5 ml / min; the eluate was collected in separate flasks and confirmed as qualified components by spotting on a silica gel plate and HPLC analysis; the qualified components were combined, transferred to a rotary evaporator, and concentrated at 45°C and 10-50 mbar until no more liquid dripped, to obtain 2.35 g of product (containing 1981 mg of retinol) with a retinol content of up to 84.3%, and a downstream purification yield of 61%.

[0301] Example 3

[0302] 2101 g of fermentation broth (containing 8665 mg of retinol) was added to 630 g of n-hexane, and the mixture was extracted with stirring at room temperature for 30 minutes. The fermentation extract was then centrifuged at 10,000 rcf for 10 minutes at room temperature to collect 713 g of the n-hexane extract phase (containing 5048 mg of retinol). The n-hexane extract phase was transferred to a rotary evaporator and concentrated at 45°C and 20-50 mbar until no more liquid was dripped, yielding 63.1 g of concentrated oil (containing 5030 mg of retinol).

[0303] Take 28.9g of concentrated oil and dilute it with 9g of n-hexane, then load it onto a silica gel column [add 200-300 mesh silica gel to n-hexane, stir evenly, and then load it into the column. After loading, the outer diameter is 40mm (inner diameter 36mm)*20cm, V=203ml, height-diameter ratio=6:1, and the loading capacity is 12g / L]. After loading, wash 200ml with n-hexane containing 0.02% VE, and then wash 600ml with n-hexane containing 0.02% VE:ethyl acetate (15:1). Finally, 800 ml of the product was eluted with n-hexane:ethyl acetate (5:1) containing 0.02% VE at a flow rate of 2-3 ml / min; the eluate was collected in separate flasks, and qualified components were confirmed by spotting on silica gel plates and HPLC detection; the qualified components were combined, transferred to a rotary evaporator, and concentrated at 45°C and 10-50 mbar until no more dripping occurred to obtain 2.95 g of product (containing 1757 mg of retinol), with a retinol content of up to 70.7% and a downstream purification yield of 44%.

[0304] Take 16.1g of concentrated oil and dilute it with 4.8g of n-hexane, then load it onto a silica gel column [add 200-300 mesh silica gel to n-hexane, stir evenly, and then load it into the column. After loading, the outer diameter is 30mm (inner diameter 25mm)*20cm, V=98ml, height-diameter ratio=8:1, and the loading capacity is 13g / L]. After loading, wash 100ml with n-hexane containing 0.01% VE, and then wash 300ml with n-hexane containing 0.01% VE:ethyl acetate (10:1). Finally, 400 ml of the product was eluted with n-hexane:ethyl acetate (5:1) containing 0.01% VE at a flow rate of 2-2.5 ml / min; the eluate was collected in separate flasks, and qualified components were confirmed by spotting on a silica gel plate and HPLC detection; the qualified components were combined, transferred to a rotary evaporator, and concentrated at 45°C and 10-50 mbar until no more dripping occurred to obtain 1.97 g of product (containing 1327 mg of retinol), with a retinol content of up to 67.4%, and a downstream purification yield of 60%.

[0305] Take 15.7g of concentrated oil and dilute it with 4.8g of n-hexane, then load it onto a silica gel column [add 200-300 mesh silica gel to n-hexane, stir evenly, and then load it into the column. After loading, the outer diameter is 30mm (inner diameter 25mm) * 22cm, V = 98ml, height-diameter ratio = 9:1, and the loading capacity is 12g / L]. After loading, wash 100ml with n-hexane containing 0.005% VE, and then wash 300ml with n-hexane containing 0.005% VE: ethyl acetate (12:1) Finally, 400 ml of the product was eluted with n-hexane:ethyl acetate (5:1) containing 0.005% VE at a flow rate of 2-2.5 ml / min; the eluate was collected in separate flasks, and qualified components were confirmed by spotting on silica gel plates and HPLC detection; the qualified components were combined, transferred to a rotary evaporator, and concentrated at 45°C and 10-50 mbar until no more dripping occurred to obtain 1.48 g of product (containing 1025 mg of retinol), with a retinol content of up to 69.2% and a downstream purification yield of 47%.

Claims

1. A method for extracting retinol from a microbial fermentation broth, characterized in that: The method comprises: step A. extracting the fermentation broth to obtain an extraction phase; step B. concentrating the extraction phase to obtain concentrated oil; step C. purifying the concentrated oil and optionally step D. concentrating the purified eluate.

2. The method according to claim 1, wherein in step A, the fermentation broth is extracted with extractant 1, and the extract phase is obtained by centrifugation.

3. The method according to claim 1, wherein said step A comprises: A1, extracting the fermentation broth using extractant 1; A2, centrifuging the fermentation extract to collect the extracted organic phase 1 and the emulsion layer; A3, emulsion layer extraction using extractant 2; A4, the emulsion layer extract is centrifuged to collect the extracted organic phase 2; A5, the organic phase 1 and the organic phase 2 are combined to form the extraction phase.

4. The method according to claim 2 or 3, wherein the extractant 1 is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the extractant 1 is n-hexane or ethyl acetate; preferably, the amount of the extractant 1 is 0.2-1 (W / W); preferably, the amount of the extractant 1 is 0.3-0.5 (W / W).

5. The method according to claim 3, wherein the extractant 2 consists of an extractant A and an extractant B; preferably, the extractant A is selected from one or more of n-hexane, ethyl acetate, dichloromethane, n-heptane, petroleum ether and butyl acetate; preferably, the extractant A is n-hexane or ethyl acetate; preferably, the extractant B is methanol or ethanol; preferably, the amount of the extractant A is 0.2-1 (W / W); preferably, the amount of the extractant A is 0.3-0.6 (W / W); preferably, the amount of the extractant B is 0-0.5 (W / W).

6. The method according to any one of claims 1 to 5, wherein the concentration method in step B is reduced pressure concentration; preferably, the concentration method is rotary evaporation; preferably, the rotary evaporation temperature is 40-50°C (e.g., 45°C) and / or the rotary evaporation vacuum degree is 5-100 mba.

7. The method according to any one of claims 1 to 6, wherein the purification in step C is performed using a silica gel column; preferably, the concentrated oil is diluted with an alkane solvent before loading onto the silica gel column; preferably, the alkane solvent is an alkane solvent of C6 or higher; preferably, the alkane solvent is n-hexane.

8. The method according to any one of claims 1 to 7, wherein in step C, after loading the sample, the sample is washed for a first time with n-hexane containing a stabilizer, washed for a second time with a mixed solution 1 of n-hexane containing a stabilizer and ethyl acetate, and eluted with a mixed solution 2 of n-hexane containing a stabilizer and ethyl acetate to obtain an eluate; preferably, the volume ratio of n-hexane:ethyl acetate in the mixed solution 1 is 10:1 to 15:1; preferably, the volume ratio of n-hexane:ethyl acetate in the mixed solution 2 is 7:1 to 5:1; preferably, the stabilizer is selected from vitamin E (VE), butylated hydroxytoluene (BHT) and rosemary extract; preferably, the concentration of the stabilizer is 0.002-0.05% (e.g., 0.005-0.03%).

9. method according to claim 8, eluent is detected and confirmed qualified components by silica gel plate spotting and / or HPLC.

10. The method according to any one of claims 1 to 9, wherein the concentration method in step D is concentration under reduced pressure; preferably, the concentration method in step D is rotary evaporation.

11. The method according to any one of claims 1 to 10, wherein the microorganism is a eukaryote or prokaryote capable of producing retinol; preferably, the eukaryote is Saccharomyces cerevisiae or Yarrowia lipolytica; preferably, the prokaryote is Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.

12. The method according to claim 11, wherein the Saccharomyces cerevisiae is an engineered Saccharomyces cerevisiae; preferably, the engineered Saccharomyces cerevisiae comprises introduced nucleic acids encoding one or more of β-carotene-15,15′-dioxygenase (BCO), retinol dehydrogenase (RDH), geranylgeranyl pyrophosphate synthase (GGPPS), phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase, farnesyl pyrophosphate synthase (ERG20) or an ERG20_GGPPS fusion protein formed by ERG20 and GGPPS, and an ABC transporter; preferably, the lycopene cyclase / phytoene synthase comprises CarRP and CarRA.

13. The method of claim 12, comprising a nucleic acid selected from the group consisting of: 1) Nucleic acids encoding BCO and RDH; 2) nucleic acids encoding BCO, RDH, GGPPS, CarB, and CarRP; 3) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, and CarRA; 4) nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, and ERG20-GGPPS fusion proteins; 5) Nucleic acids encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein and ABC transporter.

14. The method according to claim 13, wherein the number of copies of the nucleic acid encoding BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20-GGPPS fusion protein or ABC transporter is one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9), respectively; preferably, the number of copies of the nucleic acid encoding BCO is 1-5 (e.g., 1, 2, 3, 4, 5); preferably, the encoding nucleic acid sequences of different copies encoding the same protein are the same or different.

15. The method according to claim 14, wherein The copy number of the GGPPS is 2, and / or the copy number of the BCO is 1, 2 or 3, and / or the copy number of the CarRA is 1 or 2.

16. The method according to any one of claims 12 to 15, wherein: The β-carotene-15,15′-dioxygenase is derived from uncultured marinebacterium 66A03, halophilic bacterium Salinibacter ruber or a protein with Uniprot number A0A966R658; and / or, the retinol dehydrogenase is derived from Yarrowia lipolytica; and / or, the GGPPS is derived from Phaffia rhodozyma; and / or, the GGPPS in the ERG20_GGPPS fusion protein is derived from Haematococcus lacustris; and / or, the carB is derived from Mucor circinelloides f.lusitanicus; and / or, the carRP is derived from Mucor circinelloides f.lusitanicus. f. lusitanicus); and / or, the carRA is derived from Phycomyces blakesleeanus; and / or, the ERG20 in the ERG20_GGPPS fusion protein is derived from Saccharomyces cerevisiae; and / or, the ABC transporter is derived from Saccharomyces cerevisiae.

17. The method according to claim 16, wherein The dioxygenase having β-carotene-15,15' dioxygenase (BCO) activity comprises the amino acid sequence of any one of SEQ ID NOs: 1-3; and / or the oxidoreductase having retinol dehydrogenase (RDH) activity comprises the amino acid sequence of SEQ ID NO: 4; and / or the GGPPS comprises the amino acid sequence of SEQ ID NO: 5; and / or the GGPPS in the ERG20_GGPPS fusion protein comprises the amino acid sequence of SEQ ID NO: 6; and / or the carB comprises the amino acid sequence of SEQ ID NO: 7; and / or the carRP comprises the amino acid sequence of SEQ ID NO: 8; and / or the carRA comprises the amino acid sequence of SEQ ID NO: 9; and / or the ERG20 in the ERG20_GGPPS fusion protein comprises the amino acid sequence of SEQ ID NO: 10; and / or the ABC transporter comprises the amino acid sequence of SEQ ID NO: NO: The amino acid sequence shown in 11; preferably, ERG20 and GGPPS in the ERG20_GGPPS fusion protein are connected by a linker.

18. The method according to claim 17, wherein The nucleic acid encoding the dioxygenase having β-carotene-15,15' dioxygenase (BCO) activity comprises the nucleotide sequence of any one of SEQ ID NOs: 13-16; and / or the nucleic acid encoding the oxidoreductase having retinol dehydrogenase (RDH) activity comprises the nucleotide sequence of SEQ ID NO: 17; and / or the nucleic acid encoding GGPPS comprises the nucleotide sequence of SEQ ID NO: 18; and / or the nucleic acid encoding GGPPS in the ERG20-GGPPS fusion protein comprises the nucleotide sequence of SEQ ID NO: 19; and / or the nucleic acid encoding carB comprises the nucleotide sequence of SEQ ID NO: 20; and / or the nucleic acid encoding carRP comprises the nucleotide sequence of SEQ ID NO: 21; and / or the nucleic acid encoding carRA comprises the nucleotide sequence of SEQ ID NO: 22; and / or the nucleic acid encoding ERG20 in the ERG20-GGPPS fusion protein comprises the nucleotide sequence of SEQ ID NO: 23; and / or the nucleic acid encoding an ABC transporter comprises the nucleotide sequence of SEQ ID NO: The nucleotide sequence shown in ID NO:

24.

19. The method according to any one of claims 12 to 18, wherein the nucleic acid encoding one or more of BCO, RDH, GGPPS, CarB, CarRP, CarRA, ERG20 or ERG20-GGPPS fusion protein, and ABC transporter is introduced into yeast via one or more vectors.

20. The method according to any one of claims 12 to 19, wherein: The engineered Saccharomyces cerevisiae was constructed using BOTA02001 as the starting strain. The BOTA02001 was deposited in the General Microbiology Center of the China Culture Collection Administration on March 13, 2025, with a deposit number of CGMCC No. 33813.

Citation Information

Cited By

  • Method for separating and purifying retinol from fermentation liquor and application of retinol

    CN121537325A

  • A method for separating and purifying retinol from fermentation broth and its application.

    CN121537325B