Genetic engineering application of rice appearance quality gene osgrl

By silencing the OsGRL gene in rice through gene editing technology, rice grain length was increased, which solved the problem of unclear genetic regulation of rice grain length, achieved grain length gain and yield improvement, and provided a new resource for grain shape improvement.

CN120818561BActive Publication Date: 2025-12-16NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511324410.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2025-12-16
Estimated Expiration
2045-09-17

AI Technical Summary

Technical Problem

The genetic regulatory network for rice grain length has not been fully elucidated in the current technology, and there is a lack of effective genetic factors, which affects grain length improvement and yield enhancement.

Method used

By silencing the OsGRL gene in the rice genome using gene editing technology, rice grain length can be increased. The gene editing vector CRISpr-OsGRL is used to target and edit the rice OsGRL gene, reducing or knocking out OsGRL gene expression, thereby achieving grain length gain.

Benefits of technology

Successfully increasing rice grain length, optimizing grain quality characteristics, and improving rice yield provides new resources for grain shape improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818561B_ABST
    Figure CN120818561B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering and discloses genes for rice appearance quality. OsGRL Applications of genetic engineering. This invention first provides rice genes. OsGRL The cDNA sequence of this gene is shown in SEQ ID NO.1, and the coding region sequence is shown in SEQ ID NO.2. This invention also provides a rice gene. OsGRL Gene editing vectors, and provide rice genes OsGRL and Rice genes OsGRL The application of gene-editing vectors in regulating rice grain length. OsGRL This invention can increase rice grain length by editing loss-of-function genes in plants. OsGRL Genes can be used for the genetic improvement of rice grain length and quality traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a gene related to the appearance quality of rice. OsGRL Applications of genetic engineering. Background Technology

[0002] Rice ( Oryza sativa L. As one of the world's most important food crops, rice has long supported the basic food supply for approximately half of the global population. Against this backdrop, in-depth analysis of the genetic and molecular basis of important agronomic traits in rice provides a theoretical basis and gene resources for new variety breeding and genetic improvement, which has significant scientific and applied value. Grain appearance quality is an important indicator of rice's commercial value and consumer preference, and grain length is one of the key parameters determining grain appearance quality. Simultaneously, grain length is closely related to grain weight and yield; improving grain length can, to a certain extent, simultaneously improve both yield and quality. Therefore, elucidating the genetic regulatory mechanism of grain length formation not only helps to improve the genetic model of rice yield traits but also provides an important target for grain shape improvement and efficient breeding.

[0003] With the development of rice functional genomics, recent studies have identified several quantitative trait loci (QTLs) and some genes as key grain shape regulators. Among them, some QTLs regulating rice grain length have been discovered, such as... GS3 ( GRAIN SIZE 3 ), GS2 ( GRAIN SIZE ON CHROMOSOME 2 ), GL3.1 / qGL3 ( GRAIN LENGTH 3 ), GLW7 ( GRAIN LENGTH AND WIEIGHT ON CHROMOSOME 7 ), An-1 QTLs that regulate grain width, for example GW5 ( GRAIN WIDTH 5 ) / qSW5 ( SEED WIDTH 5 ), GW2 ( GRAIN WIDTH 2 ), GS5 ( GRAIN SIZE 5 ), GW7 ( GRAIN WIDTH 7 ), GW8 ( GRAIN WIDTH 8 ); QTLs that regulate grain weight, for example GIF1 ( GRAIN INCOMPLETE FILLING 1 ), TGW6 ( THOUSAND-GRAIN WEIGHT 6 ), GE ( GIANT EMBRYO ), GW6a ( Grain weight on chromosome 6 aThese regulatory factors participate in multiple signaling pathways, including the G protein signaling pathway, the mitogen-activated protein kinase (MAPK) signaling pathway, the ubiquitin-proteasome pathway, the plant hormone signaling pathway, and transcriptional regulators. These genes primarily participate in grain length formation by regulating cell division, cell enlargement, signal transduction, and hormone homeostasis. However, as a complex quantitative trait, the genetic regulatory network of grain length formation is far from fully elucidated, and many unknown genetic factors remain to be discovered. In particular, germplasm resources may still contain undiscovered superior variation sites, providing important sources of material for elucidating the genetic basis of grain length.

[0004] Through systematic screening of natural germplasm resources, we obtained a mutant material exhibiting a significant increase in grain length. The grain length gain trait of this mutant does not overlap with previously reported grain length regulatory sites, suggesting the possible involvement of novel genetic regulatory factors. Elucidating the genetic basis and molecular mechanism of this mutant will contribute to further enriching the rice grain length regulatory network and providing new genetic resources for grain shape improvement breeding. Summary of the Invention

[0005] To address the aforementioned technical problems in the existing technology, the present invention aims to disclose a gene that controls the grain length of rice. OsGRL Cloning and genetic engineering applications of rice grain length traits. Silencing genes in the rice genome using gene editing technology. OsGRL Genes can increase rice grain length, thereby optimizing rice grain quality characteristics and increasing rice yield. They can be used for the genetic improvement of rice quality traits.

[0006] This invention, through systematic screening of natural germplasm resources, obtained a mutant material exhibiting a significant increase in seed length, and identified... OsGRL It is a key candidate gene that leads to changes in particle length in mutant materials.

[0007] The technical solution of this invention is as follows:

[0008] This invention provides rice genes OsGRL or rice protein OsGRL or rice genes OsGRL The application of gene editing vectors in regulating rice grain length, wherein the editing target of the gene editing vectors is shown in SEQ ID NO.4.

[0009] Furthermore, the nucleotide sequence of the OsGRL gene is selected from any one of (1) to (3):

[0010] (1) The cDNA sequence of the OsGRL gene shown in SEQ ID NO.1;

[0011] (2) The coding region sequence of the OsGRL gene shown in SEQ ID NO.2;

[0012] (3) A nucleotide sequence that encodes the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2 by means of deletion and / or base mutation and / or vector sequence ligation or recombination, and is capable of encoding the amino acid sequence shown in SEQ ID NO.3.

[0013] Furthermore, the rice protein OsGRL is encoded by the rice gene OsGRL, and its amino acid sequence is shown in SEQ ID NO.3.

[0014] Furthermore, the gene-editing vector is a rice... OsGRL The gene editing target was inserted into the plant gene editing vector pHUE411.

[0015] Furthermore, reducing or knocking out rice genes in rice. OsGRL or reduce the protein content of rice. OsGRL The expression level, or the introduction of the aforementioned gene-editing vector into rice, can increase rice grain length.

[0016] Furthermore, the application includes the following steps:

[0017] (1) Design sgRNA (one-way guide RNA) target sites, the sgRNA target site sequence of which is shown in SEQ ID NO.4: 5'-CCGTGAGGCTCCGTGGCCC-3'; its target gene OsGRL It is unique in China and is the only one in the genome of the rice variety "NIP".

[0018] (2) Construct a combined sequence containing the rice promoter OsU3+sgRNA target sequence + gRNA scaffold, and use restriction endonucleases Bsa I The enzyme digestion vector pHUE411 was followed by insertion of the sgRNA target sequence shown in SEQ ID NO.4 into the vector pHUE411 using T4 DNA ligase to obtain the gene editing vector Crispr-OsGRL.

[0019] (3) Obtaining transgenic plants: The gene editing vector Crispr-OsGRL obtained in step (2) was transformed into Agrobacterium strain EHA105. Using Agrobacterium-mediated rice genetic transformation, the sgRNA sequence of the gene editing vector was targeted and edited in the genome of the japonica rice variety Nipponbare NIP. OsGRL Genes, thereby obtaining OsGRL Genetically modified rice with edited genes.

[0020] Furthermore, the combined sequence containing the rice promoter OsU3 + sgRNA target sequence + gRNA scaffold described in step (2) is as shown in SEQ ID. NO.5 is shown: ttttttttttcgttttgcattgagttttctccgtcgcatgtttgcagttttattttccgttttgcattgaaatttctccgtctcatgtttg cagcgtgttcaaaaagtacgcagctgtatttcacttatttacggcgccacattttcatgccgtttgtgccaactatcccgagctagtgaatacagcttg gcttcacacaacactggtgacccgctgacctgctcgtacctcgtaccgtcgtacggcacagcatttggaattaaagggtgtgatcgatactgcttgct gctCCGTGAGGCTCCGTGGCCCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0021] Furthermore, (2) the construction steps of the gene editing vector Crispr-OsGRL are as follows:

[0022] (2-1) Primers were designed to amplify the combined sequence containing the rice promoter OsU3+sgRNA target sequence + gRNA scaffold in the pCBC-MT1T2 vector, i.e., product 1. The primers are:

[0023] OsGRL-MT1T2-F0, nucleotide sequence as shown in SEQ ID NO.6: 5'- gCCGTGAGGCTCCGTGGCCCgttttagagctagaaatagc -3';

[0024] OsGRL-MT1T2-R0, nucleotide sequence as shown in SEQ ID NO.7: 5'-CCTTTGCTCCCGTAGCTATCGCTTCTTGGTGCC -3';

[0025] (2-2) The sequence of product 1 obtained by amplification was added by PCR to add homologous arms and restriction enzyme sites that can be ligated to the pHUE411 vector. The primers are:

[0026] OsGRL-MT1T2-F, nucleotide sequence as shown in SEQ ID NO.8: 5'- aataatggtctcAGGCgCCGTGAGGCTCCGTGGCCC -3';

[0027] OsGRL-MT1T2-R, nucleotide sequence as shown in SEQ ID NO.9: 5'-ATTATTTGGTCTCTAAACCCTTTGCTCCCGTAGCTAT -3';

[0028] (2-3) Using restriction endonucleases Bsa I The enzyme digestion vector pHUE411 was used to insert the amplification product obtained in step (2-2) into the vector pHUE411 using T4 DNA ligase to obtain the gene editing vector Crispr-OsGRL.

[0029] Beneficial effects

[0030] 1. This invention discloses a gene-engineered application of the rice OsGRL gene for grain shape. This gene originates from rice (Oryza sativa L.), and this invention provides a method to increase rice grain length by silencing this gene through gene editing, thereby improving the genetic quality of rice grains.

[0031] 2. The OsGRL gene cloned in this invention provides a new resource for high-yield and high-quality rice breeding. Attached Figure Description

[0032] Figure 1 . OsGRL Gene-edited strains OsGRL The construction, in which:

[0033] A. Schematic diagram of the restriction enzyme sites of the gene editing vector pHUE411;

[0034] B. OsGRL A schematic diagram illustrating different editing types in gene-edited transgenic strains.

[0035] Figure 2 . OsGRL Grain length and grain length phenotype of gene-edited lines, including:

[0036] A. OsGRL A comparison of grain length between gene-edited lines and wild-type lines;

[0037] B. OsGRL Grain length statistics of gene-edited lines and wild-type lines. Detailed Implementation

[0038] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0039] Example 1

[0040] The rice variety “NIP” was hydroponically grown in an artificial climate incubator (16h light / 8h darkness, 30℃ during the day and 26℃ at night) using the standard nutrient solution formula from the International Rice Research Institute. When the seedlings reached the 3-4 leaf stage, they were flash-frozen in liquid nitrogen and stored at -80℃ for later use. Total RNA was extracted from the stored rice seedling samples using the Invitrogen Trizol method. The quality and concentration of total RNA were analyzed by 1% agarose gel electrophoresis. Total RNA meeting quality standards was further used for the synthesis of cDNA first strand. The synthesis of cDNA first strand was performed according to the Vazyme reverse transcription system's operating manual.

[0041] Design primers:

[0042] The upstream OsGRLF sequence is shown in SEQ ID NO.10: 5'-ATGGCCACCCACATTCCCCT-3';

[0043] The downstream OsGRLR sequence is shown in SEQ ID NO.11: 5'-TCACTGCCAAAATATGGTTGGG-3'. Using the first strand of cDNA synthesized by reverse transcription as a template, cDNA was cloned by PCR.

[0044] PCR amplification was performed using Takara's PrimeStar GXL DNA polymerase.

[0045] The PCR program was as follows: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 45 s, 28 cycles, 72℃ for 10 min, and the PCR products were subjected to agarose gel electrophoresis. The target fragment was recovered using the DNA gel recovery kit from Vazyme.

[0046] The cloned fragment was ligated into the pEASY®-Blunt Simple Cloning Vector using a kit (Catalog No. CB111-01) from Beijing TransGen Biotech Co., Ltd. The vector was then transformed into *E. coli* strain DH5α using a heat shock transformation method to obtain plasmid T-OsGRL. Sequencing yielded the OsGRL cDNA sequence with a complete coding region, SEQ ID NO. 1.

[0047]

[0048] The full-length OsGRL ORF sequence is shown in SEQ ID NO.2, totaling 4305 bp:

[0049]

[0050] Analysis using BioXM software version 2.6 showed that OsGRL encodes 1434 amino acids (SEQ ID NO. 3), with an estimated isoelectric point pI of 6.454 and molecular weight MW of 152.9 kDa.

[0051]

[0052] Example 2: Construction of gene editing vectors and gene editing lines

[0053] (1) Design sgRNA target, the target sequence is shown in SEQ ID NO.4 as: 5'-CCGTGAGGCTCCGTGGCCC-3';

[0054] (2) Design primers to amplify the combined sequence containing rice OsU3 promoter + target sequence + gRNAscaffold in the pCBC-MT1T2 vector, as shown in SEQ ID. NO.5 is shown: ttttttttttcgttttgcattgagttttctccgtcgcatgtttgcagttttattttccgttttgcattgaaatttctccgtctcatgtttg cagcgtgttcaaaaagtacgcagctgtatttcacttatttacggcgccacattttcatgccgtttgtgccaactatcccgagctagtgaatacagcttg gcttcacacaacactggtgacccgctgacctgctcgtacctcgtaccgtcgtacggcacagcatttggaattaaagggtgtgatcgatactgcttgct gctCCGTGAGGCTCCGTGGCCCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc;

[0055] Its primer sequences are shown below:

[0056] OsGRL -MT1T2-F0, as shown in SEQ ID NO.6, is: 5'- gCCGTGAGGCTCCGTGGCCCgttttagagctagaaatagc -3' .

[0057] OsGRL -MT1T2-R0, as shown in SEQ ID NO.7, is: 5'- CCTTTGCTCCCGTAGCTATCGCTTCTTGGTGCC -3'.

[0058] OsGRL -MT1T2-F, as shown in SEQ ID NO.8, is: 5'- aataatggtctcAGGCgCCGTGAGGCTCCGTGGCCC -3'.

[0059] OsGRL -MT1T2-R, as shown in SEQ ID NO.9, is: 5'- ATTATTGGTCTCTAAACCCTTTGCTCCCGTAGCTAT -3'.

[0060] The pCBC-MT1T2 plasmid purchased from Shanghai Kelei Biotechnology Co., Ltd. was amplified using the primers OsGRL-MT1T2-F0 and OsGRL-MT1T2-R0. The resulting product was then amplified using primers OsGRL-MT1T2-F0 and OsGRL-MT1T2-R, with the addition of homologous arms and restriction enzyme sites for ligation with the pHUE411 vector. This yielded a combined sequence containing the OsU3 promoter, target sequence, and gRNA scaffold. The pHUE411 vector was digested with the restriction endonuclease BsaI, and the sgRNA sequence was inserted into the pHUE411 vector using T4 DNA ligase, resulting in the gene editing vector CRISPR-OsGRL( Figure 1 (A in the middle).

[0061] The gene-editing vector Crispr-OsGRL described above was transfected into Nipponbare plants according to the method described in the following literature: A CRISPR / Cas9 toolkit for multiple genome editing in plants. BMC Plant Biology, Xing, HL., Dong, L., Wang, ZP. et al., 2014. Genomic DNA was extracted from T0 generation plants to verify the gene-editing type.

[0062] Design primers flanking the OsGRL gene target site:

[0063] YZ-cr- OsGRL -F: 5'- CGTCGCATCGGGGAACC -3' (SEQ ID NO. 12);

[0064] YZ-cr-OsGRL-R: 5'-TTTGTGGGCAACAGGCAGA-3' (SEQ ID NO.13) was amplified using PCR technology, and the target editing results were analyzed by sequencing. Figure 1 (B in the results) The results showed that the Cr-OsGRL-1 and Cr-OsGRL-2 strains successfully performed insertion / deletion editing, while the OsGRL function was lost.

[0065] Cas9-free validation was performed using universal primers OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3' (SEQ ID NO.14); TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3' (SEQ ID NO.15) to prevent further gene editing in offspring. Homozygous offspring were then produced by propagating different Cr-OsGRL lines, Cr-OsGRL-1 and Cr-OsGRL-2, for further experimental research.

[0066] Example 3: Verification of the traits of gene-edited lines

[0067] This experiment used the gene-edited lines (Cr-OsGRL-2, Cr-OsGRL-3) obtained in Example 2 and the wild type (NIP).

[0068] After soaking the seeds of each group until they showed signs of sprouting, they were sown at the base for the study of agronomic traits at the mature plant stage. Each line was planted in 3 rows with a row spacing of 20 cm, 10 plants per row, and a plant spacing of 15 cm, with conventional soil and fertilizer management.

[0069] After the seeds of the gene-edited lines (Cr-OsGRL-2, Cr-OsGRL-3) and the wild-type line (NIP) matured, the panicle nodes of each group of rice were cut off, and the seeds were dried at 42℃ for 5 days before grain length analysis was performed.

[0070] Statistical results show:

[0071] The rice grains of gene-edited lines (Cr-OsGRL-1, Cr-OsGRL-2) were significantly longer than those of wild-type NIP. Figure 2 This indicates that loss of OsGRL function can increase rice grain length, which is beneficial for the genetic improvement of rice grain shape.

[0072] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Knock out rice genes OsGRL Or knock out rice genes OsGRL The application of gene-editing vectors in increasing rice grain length is characterized by, The editing target of the gene editing vector is shown in SEQ ID NO.4; The OsGRL The nucleotide sequence of the gene is selected from (1) or (2): (1) As shown in SEQ ID NO.1 OsGRL The cDNA sequence of the gene; (2) As shown in SEQ ID NO.2 OsGRL The coding region sequence of a gene; The gene-editing vector is a rice... OsGRL The gene editing target was inserted into the plant gene editing vector pHUE411.

2. The application according to claim 1, characterized in that, The application includes the following steps: (1) Design sgRNA target, the sgRNA target sequence is shown in SEQ ID NO.4: 5'-CCGTGAGGCTCCGTGGCCC-3'; (2) Construct a combined sequence containing the rice promoter OsU3+sgRNA target sequence + gRNA scaffold, and use restriction endonucleases Bsa I The enzyme digestion vector pHUE411 was used to insert the sgRNA target sequence shown in SEQ ID NO.4 into the vector pHUE411 via T4 DNA ligase to obtain the gene editing vector Crispr-OsGRL; (3) Obtaining transgenic plants: The gene editing vector Crispr-OsGRL obtained in step (2) was transformed into Agrobacterium strain EHA105. Using Agrobacterium-mediated rice genetic transformation, the sgRNA sequence of the gene editing vector was targeted and edited in the genome of the japonica rice variety Nipponbare NIP. OsGRL Genes, thereby obtaining OsGRL Genetically modified rice with edited genes.

3. The application according to claim 2, characterized in that, The combined sequence containing rice promoter OsU3 + sgRNA target sequence + gRNA scaffold in step (2) is shown in SEQ ID NO.

5.

4. The application according to claim 2, characterized in that, (2) The construction steps of the gene editing vector CRISPR-OsGRL are as follows: (2-1) Primers were designed to amplify the combined sequence containing the rice promoter OsU3+sgRNA target sequence + gRNAscaffold in the pCBC-MT1T2 vector, i.e., product 1. The primers are: OsGRL-MT1T2-F0, nucleotide sequence as shown in SEQ ID NO.6: 5'- gCCGTGAGGCTCCGTGGCCCgttttagagctagaaatagc -3'; OsGRL-MT1T2-R0, nucleotide sequence as shown in SEQ ID NO.7: 5'-CCTTTGCTCCCGTAGCTATCGCTTCTTGGTGCC -3'; (2-2) The sequence of product 1 obtained by amplification was added by PCR to add homologous arms and restriction enzyme sites that can be ligated to the pHUE411 vector. The primers used were: OsGRL-MT1T2-F, nucleotide sequence as shown in SEQ ID NO.8: 5'- aataatggtctcAGGCgCCGTGAGGCTCCGTGGCCC -3'; OsGRL-MT1T2-R, nucleotide sequence as shown in SEQ ID NO.9: 5'-ATTATTTGGTCTCTAAACCCTTTGCTCCCGTAGCTAT -3'; (2-3) Using restriction endonucleases Bsa I The enzyme digestion vector pHUE411 was used to insert the amplification product obtained in step (2) into the vector pHUE411 using T4 DNA ligase to obtain the gene editing vector Crispr-OsGRL.