Application of non-isometric double-stranded DNA template in detection of connection efficiency of blunt ends of double-chain joints

Abstract

The invention discloses an application of a non-isometric double-stranded DNA template in detection of connection efficiency of a double-chain connector and a blunt end. According to the method, the non-equal-length double-stranded DNA template is designed for blunt end ligation efficiency detection, rapid and simple detection of single-end blunt end ligation efficiency can be realized, the result is stable, and the design of the non-equal-length double-stranded DNA template can eliminate interference of simultaneous amplification of two template single chains on linker ligation efficiency detection to a certain extent; therefore, the magnitude of template amplification is equivalent to the magnitude of ligation product amplification, the ligation efficiency can be reduced more truly, the expression of different blunt end ligation can be evaluated quickly, and the most appropriate linker can be selected.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology and relates to application of non-isometric double-stranded DNA templates in detection of double-linker blunt-end ligation efficiency. BACKGROUND

[0002] Ligation of adapters is one of important links in NGS library preparation process and plays a decisive role in library quality and yield. Blunt-end ligation is one of commonly used types of adapter ligation in the current NGS library preparation process. In the ligation process, the ratio of the amount of DNA with adapters added to the ends of DNA fragments to the total amount of starting DNA (i.e. ligation efficiency) is an important factor affecting library quality and an important indicator for evaluating the advantages and disadvantages of adapters. At present, detection of blunt-end ligation efficiency in the NGS library preparation process is usually performed by determining the library concentration before and after ligation to estimate the ligation efficiency. The method for calculating the ligation efficiency by determining the library concentration before and after ligation can only determine the total amount of double-stranded DNA and cannot determine the effective library amount of the ligated adapters, resulting in large errors in the results. The qPCR or ddPCR method used in the prior art is only suitable for NGS libraries in which both ends of DNA fragments are ligated with known sequence adapters and cannot be used to determine the efficiency of blunt-end ligation performed on one end of DNA fragments. Since the adapters are usually non-isometric, only one strand (usually the long strand) is amplified when the amount of double-stranded DNA templates after ligation of adapters is detected, while the primer probe amplification system of the double-stranded DNA template amplifies both single strands of the double-stranded DNA template at the same time when the isometric double-stranded DNA template is operated, thereby interfering with the determination of the ligation efficiency of the adapters.

[0003] Therefore, there is an urgent need to provide a method for quickly evaluating different blunt-end ligation efficiencies with stable results and high sensitivity. SUMMARY

[0004] In view of the deficiencies of the prior art and actual needs, the application provides application of non-isometric double-stranded DNA templates in detection of double-linker blunt-end ligation efficiency, which can more truly restore the ligation efficiency, to a certain extent, reduce the interference of simultaneous amplification of both single strands of the double-stranded DNA template on the detection of the ligation efficiency of the adapters and ensure that the order of magnitude of the template amplification is equivalent to that of the ligation product amplification.

[0005] To achieve the object of the application, the following technical solutions are adopted in the application.

[0006] In a first aspect, the application provides application of non-isometric double-stranded DNA templates in detection of double-linker blunt-end ligation efficiency.

[0007] The present application is designed to detect blunt end ligation efficiency of non-equal-length double-stranded DNA template, and specifically designs non-equal-length double-stranded DNA template according to target genes, connects the template with a joint to be evaluated, connects the joint with the blunt end of the non-equal-length double-stranded DNA template, and then amplifies the non-equal-length double-stranded DNA template to which the joint is connected, so that the blunt end ligation efficiency of the double joint can be detected, and the ligation efficiency can be more truly restored.

[0008] It can be understood that the non-equal-length double-stranded DNA template includes a long chain and a short chain, one end is a blunt end, and the other end is a non-blunt end.

[0009] In a second aspect, a kit for detecting blunt end ligation efficiency of a double joint includes a non-equal-length double-stranded DNA template, a template upstream primer, a template downstream primer, a probe, and a double joint downstream primer; the non-equal-length double-stranded DNA template includes a long chain and a short chain, one end is a blunt end, and the other end is a non-blunt end.

[0010] The template upstream primer and the template downstream primer form a primer pair for amplifying the long chain of the non-equal-length double-stranded DNA template, and the template upstream primer and the template downstream primer do not form a primer pair for amplifying the short chain of the non-equal-length double-stranded DNA template; the binding region of the probe is between the template upstream primer and the template downstream primer, and does not overlap with the two; the probe is reverse complementary to part of the sequence in the long chain of the non-equal-length double-stranded DNA template.

[0011] Preferably, the double joint downstream primer and the template upstream primer form a primer pair for amplifying the single strand after the long chain of the non-equal-length double-stranded DNA template is connected with the joint.

[0012] Preferably, the template upstream primer has no overlapping region with the short chain of the non-equal-length double-stranded DNA template, and is the same as part of the sequence in the long chain of the non-equal-length double-stranded DNA template.

[0013] Preferably, the starting position of the template downstream primer is the 3' end of the long chain of the non-equal-length double-stranded DNA template, and is reverse complementary to part of the sequence in the long chain of the non-equal-length double-stranded DNA template.

[0014] Preferably, the double joint includes an equal-length double joint or a non-equal-length double joint.

[0015] Preferably, the long chain of the non-equal-length double joint is connected with the long chain of the non-equal-length double-stranded DNA template, and the short chain of the non-equal-length double joint is connected with the short chain of the non-equal-length double-stranded DNA template.

[0016] Preferably, the downstream primer of the non-isometric double-stranded adapter does not overlap with the short strand in the non-isometric double-stranded adapter or the overlapping region is less than 5 bp.

[0017] Preferably, the downstream primer of the non-isometric double-stranded adapter is partially reverse-complementary to the long strand in the non-isometric double-stranded adapter.

[0018] In the present application, based on the design idea of the non-isometric double-stranded DNA template, the primer probe for amplifying the non-isometric double-stranded DNA template and the primer probe for amplifying the non-isometric double-stranded DNA template after the adapter is further designed, which can ensure that the primer only amplifies the long strand of the ligation product or the long strand of the non-isometric double-stranded DNA template in the amplification, effectively avoids the additional pairing and extension of different detection primers in the amplification reaction, truly restores the ligation efficiency, and to some extent, eliminates the interference of simultaneous amplification of the two single strands of the double-stranded DNA template on the detection of the ligation efficiency of the adapter.

[0019] It can be understood that the present application is based on the design idea of the non-isometric double-stranded DNA template and the corresponding primer and probe, and is not limited by the specific sequences of the target gene and the adapter. As long as the design idea of ensuring the "non-isometric" of the template and the positional relationship of the primer and the probe, the ligation process of any gene fragment and the adapter can be detected and evaluated. The specific length of the short strand and the long strand in the template, the specific length of the primer and the probe can be selected according to the actual demand and the basic requirements of the specific amplification reaction. Those skilled in the art can know that, for example, the length of the short strand in the template can be 50-500 bp, and the length of the long strand can be 50-1000 bp.

[0020] In a third aspect, the present application provides a method for detecting the blunt-end ligation efficiency, which comprises:

[0021] Taking the product after the non-isometric double-stranded DNA template is ligated with the double-stranded adapter, detecting the amount of all non-isometric double-stranded DNA templates and the amount of non-isometric double-stranded DNA templates ligated with the double-stranded adapter;

[0022] The blunt-end ligation efficiency = the amount of non-isometric double-stranded DNA templates ligated with the double-stranded adapter / the amount of all non-isometric double-stranded DNA templates x 100%.

[0023] Preferably, the method for detecting the blunt-end ligation efficiency uses the kit for detecting the blunt-end ligation efficiency of the double-stranded adapter of the second aspect to detect, specifically comprising:

[0024] Taking the product after the non-isometric double-stranded DNA template is ligated with the double-stranded adapter;

[0025] The product is used as a substrate to perform a first amplification reaction with a template upstream primer, a template downstream primer, and a probe to calculate the amount of all non-isometric double-stranded DNA templates; the product is used as a substrate to perform a second amplification reaction with a template upstream primer, a downstream primer of a double-linker, and a probe to calculate the amount of non-isometric double-stranded DNA templates connected with a double-linker.

[0026] It can be understood that the present application can use common quantitative methods in the art, such as ddPCR, qPCR, etc., to quantify the number of DNA templates, which is easily thought of by those skilled in the art.

[0027] Preferably, the first amplification reaction and the second amplification reaction are each independently selected from a ddPCR or a qPCR reaction.

[0028] Preferably, the amount of all non-isometric double-stranded DNA templates includes the copy number of all non-isometric double-stranded DNA templates.

[0029] Preferably, the amount of non-isometric double-stranded DNA templates connected with a double-linker includes the copy number of non-isometric double-stranded DNA templates connected with a double-linker.

[0030] As a preferred technical solution, the method for detecting blunt-end ligation efficiency comprises the following steps:

[0031] (1) Take non-isometric double-stranded DNA templates and a double-linker to be detected to perform a ligation reaction;

[0032] (2) Take the product of the ligation reaction of step (1);

[0033] The product is used as a substrate to perform a first amplification reaction with a template upstream primer, a template downstream primer, and a probe to calculate the copy number of all non-isometric double-stranded DNA templates;

[0034] The product is used as a substrate to perform a second amplification reaction with a template upstream primer, a downstream primer of a double-linker, and a probe to calculate the copy number of non-isometric double-stranded DNA templates connected with a double-linker;

[0035] The blunt-end ligation efficiency = the copy number of non-isometric double-stranded DNA templates connected with a double-linker / the copy number of all non-isometric double-stranded DNA templates x 100%.

[0036] In a fourth aspect, the present application provides a reaction system for detecting blunt-end ligation efficiency, which is used in the method for detecting blunt-end ligation efficiency according to the third aspect, and comprises a first reaction system and a second reaction system; the first reaction system comprises a product after the non-equal-length double-stranded DNA template is ligated with a double-stranded adapter, an upstream primer on the template, a downstream primer on the template, a probe and a ddPCR reaction solution or a qPCR reaction solution; the second reaction system comprises a product after the non-equal-length double-stranded DNA template is ligated with a double-stranded adapter, an upstream primer on the template, a downstream primer of the double-stranded adapter, a probe and a ddPCR reaction solution or a qPCR reaction solution.

[0037] It can be understood that the ddPCR reaction solution / qPCR reaction solution refers to reagents for performing ddPCR / qPCR reaction in addition to the template, primer and probe, including polymerase, dNTP, buffer and the like, such as a commercially available ddPCR SuperMix, which can be known by those skilled in the art.

[0038] In a fifth aspect, the present application provides application of the kit for detecting double-stranded adapter blunt-end ligation efficiency according to the second aspect, the method for detecting blunt-end ligation efficiency according to the third aspect or the reaction system for detecting blunt-end ligation efficiency according to the fourth aspect in preparation of a nucleic acid library.

[0039] The kit for detecting double-stranded adapter blunt-end ligation efficiency, the method and the like according to the present application can realize rapid and simple detection of single-end blunt-end ligation efficiency, rapid evaluation of performances of different blunt-end ligations, thereby selecting the most suitable adapter, and have important significance for preparation of a high-quality nucleic acid sequencing library.

[0040] Compared with the prior art, the present application has the following beneficial effects:

[0041] (1) The non-equal-length double-stranded DNA template design according to the present application can truly restore ligation efficiency, eliminate interference of simultaneous amplification of two single strands in the double-stranded DNA template on the adapter ligation efficiency, and ensure that the detection primer and the long strand in the non-equal-length double-stranded DNA template and the detection primer and the long strand in the ligation product are in a unique corresponding relationship, thereby avoiding additional amplification, ensuring accuracy and simplicity of the detection result, and realizing accurate determination of blunt-end ligation efficiency.

[0042] (2) The method according to the present application has the advantages of high sensitivity and accurate quantification compared with the method for determining library concentration before and after ligation, and compared with the method for detecting the number of effective libraries after ligation in the prior art, the method according to the present application saves the library construction process, is simpler to operate, faster and does not need to use precious samples. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 The figure is a schematic diagram of the principle of the method according to the present application;

[0044] Figure 2 The results of blunt end ligation efficiency detection map. DETAILED DESCRIPTION

[0045] To further illustrate the technical means adopted by the present application and its effects, the present application will be further described below in conjunction with examples and drawings. It can be understood that the specific embodiments described herein are only used to explain the present application, and not to limit the present application.

[0046] Unless specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art, or according to the product instructions are used. Unless the manufacturer of the reagent or instrument is specified, it is a conventional product that can be commercially available through a regular channel.

[0047] In the examples of the present application, the efficiency of blunt end ligation of KRAS gene is taken as an example. It can be understood that the method of the present application is also used for other genes, and the detection of the efficiency of blunt end ligation of other genes is also within the protection scope of the present application. The schematic diagram of the detection principle is shown in Figure 1

[0048] Example 1

[0049] The present embodiment provides a kit for detecting the efficiency of blunt end ligation of double linkers, which comprises a non-equal-length double-stranded DNA template, a template upstream primer, a template downstream primer, a probe and a double-linker downstream primer.

[0050] The nucleic acid sequence of the non-equal-length double-stranded DNA template comprises the sequence shown in SEQ ID NO. 1-SEQ ID NO. 2.

[0051] The nucleic acid sequence of the double-linker downstream primer comprises the sequence shown in SEQ ID NO. 3.

[0052] The nucleic acid sequence of the template upstream primer comprises the sequence shown in SEQ ID NO. 4.

[0053] The nucleic acid sequence of the probe comprises the sequence shown in SEQ ID NO. 5.

[0054] The nucleic acid sequence of the template downstream primer comprises the sequence shown in SEQ ID NO. 6.

[0055] SEQ ID NO. 1:

[0056] ACCTCTATTGTTGGATCATATTCGTGACTTGCCTACGCCACCAGCT.

[0057] SEQ ID NO. 2: ​

[0058] TGGCCTGCTGAAAATGACTGTAGCTGGTGGCGTAGGCAAGTCACGAA TATGATCCAACAATAGAGGT.

[0059] SEQ ID NO.3: TCTTTCCCTACACGACGCTC.

[0060] SEQ ID NO.4: GGCCCTGCTGAAAATGACTG.

[0061] SEQ ID NO.5: CTTGCCTACGCCACCAG.

[0062] SEQ ID NO.6: CCTCTATTGTTGGATCATATTCG.

[0063] The kit also includes commercially available reagents for PCR amplification.

[0064] Example 2

[0065] This example provides a method for detecting the efficiency of KRAS gene end joining.

[0066] The DNA template and primer probe sequences are shown in Table 1. The DNA template, primers and probes were synthesized by GenScript (Nanjing) Biotechnology Co., Ltd., and the adapters were synthesized by Integrated DNA Technologies (IDT) Co., Ltd. (USA). The products were delivered in dry powder form, added to IDTE buffer (IDT) according to the manufacturer's recommended volume, and quality controlled using a NanoDrop spectrophotometer (ThermoFisher).

[0067] Table 1

[0068]

[0069] wherein SpacerC3 represents a 3' end spacer modification, a blocking group for oligonucleotide extension, Pho represents a 5' end phosphate modification group, and *C*A*T*T represents a thio modification. Insert-F is the short strand in the non- equal length double-stranded KRAS gene template, and Insert-R is the long strand in the non- equal length double-stranded KRAS gene template. Probe refers to a specific probe. LEF represents a KRAS gene downstream primer, LER-ATNR1 represents a linker downstream primer, KRASR represents a KRAS gene upstream primer. CL53T represents the short strand in the double-stranded linker, and CL73 represents the long strand in the double-stranded linker.

[0070] The non-equal length DNA double-stranded template preparation system is shown in Table 2.

[0071] Table 2

[0072] Component Volume Final concentration Insert-F (10 μΜ) 25 μL 50 μΜ Insert-R (10 μΜ) 25 μL 50 μΜ 5 M NaCl 0.5 μL 50 mM

[0073] The above system was prepared and incubated at 95°C for 10s (AutoDelta-0.1°C / s) > 10°C reaction program in a PCR instrument to anneal to form non-isometric DNA double strands and diluted to 0.1 μΜ.

[0074] The blunt end linker preparation system is shown in Table 3.

[0075] Table 3

[0076] Component Volume Final concentration CL53T (100 μΜ) 25 μL 50 μΜ CL73 (100 μΜ) 25 μL 50 μΜ 5 M NaCl 0.5 μL 50 mM

[0077] The above system was prepared and incubated at 95°C for 10s (AutoDelta-0.1°C / s) > 10°C reaction program in a PCR instrument to anneal to form double-stranded linkers.

[0078] The blunt end linker preparation system is shown in Table 3.

[0079] Table 4

[0080] Component Volume (μL) 10x T4 DNA ligase buffer 10 50% PEG 4000 10 1% Tween 20 2.5 Adapter (50 μΜ) 4 5 U / μL T4 DNA ligase 2 Non-equal length DNA double-stranded template (0.1 μΜ) 2 H2O 69.5

[0081] The above reaction system was prepared and incubated at 22°C for 1h in a PCR instrument to perform the ligation reaction. 10 μL of the ligation product (theoretical template molecule concentration 1.2E9 / μL) was diluted 10 times with TET buffer gradient to 1.2E4 / μL, and 1 μL was taken into a 20 μL ddPCR system. (ddPCR requires <= 1.2E5 copies / 20 μL) 5

[0082] (2) Preparation of control samples

[0083] 2 μL of 0.1 μM template mixture was taken and diluted 10 times with 98 μL of IDTE buffer (1.2 x 10 9 5

[0084] (3) Establishment of ddPCR system

[0085] The above diluted ligation product and control samples were taken as substrates, and LEF+KRASR and LER-ATNR1+KRASR were taken as primer combinations to perform ddPCR. For a single ddPCR reaction, the system is as shown in Table 5.

[0086] Table 5

[0087] ​​​ Component Volume (μL) 2x ddPCR Super Mix (no dUTP) 10 Upper primer (10 μΜ) 1.8 Lower primer (10 μΜ) 1.8 Probe (5 μΜ) 1 H2O 4.4

[0088] In each system, the upstream primer is KRASR, and the downstream primer is LEF or LER-ATNR1.

[0089] The reaction procedure is shown in Table 6.

[0090] Table 6

[0091]

[0092] (4) Result interpretation: According to the DNA copy number before and after the ligation of LEF+KRASR and LER-ATNR1+KRASR, the blunt-end ligation efficiency is calculated as follows: the copy number of double-stranded DNA template after ligation (LER-ATNR1+KRASR amplification calculation) / the copy number of all non-isometric double-stranded DNA templates (LEF+KRASR amplification calculation) * 100%.

[0093] The ddPCR result is shown in Figure 2 According to the calculation formula: ligation efficiency = the amount of double-stranded DNA template after ligation / the total amount of non-isometric double-stranded DNA template * 100%, the measured ligation efficiency = [(484+469+499) / 3] / [(564+543+566) / 3]*100% = 86.8%.

[0094] In the design idea of the non-isometric double-stranded DNA template and the corresponding primer and probe based on the present application, it can be understood that the copy number of the double-stranded DNA template after ligation is actually the copy number of the long chain in the double-stranded DNA template after ligation, and the copy number of all non-isometric double-stranded DNA templates is actually the copy number of the long chain in all non-isometric double-stranded DNA templates.

[0095] In addition, according to the principle of the calculation method and the experimental method for detecting the blunt-end ligation efficiency of the present application, whether the double-stranded linker is isometric or non-isometric does not affect the detection of the blunt-end ligation efficiency using the present application. As long as the double-stranded DNA template is non-isometric, the interference of the simultaneous amplification of the two single strands in the double-stranded DNA template on the determination of the ligation efficiency can be excluded to a certain extent, and the amplification of the non-isometric double-stranded DNA template and the amplification of the double-stranded DNA template after ligation can be ensured to be of the same order of magnitude, which can more truly restore the ligation efficiency and achieve the purpose and effect of detecting the blunt-end ligation efficiency of the present application. Therefore, in addition to being applied to the case of using a non-isometric double-stranded linker, the present application can also be applied to the case of using an isometric double-stranded linker.

[0096] It can be understood that the present application can also use other quantitative methods such as qPCR to quantify the number of DNA templates, which is also easily thought by those skilled in the art, and then the corresponding equipment and / or reagents in the specific embodiments of the present application are replaced with those suitable for qPCR reaction.

[0097] In summary, the present application can realize the rapid and simple detection of single-end blunt-end ligation efficiency, the results are stable, and the performance of different blunt-end ligation can be quickly evaluated, so as to select the most suitable joint. The non-equal-length double-stranded DNA template design can truly restore the ligation efficiency, and ensure that the order of magnitude of the template amplification and the order of magnitude of the ligation product amplification are comparable.

[0098] Applicants declare that the present application is illustrated by the above embodiments to explain the detailed method of the present application, but the present application is not limited to the above detailed method, that is, it does not mean that the present application must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific methods, etc. fall within the protection scope and disclosure scope of the present application.

Claims

1. Use of a non-equal-length double-stranded DNA template in detecting blunt-end ligation efficiency of a double-stranded adaptor.

2. A kit for detecting the efficiency of blunt-end ligation of a bi-directional linker, characterized by, The kit comprises a non-equal-length double-stranded DNA template, a template upstream primer, a template downstream primer, a probe and a double-stranded adaptor downstream primer; The non-equal-length double-stranded DNA template comprises a long strand and a short strand, one end of which is a blunt end and the other end is a non-blunt end; The template upstream primer and the template downstream primer form a primer pair for amplifying the long strand of the non-equal-length double-stranded DNA template, and the template upstream primer and the template downstream primer do not form a primer pair for amplifying the short strand of the non-equal-length double-stranded DNA template; The binding region of the probe is between the template upstream primer and the template downstream primer, and does not overlap with both; the probe is reverse complementary to part of the sequence in the long strand of the non-equal-length double-stranded DNA template.

3. The kit of claim 2, wherein the double-stranded adaptor downstream primer and the template upstream primer form a primer pair for amplifying a single strand after the long strand of the non-equal-length double-stranded DNA template is connected with the adaptor.

4. The kit of claim 2, wherein the template upstream primer has no overlapping region with the short strand of the non-equal-length double-stranded DNA template, and is identical to part of the sequence in the long strand of the non-equal-length double-stranded DNA template; The starting position of the template downstream primer is the 3' end of the long strand of the non-equal-length double-stranded DNA template, and the template downstream primer is reverse complementary to part of the sequence in the long strand of the non-equal-length double-stranded DNA template.

5. The kit for detecting efficiency of blunt-end ligation of a bi-directional linker according to any one of claims 2 to 4, wherein The double-stranded adaptor comprises an equal-length double-stranded adaptor or a non-equal-length double-stranded adaptor; Preferably, the long strand of the non-equal-length double-stranded adaptor is connected with the long strand of the non-equal-length double-stranded DNA template, and the short strand of the non-equal-length double-stranded adaptor is connected with the short strand of the non-equal-length double-stranded DNA template; Preferably, the double-stranded adaptor downstream primer does not overlap with the short strand of the non-equal-length double-stranded adaptor or the overlapping region is less than 5 bp; Preferably, the double-stranded adaptor downstream primer is reverse complementary to part of the sequence in the long strand of the non-equal-length double-stranded adaptor.

6. A method of detecting blunt-end ligation efficiency, characterized by, The method comprises: taking the product after the non-equal-length double-stranded DNA template is connected with the double-stranded adaptor, detecting the amount of all non-equal-length double-stranded DNA templates and the amount of non-equal-length double-stranded DNA templates connected with the double-stranded adaptor; The blunt-end ligation efficiency = the amount of non-equal-length double-stranded DNA templates connected with the double-stranded adaptor / the amount of all non-equal-length double-stranded DNA templates × 100%.

7. The method of detecting blunt-end ligation efficiency according to claim 6, wherein, The method utilizes the kit for detecting the blunt-end ligation efficiency of the double-stranded adaptor according to any one of claims 2 to 5, and specifically comprises: taking the product after the non-equal-length double-stranded DNA template is connected with the double-stranded adaptor; performing a first amplification reaction on the product as a substrate with the template upstream primer, the template downstream primer and the probe, and calculating the amount of all non-equal-length double-stranded DNA templates; performing a second amplification reaction on the product as a substrate with the template upstream primer, the double-stranded adaptor downstream primer and the probe, and calculating the amount of non-equal-length double-stranded DNA templates connected with the double-stranded adaptor.

8. The method of detecting blunt-end ligation efficiency according to claim 7, wherein, The first amplification reaction and the second amplification reaction are each independently selected from a ddPCR reaction.

9. The method of detecting blunt-end ligation efficiency according to claim 8, wherein, The amount of all non-equal-length double-stranded DNA templates comprises the copy number of all non-equal-length double-stranded DNA templates. Preferably, the amount of the non-equal-length double-stranded DNA template with the double-linker connected thereto comprises the copy number of the non-equal-length double-stranded DNA template with the double-linker connected thereto.

10. The method of detecting blunt-end ligation efficiency according to any one of claims 6-9, wherein, The method comprises the following steps: (1) connecting the non-equal-length double-stranded DNA template with the double-linker to be detected; (2) taking the product of the connection reaction in step (1); performing a first amplification reaction on the product as a substrate with a template upstream primer, a template downstream primer, and a probe, and calculating the copy number of all non-equal-length double-stranded DNA templates; performing a second amplification reaction on the product as a substrate with a template upstream primer, a double-linker downstream primer, and a probe, and calculating the copy number of the non-equal-length double-stranded DNA template with the double-linker connected thereto; The blunt-end connection efficiency = the copy number of the non-equal-length double-stranded DNA template with the double-linker connected thereto / the copy number of all non-equal-length double-stranded DNA templates x 100%.

11. A reaction system for detecting blunt-end ligation efficiency, characterized in that, The reaction system is used in the method for detecting the blunt-end connection efficiency according to claim 8, and the reaction system comprises a first reaction system and a second reaction system; The first reaction system comprises the product after the non-equal-length double-stranded DNA template is connected with the double-linker, a template upstream primer, a template downstream primer, a probe, and a ddPCR reaction solution or a qPCR reaction solution; The second reaction system comprises the product after the non-equal-length double-stranded DNA template is connected with the double-linker, a template upstream primer, a double-linker downstream primer, a probe, and a ddPCR reaction solution or a qPCR reaction solution.

12. Use of the kit for detecting the blunt-end connection efficiency of the double-linker according to any one of claims 2 to 5, the method for detecting the blunt-end connection efficiency according to any one of claims 6 to 10, or the reaction system for detecting the blunt-end connection efficiency according to claim 11 in the preparation of a nucleic acid library.

Images