Molecular marker for identifying genetic sex of different populations of micropterus salmoides as well as primer pair and application of molecular marker

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker for identifying genetic sex of different populations of micropterus salmoides as well as a primer pair and application of the molecular marker. The invention provides a molecular marker for identifying genetic sex of different populations of micropterus salmoides. The molecular marker is located between the 35054224th site and the 35054476th site of a micropterus salmoides genome database ASM2243578v1 genetic sex number 15 linkage group. The used primer pair comprises M-F and M-R. PCR amplification is carried out through the primer pair, if two bands of 307 bp and 253 bp are obtained through amplification, the male is determined, and if only the band of 253 bp is determined, the female is determined. According to the method, the sex of the largemouth bass can be accurately identified, a result can be obtained on the same day, and the repeatability is high. The method lays a technical foundation for sex control breeding and unisexual breeding of the micropterus salmoides.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a molecular marker for identifying the genetic sex of different groups of largemouth bass, a primer pair thereof and an application thereof. Background Art

[0002] Largemouth bass ( Micropterus salmoides ), also known as California bass, is native to North America. Since its introduction to my country in 1980, it has quickly become an important freshwater aquaculture species in my country due to its delicious meat, no intramuscular spines, rapid growth, and short breeding cycle. According to the "2024 China Fisheries Statistical Yearbook", the national largemouth bass aquaculture output in 2023 was 888,000 tons, and its growth rate ranked among the top in my country's freshwater aquaculture fish. Based on the morphological characteristics and geographical distribution of largemouth bass, it is divided into northern subspecies ( M. salmoides salmoides ) and the Florida subspecies ( M. salmoides floridanus ), the northern subspecies is found in the central and eastern United States, northeastern Mexico, and southeastern Canada, while the Florida subspecies is found in southern Florida. In recent years, due to a shortage of newly introduced germplasm resources and the practice of self-propagation by farmers, the genetic diversity of largemouth bass has decreased significantly, leading to a significant deterioration of desirable traits, primarily manifested by frequent disease outbreaks, early sexual puberty, and slower growth. The development of targeted breeding for new largemouth bass varieties is urgent. Studies have shown that largemouth bass exhibit early sexual dimorphism. After 60 days of artificial rearing, males exhibit superior growth performance, and males exhibit superior liver antioxidant and immune indicators, as well as intestinal barrier function, compared to females. Furthermore, largemouth bass exhibit significant sexual dimorphism in stripe shape, net meat percentage, and feed conversion ratio, with males exhibiting better stripe shape, higher net meat percentage, and lower feed conversion ratio. Therefore, cultivating monosexed, improved varieties is of great economic value for the development of the industry.

[0003] Before sexual maturity, it's difficult to distinguish the sex of largemouth bass based on their external morphology. The sex determination type of largemouth bass is XX / XY, and one of the key technologies for producing all-male seedlings is the development and identification of sex molecular markers. Currently, Chinese Patent Publication No. CN114717301A discloses a molecular marker and primer pair for identifying the genetic sex of largemouth bass. This marker is present on the X chromosome, which is the genetic sex of largemouth bass, and is absent on the Y chromosome. Using this primer pair, the sex ratio of embryos, larvae, and adults of largemouth bass can be easily, quickly, and stably determined with 100% accuracy. Chinese Patent Publication No. CN113637765A, on the other hand, has developed SNP markers for genetic sex identification of largemouth bass. However, the molecular markers for genetic sex of largemouth bass disclosed in these patents have an accuracy rate of less than 80% in different geographic populations of Taiwanese and Sichuan bass, possibly due to differences in their selection of sex-determining loci. Furthermore, no relevant literature has been published regarding the identification of the genetic sex of Taiwanese and Sichuan bass. SUMMARY

[0004] In view of the problems existing in the prior art, the purpose of the present application is to provide a technical solution of a molecular marker for identifying genetic sex of different populations of Micropterus salmoides, a primer pair and application thereof.

[0005] The present application specifically adopts the following technical solutions to achieve the above purpose: The first aspect of the present application provides a molecular marker for identifying genetic sex of different populations of Micropterus salmoides, which is shown in SEQ ID NO. 1 and exists between the 35054224th and 35054476th positions on the 15th linkage group of the genetic sex of the Micropterus salmoides genome database (ASM2243578v1).

[0006] The second aspect of the present application provides a primer pair for identifying genetic sex of different populations of Micropterus salmoides, which comprises primers M-F and M-R, the nucleotide sequence of the primer M-F is shown in SEQ ID NO. 2, and the nucleotide sequence of the primer M-R is shown in SEQ ID NO. 3.

[0007] The third aspect of the present application provides a kit containing the above-mentioned primer pair.

[0008] The fourth aspect of the present application provides application of the above-mentioned primer pair in identifying genetic sex of different populations of Micropterus salmoides.

[0009] The fifth aspect of the present application provides a method for identifying a molecular marker for genetic sex of different populations of Micropterus salmoides by using the above-mentioned primer pair, which performs PCR amplification on the DNA to be tested by using the above-mentioned primer pair.

[0010] The sixth aspect of the present application provides a method for identifying genetic sex of different populations of Micropterus salmoides, which performs PCR detection by using the above-mentioned primer pair, if the PCR amplification fragment has two specific bands of different sizes of 307 bp and 253 bp, it is judged that the genetic sex of the Micropterus salmoides to be tested is male, and if the PCR amplification fragment has only one specific band of 253 bp, it is judged that the genetic sex of the Micropterus salmoides to be tested is female.

[0011] Further, the reaction system of the PCR detection is calculated based on the total reaction volume of 20 μL, 2x Taq PCRmix 10 μL, Depc H2O 8 μL, DNA template 1 μL, M-F / -R: 0.5 μL / 0.5 μL.

[0012] Further, the amplification condition of the PCR detection is: 94℃, 5 min; 94℃, 30 s; 60℃, 40 s; 72℃, 30 s; 35 cycles; 72℃, extension for 10 min.

[0013] Compared with the prior art, the beneficial effects of the present application are: The present application can accurately identify the gender of the largemouth bass by extracting DNA of the largemouth bass sample to be identified, cooperating with the gender-specific molecular marker primer for PCR amplification, and then performing agarose gel electrophoresis detection. Compared with the prior art, the gender detection accuracy of the largemouth bass of the broad bass, the tai bass and the Sichuan bass is 100%, and the result can be obtained on the same day, and the repeatability is high. Through this method, a technical foundation is laid for gender control breeding and monosex culture of largemouth bass. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 Agarose gel electrophoresis results of the gender-specific molecular marker of the largemouth bass; Figure 2 Sequencing results of the PCR product of the gender-specific molecular marker of the largemouth bass. DETAILED DESCRIPTION

[0015] The concept and technical effects of the present application will be described below in conjunction with the embodiments for a clear and complete description, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0016] Example 1: Application of primer pairs for identifying genetic gender of largemouth bass in different populations

[0017] 1. Experimental materials The largemouth bass used in this embodiment is the domestic different populations of tai bass, Sichuan bass and Guangdong bass collected and preserved by Huzhou Rongsheng Aquaculture Technology Co., Ltd. in the early stage, which are separately bred after being injected with PIT electronic markers.

[0018] 2. Sample selection Tai bass, Sichuan bass and Guangdong bass populations were selected for sampling. After the gender was identified by dissection of the gonad, the tail fin was cut and preserved in 95% ethanol at -80°C for standby use.

[0019] 3. DNA extraction The DNA of the female and male samples of the different populations of Micropterus salmoides, Micropterus dolomieu and Micropterus notius was extracted by using a blood / cell / tissue genomic DNA extraction kit (Cat No. DP304-03), the quality and concentration of the genomic DNA were detected by using 1.2% agarose gel electrophoresis NanoDrop 2000, and finally the extracted DNA concentration was diluted to 50 ng / μL for storage.

[0020] 4. PCR amplification and gel electrophoresis detection The primer pair was designed by using the molecular marker of the genetic sex of Micropterus salmoides (the molecular marker is shown in SEQ ID NO. 1, and the molecular marker exists between the 35054224th and 35054476th positions on the genetic sex 15th linkage group of the genomic database ASM2243578v1 of Micropterus salmoides). The primer pair used in this embodiment includes: M-F: GTCCTTACGGAGTAGCTCAGTCC (SEQ ID NO. 2) M-R: GTCTGCAGTGTCTAGTCTGAACG (SEQ ID NO. 3) The DNA samples of the female and male samples of Micropterus salmoides were used as templates for PCR amplification by using the above primer pair.

[0021] The PCR reaction system was as follows: 2x Taq PCR mix 10 μL; Depc H2O 8 μL; DNA template 1 μL; M-F / -R: 0.5 μL / 0.5 μL.

[0022] The reaction program was as follows: 94℃, 5 min; 94℃, 30 s; 60℃, 40 s; 72℃, 30 s; 35 cycles; 72℃ extension for 10 min, and then storage at 4℃.

[0023] After the completion of PCR amplification, 2% agarose gel electrophoresis was used for detection, V-130 V, A-400 mA, T-50 min.

[0024] 5. Result analysis The 18 female and male samples of Micropterus salmoides of the three populations of domestic Micropterus salmoides, Micropterus dolomieu and Micropterus notius were subjected to PCR amplification and agarose gel electrophoresis, and the results showed that the female samples of Micropterus salmoides were single bands with a size of 253 bp, while the male samples were double bands with sizes of 307 bp and 253 bp (Fig. 1), and the detection results were consistent with the sampling results, and the detection accuracy was 100%. Figure 1

[0025] 6. Sequencing analysis The SanPrep column type DNA gel recovery kit (Shanghai, GenScript) was used to recover the DNA fragments of the female and male samples of Micropterus salmoides, and the recovered DNA fragments were sequenced by using the ABI3730XL DNA sequencer. Figure 1 ​The obtained female 253 bp and male 307 bp and 253 bp bands were recovered by gel cutting and gel cutting, and after confirming that the concentration was qualified, they were connected with pESI-T vector, and then transformed into DH5a competent cells. Positive clones were selected and sent to Shanghai Genechem Biotechnology Co., Ltd. for sequencing. The sequencing results are shown in Figure 2 Figure 2, wherein X represents the female 253 bp band and Y represents the male 307 bp band.

Claims

1. A molecular marker for identifying the genetic sex of different populations of Micropterus salmoides, characterized in that, The molecular marker is shown in SEQ ID NO. 1, and exists between 35054224 and 35054476 on the genetic sex 15 linkage group of the database ASM2243578v1 of the genome of Micropterus salmoides.

2. A primer pair for identifying the genetic sex of different populations of Micropterus salmoides, characterized in that, The primer pair comprises primer M-F and M-R, the nucleotide sequence of the primer M-F is shown in SEQ ID NO. 2, and the nucleotide sequence of the primer M-R is shown in SEQ ID NO.

3.

3. A kit comprising the primer pair of claim 2.

4. Use of the primer pair of claim 2 or the kit of claim 3 in identifying the genetic sex of different populations of Micropterus salmoides.

5. A method for identifying the molecular marker of claim 1 using the primer pair of claim 2, wherein, The DNA to be tested is subjected to PCR amplification by the primer pair of claim 2. ​ 6. A method of identifying the genetic sex of different populations of Micropterus salmoides, characterized by, If there are two specific bands of different sizes, 307 bp and 253 bp, in the PCR amplification fragment, it is determined that the genetic sex of the Micropterus salmoides to be tested is male; If there is only one specific band, 253 bp, in the PCR amplification fragment, it is determined that the genetic sex of the Micropterus salmoides to be tested is female.

7. The method of claim 6, wherein, The reaction system of the PCR detection is as follows: 2x Taq PCR mix 10 μL; Depc H2O 8 μL; DNA template 1 μL; M-F / -R: 0.5 μL / 0.5 μL, calculated based on the total reaction volume of 20 μL.

8. The method of claim 6, wherein, The amplification conditions of the PCR detection are as follows: 94℃, 5 min; 94℃, 30 s; 60℃, 40 s; 72℃, 30 s; 35 cycles; 72℃, 10 min.

Images