Triplex forming oligonucleotide sequences that inhibit amplification of mdm2 and mdm4 genes and uses thereof
By designing triple-stranded oligonucleotide sequences of specific lengths and binding positions to pair with DNA, the amplification of MDM2 and MDM4 genes is inhibited, solving the problem of high toxicity and side effects of existing inhibitors and achieving safer cancer treatment.
Patent Information
- Application Number
- CN202510840630.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-28
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-04-28
AI Technical Summary
Existing inhibitors targeting MDM2 and MDM4 have significant toxic side effects, and there is an urgent need to develop inhibitors that can target MDM2 and MDM4 to improve targeting and reduce or avoid toxic side effects in cancer treatment.
A triple-stranded oligonucleotide sequence, 22-23 bases in length, was designed to bind to a specific location on human chromosome 12. It pairs with double-stranded DNA via Husstan or anti-Husstan pairing while maintaining the normal Watson-Crick pairing pattern, and is used to inhibit the amplification of the MDM2 and MDM4 genes.
It effectively inhibits the amplification of MDM2 and MDM4 genes, reduces or avoids toxic side effects, and improves the efficacy of cancer treatment.
Smart Images

Figure CN120837517B_ABST
Abstract
Description
[0001] This application is a divisional application of Chinese Patent Application No. 202410531366.5, "Triplex-forming oligonucleotide sequence for inhibiting amplification of MDM2 and MDM4 genes and application thereof", filed on April 28, 2024. TECHNICAL FIELD
[0002] The present application belongs to the technical field of biological medicine, and relates to an oligonucleotide sequence and application thereof, in particular to a triplex-forming oligonucleotide (TFO) sequence for inhibiting amplification of MDM2 and MDM4 genes and application thereof. BACKGROUND
[0003] P53 is a tumor suppressor gene with the highest correlation to human tumors ever discovered. Wild-type p53 protein has the function of timely repairing damage and inhibiting uncontrolled cell growth, and its inactivation plays an important role in tumor formation. MDM2 and MDM4 are the main negative regulators of p53, which inhibit the function of p53 in different and complementary ways. MDM2 mainly regulates the stability of p53, and MDM4 regulates the activity of p53. Overexpression of MDM2 and MDM4 genes can induce spontaneous tumor formation under the control of their natural promoters or heterologous promoters. Amplification of MDM2 can be found in more than 1 / 3 of human sarcoma samples and a series of tumors outside sarcoma. It is widely present in various histological subtypes of soft tissue sarcoma, including osteosarcoma, liposarcoma, lipoma, leiomyosarcoma, rhabdomyosarcoma, malignant schwannoma, fibrosarcoma, perivascular cell tumor and malignant fibrous histiocytoma. In addition, MDM2 is also amplified outside sarcoma, including malignant glioma, breast cancer, ovarian cancer, urothelial carcinoma, lung cancer, gastrointestinal tumors, etc. Amplification of MDM4 gene is found in various tumors, with a high amplification rate of 65% (32 / 49) in retinoblastoma; the rest have 10% amplification in ER+ breast cancer, 17% amplification in primary invasive breast cancer, 17% amplification in soft tissue sarcoma, and about 10% amplification in malignant glioma, the rest have a certain proportion of amplification in metastatic melanoma, atypical liposarcoma, well-differentiated liposarcoma, and bladder cancer.
[0004] There are many pharmaceutical companies that have designed and produced small molecule protein drugs targeting MDM2 on the market, but they are very easy to produce drug resistance, and the curative effect is often not satisfactory. MDM2 small molecule drugs have strong side effects, and preclinical studies show that MDM2 small molecule drugs have gastrointestinal and lymphatic toxicity. NCT02935907 is a clinical study on MDM2 small molecule inhibitor APG-115 in advanced solid tumors. The first course of treatment occurred dose-limiting toxicity (DLTs), including 2 grade platelet reduction at 200mg dose, 3 grade platelet reduction at 300mg dose, and 3 grade fatigue at 100mg and 300mg, respectively. The most common 3 or 4 grade treatment-related adverse events (AEs) include: fatigue, nausea, vomiting, diarrhea, anorexia, dehydration, neutropenia, leukopenia, limb pain and thrombocytopenia. In another study on APG-115 in Chinese patients with advanced soft tissue sarcoma (CTR20170975), a patient taking 200mg dose was observed to have two dose-limiting toxicities (DLTs) of thrombocytopenia and febrile neutropenia. Common adverse reactions (TEAEs) include: anemia, thrombocytopenia, vomiting, hypercholesterolemia and leukopenia. Seven people (54%) had serious adverse events (SAEs), four of which were related to treatment. Common 3 / 4 grade treatment-related adverse events (TRAEs) include anemia (38.5%), thrombocytopenia (38.5%), leukopenia (30.8%) and neutropenia (23.1%). In addition to antagonizing the function of p53, MDM2 protein is also involved in normal hematopoietic function, and treatment with MDM2 antagonists can cause hematopoietic defects in patients.
[0005] MDM4 is also one of the negative regulators of p53, mainly playing a role in regulating the activity of tumor suppressor gene p53. Current inhibitors targeting MDM4 mainly target the MDM4-P53 binding site, which can be divided into short peptide inhibitors and small molecule inhibitors. Currently, only a few short peptide inhibitors have entered clinical trial research, and their inhibition of tumors is related to the enhancement of P53, and they cannot play a tumor inhibitory role independent of P53. In normal cells and tissues, increased P53 activity can produce toxic effects.
[0006] The existing art inhibitors targeting MDM2 and MDM4 have large toxic side effects, so it is urgent to develop an inhibitor targeting MDM2 and MDM4, which can improve the targeting while reducing or avoiding toxic side effects, so as to achieve better effect of treating cancer. SUMMARY
[0007] To solve the above technical problems, the present application provides a triplex-forming oligonucleotide (TFO) sequence for inhibiting MDM2 and MDM4 gene amplification and application thereof.
[0008] The present application provides a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification, wherein the sequence length of the triplex-forming oligonucleotide is 22 bases, the triplex-forming oligonucleotide is combined at position 68809256-68809277 of human chromosome 12, and the DNA double strand is paired according to Hoogsteen or anti-Hoogsteen pairing principle while maintaining the normal mode of Watson-Crick pairing.
[0009] The present application also provides a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 1.
[0010] The present application also provides a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification, wherein the sequence length of the triplex-forming oligonucleotide is 23 bases, the triplex-forming oligonucleotide is combined at position 68809258-68809280 of human chromosome 12, and the DNA double strand is paired according to Hoogsteen or anti-Hoogsteen pairing principle while maintaining the normal mode of Watson-Crick pairing.
[0011] The present application also provides a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 2.
[0012] The present application also provides a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification, wherein the sequence length of the triplex-forming oligonucleotide is 22 bases, the triplex-forming oligonucleotide is combined at position 68809289-68809310 of human chromosome 12, and the DNA double strand is paired according to Hoogsteen or anti-Hoogsteen pairing principle while maintaining the normal mode of Watson-Crick pairing.
[0013] The present application also provides a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 3.
[0014] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68813575-68813597, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0015] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 4.
[0016] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68813607-68813629, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0017] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 5.
[0018] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68835820-68835842, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0019] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 6.
[0020] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68835838-68835860, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0021] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 7.
[0022] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839310-68839332 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0023] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 8.
[0024] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839311-68839333 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0025] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 9.
[0026] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839314-68839336 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0027] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 10.
[0028] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, is bound to human chromosome 12 at position 68839320-68839341, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0029] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 11.
[0030] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839321-68839343, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0031] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 12.
[0032] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839338-68839360, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0033] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 13.
[0034] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, is bound to human chromosome 12 at position 68839346-68839367, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0035] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 14.
[0036] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839364-68839386 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0037] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 15.
[0038] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839369-68839391 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0039] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 16.
[0040] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839393-68839415 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0041] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 17.
[0042] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839407-68839429, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0043] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 18.
[0044] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839418-68839440, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0045] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 19.
[0046] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839451-68839473, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0047] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 20.
[0048] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839480-68839502, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0049] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 21.
[0050] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839562-68839584 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0051] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 22.
[0052] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, binds at position 68839595-68839616 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0053] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 23.
[0054] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839599-68839621 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0055] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 24.
[0056] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839600-68839622, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0057] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 25.
[0058] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, is bound to human chromosome 12 at position 68839630-68839651, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0059] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 26.
[0060] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 21 bases in length, is bound to human chromosome 12 at position 68839632-68839652, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0061] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 27.
[0062] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, is bound to human chromosome 12 at position 68839665-68839686, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0063] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 28.
[0064] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839674-68839696 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0065] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 29.
[0066] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839679-68839701 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0067] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 30.
[0068] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839694-68839716 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0069] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 31.
[0070] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839709-68839731, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0071] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 32.
[0072] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839718-68839740, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0073] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 33.
[0074] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, is bound to human chromosome 12 at position 68839753-68839774, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0075] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 34.
[0076] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound to human chromosome 12 at position 68839764-68839786, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0077] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 35.
[0078] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839793-68839815 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0079] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 36.
[0080] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, binds at position 68839814-68839836 of human chromosome 12, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0081] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 37.
[0082] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex-forming oligonucleotide is 22 bases in length, binds at position 204525409-204525430 of human chromosome 1, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0083] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 38.
[0084] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex-forming oligonucleotide is 21 bases in length, is bound at position 204525412-204525432 of human chromosome 1, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0085] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 39.
[0086] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound at position 204525514-204525536 of human chromosome 1, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0087] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 40.
[0088] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound at position 204525532-204525554 of human chromosome 1, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0089] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex-forming oligonucleotide is shown as SEQ ID NO: 41.
[0090] The application also provides a triplex-forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex-forming oligonucleotide is 23 bases in length, is bound at position 204525535-204525557 of human chromosome 1, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0091] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 42.
[0092] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM4 gene, wherein the sequence of the triplex forming oligonucleotide is 22 bases in length, binds at position 204525551-204525572 of human chromosome 1, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0093] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 43.
[0094] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM4 gene, wherein the sequence of the triplex forming oligonucleotide is 23 bases in length, binds at position 204525561-204525583 of human chromosome 1, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0095] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 44.
[0096] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM4 gene, wherein the sequence of the triplex forming oligonucleotide is 22 bases in length, binds at position 204525576-204525597 of human chromosome 1, pairs with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.
[0097] The application also provides a triplex forming oligonucleotide for inhibiting amplification of the MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 45.
[0098] The application also provides a triplex forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex forming oligonucleotide is 23 bases in length, is bound to human chromosome 1 at position 204525579-204525601, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time.
[0099] The application also provides a triplex forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 46.
[0100] The application also provides a triplex forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex forming oligonucleotide is 23 bases in length, is bound to human chromosome 1 at position 204525589-204525611, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time.
[0101] The application also provides a triplex forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 47.
[0102] The application also provides a triplex forming oligonucleotide for inhibiting amplification of an MDM4 gene, wherein the sequence of the triplex forming oligonucleotide is 22 bases in length, is bound to human chromosome 1 at position 204525673-204525694, is paired with double-stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time.
[0103] The application also provides a triplex forming oligonucleotide for inhibiting amplification of an MDM2 gene, wherein the sequence of the triplex forming oligonucleotide is shown as SEQ ID NO: 48.
[0104] The application also provides a pharmaceutical composition comprising the triplex forming oligonucleotide and a pharmaceutically acceptable carrier.
[0105] The application also provides use of the triplex forming oligonucleotide or the pharmaceutical composition in preparation of a drug for inhibiting amplification of an MDM2 or MDM4 gene.
[0106] The application also provides the use of the triplex forming oligonucleotide or the pharmaceutical composition in the preparation of a drug for preventing or treating tumors.
[0107] The application provides a new therapeutic drug for MDM2 / MDM4 amplified tumor patients, and a deoxyribonucleic acid specific sequence targeting MDM2 / MDM4 gene is designed to form a triplex structure in the amplified MDM2 / MDM4 gene of tumor cells, cause replication stress, and finally lead to apoptosis of tumor cells; in normal cells, the MDM2 / MDM4 gene is not amplified, and the formed triplex structure is restored to normal under the action of DNA double-strand repair, so it has no damage to normal cells. The application targets the MDM2 / MDM4 amplified gene sequence instead of protein, has better drug resistance than the small molecule inhibitor drugs in the prior art, targets MDM2 / MDM4 amplified tumor cells, causes apoptosis of tumor cells containing MDM2 / MDM4 amplification, has no effect on normal cells without MDM2 / MDM4 amplification, has excellent safety, has good therapeutic effect on MDM2 / MDM4 gene amplified tumors. In summary, the triplex forming oligonucleotide and the pharmaceutical composition thereof provided by the application have good targeting, effectiveness and safety for treating or inhibiting MDM2 / MDM4 amplified tumor cells. BRIEF DESCRIPTION OF DRAWINGS
[0108] Figure 1 Figure 1 is a graph showing the inhibitory effect of triplex forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells in MDM2 high-copy cell line 93T449 after 48h treatment;
[0109] Figure 2Figure 8 is a graph of the inhibition of cells by the triple-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 when treated for 48 h in the MDM2 high copy cell line 94T778;
[0110] Figure 3 Figure 9 is a graph of the inhibition of cells by the triple-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 when treated for 48 h in the MDM2 high copy cell line SJSA-1;
[0111] Figure 4 Figure 10 is a graph of the inhibition of cells by the triple-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 when treated for 48 h in the MDM2 low copy cell line SW872;
[0112] Figure 5Figure 8 is a graph of the inhibition of cells by triplex forming oligonucleotide fragments targeting MDM2 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 when treated for 48 h in the normal cardiac myocyte cell line H9C2;
[0113] Figure 6 Figure 9 is a confocal image of triplex forming oligonucleotide fragments targeting MDM2 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 after 12 h treatment in the MDM2 high copy cell line SJSA-1;
[0114] Figure 7 Figure 10 is a confocal image of triplex forming oligonucleotide fragments targeting MDM2 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 after 12 h treatment in the MDM2 high copy cell line 94T778;
[0115] Figure 8 Figure 11 is a confocal image of triplex forming oligonucleotide fragments targeting MDM2 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 after 12 h treatment in the MDM2 high copy cell line 93T449;
[0116] Figure 9 Figure 12 is a graph of the inhibition of cells by triplex forming oligonucleotide fragments targeting MDM4 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 when treated for 48 h in the MDM4 high copy cell line HT1080;
[0117] Figure 10 Figure 13 is a graph of the inhibition of cells by triplex forming oligonucleotide fragments targeting MDM4 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 when treated for 48 h in the MDM4 high copy cell line SK-Hep1;
[0118] Figure 11 Figure 14 is a graph of the inhibition of cells by triplex forming oligonucleotide fragments targeting MDM4 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 when treated for 48 h in the MDM4 low copy cell line HepG2;
[0119] Figure 12Figure 1 is a graph showing the inhibitory effect of MDM4-targeted triplex-forming oligonucleotide fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 on cells treated for 48 h in MDM4 low-copy cell line CP-H103;
[0120] Figures 13-14 Figure 2 is a photograph of a treated mouse CDX model and a photograph of a tumor.
[0121] Figure 15 Figure 3 is a graph showing the tumor growth curve of MDM2-targeted triplex-forming oligonucleotides, doxorubicin, and a control group in nude mice;
[0122] Figure 16 Figure 4 is a graph showing the tumor growth curve of MDM2-targeted MDM2-Lip-TFOs, single TFOs, doxorubicin, and a control group in nude mice. DETAILED DESCRIPTION
[0123]
Example 1
[0124] The MDM2-targeted triplex-forming oligonucleotide sequence is designed as follows:
[0125] MDM2-1084: 22 bases in length, binds at position 68809256-68809277 on chromosome 12, pairs with double-stranded DNA according to Hoogsteen or anti-Hoogsteen pairing principles, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GAAGCTGGAATCTGTGAGGTGG (SEQ ID NO: 1).
[0126] MDM2-1087: 23 bases in length, binds at position 68809258-68809280 on chromosome 12, pairs with double-stranded DNA according to Hoogsteen or anti-Hoogsteen pairing principles, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTCCGAAGCTGGAATCTGTGAGG (SEQ ID NO: 2).
[0127] MDM2-1117: 22 bases in length, binds at position 68809289-68809310 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GAGACAAAAATACTAACCAGGG (SEQ ID NO: 3).
[0128] MDM2-5404: 23 bases in length, binds at position 68813575-68813597 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTGAAGTTATTAAAGTCTGTTGG (SEQ ID NO: 4).
[0129] MDM2-5436: 23 bases in length, binds at position 68813607-68813629 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AGACACTTATACTATGAAAGAGG (SEQ ID NO: 5).
[0130] MDM2-27649: 23 bases in length, binds at position 68835820-68835842 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTGTTTTAGGATCTTGATGCTGG (SEQ ID NO: 6).
[0131] MDM2-27667: 23 bases in length, binds at position 68835838-68835860 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GCTGGTGTAAGTGAACATTCAGG (SEQ ID NO: 7).
[0132] MDM2-31139: 23 bases in length, binds at chromosome 12 position 68839310-68839332, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTGCAATGTGATGGAAGGGGGGG (SEQ ID NO: 8).
[0133] MDM2-31140: 23 bases in length, binds at chromosome 12 position 68839311-68839333, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GTTGCAATGTGATGGAAGGGGGG (SEQ ID NO: 9).
[0134] MDM2-31143: 23 bases in length, binds at chromosome 12 position 68839314-68839336, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TCTGTTGCAATGTGATGGAAGGG (SEQ ID NO: 10).
[0135] MDM2-31148: 22 bases in length, binds at chromosome 12 position 68839320-68839341, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AACATCTGTTGCAATGTGATGG (SEQ ID NO: 11).
[0136] MDM2-31150: 23 bases in length, binds at chromosome 12 position 68839321-68839343, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is ATCACATTGCAACAGATGTTGGG (SEQ ID NO: 12).
[0137] MDM2-31167: 23 bases in length, binds at chromosome 12 position 68839338-68839360, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GTTGGGCCCTTCGTGAGAATTGG (SEQ ID NO: 13).
[0138] MDM2-31174: 22 bases in length, binds at chromosome 12 position 68839346-68839367, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AGGAAGCCAATTCTCACGAAGG (SEQ ID NO: 14).
[0139] MDM2-31193: 23 bases in length, binds at chromosome 12 position 68839364-68839386, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTATCTTTCCCTTTATCTTCAGG (SEQ ID NO: 15).
[0140] MDM2-31198: 23 bases in length, binds at chromosome 12 position 68839369-68839391, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AGATAAAGGGAAAGATAAAGGGG (SEQ ID NO: 16).
[0141] MDM2-31225: 23 bases in length, binds at position 68839393-68839415 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AATCTCTGAGAAAGCCAAACTGG (SEQ ID NO: 17).
[0142] MDM2-31236: 23 bases in length, binds at position 68839407-68839429 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTGTGTTGAGTTTTCCAGTTTGG (SEQ ID NO: 18).
[0143] MDM2-31247: 23 bases in length, binds at position 68839418-68839440 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AACTCAACACAAGCTGAAGAGGG (SEQ ID NO: 19).
[0144] MDM2-31280: 23 bases in length, binds at position 68839451-68839473 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is ACTATAGTTTTTTTACAATCAGG (SEQ ID NO: 20).
[0145] MDM2-31309: 23 bases in length, binds at position 68839480-68839502 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTCCAGAGAGTCATGTGTTGAGG (SEQ ID NO: 21).
[0146] MDM2-31391 : 23 bases in length, binds at chromosome 12 position 68839562-68839584, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is ATAATGCTACTAGAAGTTGATGG (SEQ ID NO: 22).
[0147] MDM2-31423: 22 bases in length, binds at chromosome 12 position 68839595-68839616, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AAACTCTTTCACATCTTCTTGG (SEQ ID NO: 23).
[0148] MDM2-31428: 23 bases in length, binds at chromosome 12 position 68839599-68839621, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AAGATGTGAAAGAGTTTGAAAGG (SEQ ID NO: 24).
[0149] MDM2-31429: 23 bases in length, binds at chromosome 12 position 68839600-68839622, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AGATGTGAAAGAGTTTGAAAGGG (SEQ ID NO: 25).
[0150] MDM2-31458: 22 bases in length, binds at chromosome 12 position 68839630-68839651, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is ACACTCTCTTCTTTGTCTTGGG (SEQ ID NO: 26).
[0151] MDM2-31459: 21 bases in length, binds at chromosome 12 position 68839632-68839652, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, while the DNA double strand maintains the normal pattern of Watson-Crick pairing. The specific sequence is AAGACAAAGAAGAGAGTGTGG (SEQ ID NO: 27).
[0152] MDM2-31496: 22 bases in length, binds at chromosome 12 position 68839665-68839686, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, while the DNA double strand maintains the normal pattern of Watson-Crick pairing. The specific sequence is AAGGTTCAATGGCATTAAGGGG (SEQ ID NO: 28).
[0153] MDM2-31503: 23 bases in length, binds at chromosome 12 position 68839674-68839696, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, while the DNA double strand maintains the normal pattern of Watson-Crick pairing. The specific sequence is ACAAATCACACAAGGTTCAATGG (SEQ ID NO: 29).
[0154] MDM2-31508: 23 bases in length, binds at chromosome 12 position 68839679-68839701, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, while the DNA double strand maintains the normal pattern of Watson-Crick pairing. The specific sequence is GAACCTTGTGTGATTTGTCAAGG (SEQ ID NO: 30).
[0155] MDM2-31523: 23 bases in length, binds at position 68839694-68839716 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TGTCAAGGTCGACCTAAAAATGG (SEQ ID NO: 31).
[0156] MDM2-31538: 23 bases in length, binds at position 68839709-68839731 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AAAAATGGTTGCATTGTCCATGG (SEQ ID NO: 32).
[0157] MDM2-31547: 23 bases in length, binds at position 68839718-68839740 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TGCATTGTCCATGGCAAAACAGG (SEQ ID NO: 33).
[0158] MDM2-31581: 22 bases in length, binds at position 68839753-68839774 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTCTTTGCACATGTAAAGCAGG (SEQ ID NO: 34).
[0159] MDM2-31593: 23 bases in length, binds at position 68839764-68839786 on chromosome 12, pairs with double stranded DNA according to Hoogsteen or anti-Hoogsteen base pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GTGCAAAGAAGCTAAAGAAAAGG (SEQ ID NO: 35).
[0160] MDM2-31622: 23 bases in length, binds at chromosome 12 position 68839793-68839815, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GGTTGTCTACATACTGGGCAGGG (SEQ ID NO: 36).
[0161] MDM2-31643: 23 bases in length, binds at chromosome 12 position 68839814-68839836, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double strand maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is GTTAGCACAATCATTTGAATTGG (SEQ ID NO: 37).
[0162]
Example 2
[0163] S1, under ventilation, 5.0-15.0 mg of dimethyl octadecyl epoxy propyl ammonium chloride and 5.0-15.0 mg of cholesterol are weighed into a container, then 200-300 μL of dioleoyl phosphatidylcholine solution and 50-150 μL of carboxymethyl chitosan hexadecyl quaternary ammonium salt solution are added to the container, and the components are mixed uniformly to obtain a mixed solution; the mixed solution is subjected to ultrasonic treatment for 15-45 s, then 4-8 mL of ultrapure water is added to the container, and the ultrasonic treatment is continued until the total time is 4-8 min; finally, vacuum rotary evaporation treatment is performed for 20-40 min to obtain a liposome nanoparticle;
[0164] S2, a triple-stranded forming oligonucleotide fragment targeting MDM2 is added to the liposome nanoparticle and acts for 2-4 min;
[0165] S3, the liposome nanoparticle loaded with the triple-stranded forming oligonucleotide fragment is weighed and stored in a cold storage to obtain the high-efficiency and safe drug for treating MDM2 high-expression tumor.
[0166] Preferably, in the above method, the liposome nanoparticle can also use a commercial product Thermo Scientific Dharmacon FECT.
[0167] Preferably, the power of the ultrasound in step S1 is 27%, the ultrasound treatment is 2s per cycle, the interval is 1s, and the treatment temperature is 25℃.
[0168] Preferably, the MDM2-targeted triplex-forming oligonucleotide fragment in step S2 is designed by the following method:
[0169] M1, design a triplex-forming oligonucleotide fragment, which is selected at the promoter site of the gene and inside the gene, including exons and introns;
[0170] M2, determine the target region and design parallel or antiparallel fragments;
[0171] M3, the specific sequence basically follows the Watson-Crick pairing principle, the middle part of the base is adjusted according to the Hoogsteen pairing principle, and the pairing free energy size is compared and calculated by using software such as snapgene, dnaman, and NovoPro; the hairpin and other secondary structures are removed by using Primer Premier 5 software to prevent false adhesion.
[0172] The MDM2-targeted triplex-forming oligonucleotide fragment is designed.
[0173] Preferably, the triplex-forming oligonucleotide fragment in step S2 is 16-35 bases.
[0174] Preferably, the temperature of the refrigerated storage in step S3 is 2-8℃.
[0175] Liposomes are carriers that can effectively deliver various drugs to target cells. The combination of drugs and liposomes can significantly improve the pharmacokinetics of drugs, reduce drug toxicity, and improve therapeutic effects. Therefore, liposome preparations have broad development prospects in the delivery of antitumor drugs. In the field of nanomedicine, active targeting is an important strategy to overcome low selectivity and systemic toxicity and improve therapeutic effects. Drug delivery devices with controllable and targeted functions can ideally deliver high doses of therapeutic agents specifically to diseased cells, reducing interference with healthy cells, thereby producing the expected pharmacokinetics and biodistribution, achieving higher therapeutic effects and fewer side effects. In the present application, the MDM2-targeted triplex-forming oligonucleotide immunoliposome is a promising strategy for targeted drug delivery for the treatment of MDM2 overexpression cancer. The ionizable cationic liposome nanoparticle prepared in the present application can optimize the encapsulation of effective payloads and the intracellular delivery of nucleic acids, and they can produce good immunostimulatory effects only with a small dose and a small injection.
[0176] [Example 3] Sequence design of triplex-forming oligonucleotide targeting MDM4 The MDM4 gene is located in the region of human chromosome 1, at position 204516406-204558120, with a length of 41715 base pairs.
[0177] The sequence design of triplex-forming oligonucleotide targeting MDM4 is as follows:
[0178] MDM4-9004: 22 bases in length, binding at position 204525409-204525430 of chromosome 1, pairing with double-stranded DNA according to Hoogsteen or anti-Hoogsteen pairing principles, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time. The specific sequence is TTTAGCATTCACACAAAGGCAA (SEQ ID NO: 38).
[0179] MDM4-9006: 21 bases in length, binding at position 204525412-204525432 of chromosome 1, pairing with double-stranded DNA according to Hoogsteen or anti-Hoogsteen pairing principles, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time. The specific sequence is TATTTAGCATTCACACAAAGG (SEQ ID NO: 39).
[0180] MDM4-9109: 23 bases in length, binding at position 204525514-204525536 of chromosome 1, pairing with double-stranded DNA according to Hoogsteen or anti-Hoogsteen pairing principles, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time. The specific sequence is GGTGGAAAATGATGTCATTTTGG (SEQ ID NO: 40).
[0181] MDM4-9127: 23 bases in length, binding at position 204525532-204525554 of chromosome 1, pairing with double-stranded DNA according to Hoogsteen or anti-Hoogsteen pairing principles, and the DNA double strand maintains the normal mode of Watson-Crick pairing at the same time. The specific sequence is TGTTGAACACTGAGCAGAGGTGG (SEQ ID NO: 41).
[0182] MDM4-9130: 23 bases in length, binds at chromosome 1 position 204525535-204525557, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AGATGTTGAACACTGAGCAGAGG (SEQ ID NO: 42).
[0183] MDM4-9145: 22 bases in length, binds at chromosome 1 position 204525551-204525572, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AACATCTGACAGTGCTTGCAGG (SEQ ID NO: 43).
[0184] MDM4-9156: 23 bases in length, binds at chromosome 1 position 204525561-204525583, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is AGTGCTTGCAGGATCTCTCCTGG (SEQ ID NO: 44).
[0185] MDM4-9170: 22 bases in length, binds at chromosome 1 position 204525576-204525597, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TCTCCTGGACAAATCAATCAGG (SEQ ID NO: 45).
[0186] MDM4-9174: 23 bases in length, binds at chromosome 1 position 204525579-204525601, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick pairing at the same time. The specific sequence is TTTACCTGATTGATTTGTCCAGG (SEQ ID NO: 46).
[0187] MDM4-9184: 23 bases in length, binds at chromosome 1 position 204525589-204525611, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen base pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick base pairing. The specific sequence is TCAATCAGGTAAATCATTTTCGG (SEQ ID NO: 47).
[0188] MDM4-9268: 22 bases in length, binds at chromosome 1 position 204525673-204525694, pairs with double stranded DNA according to Hoogsteen or reverse Hoogsteen base pairing rules, and the DNA double helix maintains the normal pattern of Watson-Crick base pairing. The specific sequence is GTAATCCCAGCACTTTGAGAAG (SEQ ID NO: 48).
[0189]
Example 4
[0190] S1, under ventilation, 5.0-15.0 mg of dimethyl octadecyl epoxy propyl ammonium chloride and 5.0-15.0 mg of cholesterol are weighed into a container, then 200-300 μL of dioleoyl phosphatidylcholine solution and 50-150 μL of carboxymethyl chitosan hexadecyl quaternary ammonium salt solution are added to the container, and the components are mixed uniformly to obtain a mixed solution; the mixed solution is subjected to ultrasonic treatment for 15-45 s, then 4-8 mL of ultrapure water is added to the container, and the ultrasonic treatment is continued until the total time is 4-8 min; finally, vacuum rotary evaporation treatment is performed for 20-40 min to obtain a liposome nanoparticle;
[0191] S2, a triple-stranded oligonucleotide fragment targeting MDM4 is added to the liposome nanoparticle and acts for 2-4 min;
[0192] S3, the liposome nanoparticle loaded with the triple-stranded oligonucleotide fragment is weighed and stored in a cold storage to obtain the highly safe and efficient drug for treating MDM4 high expression tumor.
[0193] Preferably, in the above method, the liposome nanoparticle can also use a commercial product Thermo Scientific Dharmacon FECT.
[0194] Preferably, the power of the ultrasound in step S1 is 27%, the ultrasound treatment is 2s per cycle, the interval is 1s, and the treatment temperature is 25℃.
[0195] Preferably, the MDM4-targeted triplex-forming oligonucleotide fragment in step S2 is designed by the following method:
[0196] M1, design a triplex-forming oligonucleotide fragment, which is selected at the promoter site of the gene and inside the gene, including exons and introns;
[0197] M2, determine the target region and design parallel or antiparallel fragments;
[0198] M3, the specific sequence basically follows the Watson-Crick pairing principle, the middle part of the base is adjusted according to the Hoogsteen pairing principle, and the pairing free energy size is compared and calculated by using software such as snapgene, dnaman, and NovoPro; the hairpin and other secondary structures are removed by using Primer Premier 5 software to prevent false adhesion.
[0199] The MDM4-targeted triplex-forming oligonucleotide fragment is designed.
[0200] Preferably, the triplex-forming oligonucleotide fragment in step S2 is 16-35 bases.
[0201] Preferably, the temperature of the refrigerated storage in step S3 is 2-8℃.
[0202]
Example 5
[0203] Experimental method:
[0204] Culture of cell lines
[0205] (1) The MDM2 high-copy cell lines 93T449, 94T778, and SJSA-1 are cultured in RPMI1640 medium containing 10% fetal bovine serum (FBS) (Nunclon 6-well plate, 5×105 cells / 2ml);
[0206] (2) MDM2 low copy cell line SW872 and normal immortalized myocardial cell line H9C2 were cultured in DMEM medium (Nunclon 6-well plate, 5 x 105cells / 2ml) containing 10% fetal bovine serum (FBS);
[0207] (3) The cell lines were cultured in a 5% CO2, saturated humidity, 37°C incubator.
[0208] Transfection of cell lines
[0209] (4) 0.3-2 x 105cells (93T449, 94T778, SJSA-1, SW872, H9C2) were seeded in 96-well plates 24h before transfection, and the cell confluence was 80-90% at the time of transfection;
[0210] (5) The designed different target MDM2 triple helix forming oligonucleotide fragments were diluted, and the transfection reagent liposome nanoparticles (Lip) was also diluted at the same time;
[0211] (6) Mix the transfection reagent liposome nanoparticles (Lip) and the triple helix forming oligonucleotide diluent, and stand at room temperature. Add the transfection complex to the 96-well cell plate, with 6 replicates for each group;
[0212] (7) Place the cell plate in a 37°C, 5% CO2 incubator for 12-48h.
[0213] Measurement of cell viability by CCK-8 method
[0214] (8) Add 10μl CCK-8 solution to each well of the above treated 96-well plate, and incubate the plate in the incubator for 2h. Then measure the absorbance at 450nm using a microplate reader.
[0215] (9) Calculate the cell proliferation activity according to the formula. The relevant data are shown in Table 1 and Figures 1-5 .
[0216]
[0217] Table 1 Cell proliferation activity statistics
[0218] Analysis of experimental results
[0219] (1) Figure 1Figure 2 is a graph of the inhibitory effect of the MDM2-targeting triplex-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 on cells when treated for 48 h in the MDM2 high-copy cell line 93T449; it can be seen that the MDM2-targeting triplex-forming oligonucleotides can significantly inhibit the growth of the MDM2 high-copy cell line 93T449 cells compared to the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, indicating that the MDM2-targeting triplex-forming oligonucleotides have a strong inhibitory effect on MDM2 high-copy tumor cells;
[0220] (2) Figure 2 Figure 3 is a graph of the inhibitory effect of the MDM2-targeting triplex-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 on cells when treated for 48 h in the MDM2 high-copy cell line 94T778; it can be seen that the MDM2-targeting triplex-forming oligonucleotides can significantly inhibit the growth of the MDM2 high-copy cell line 94T778 cells compared to the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, indicating that the MDM2-targeting triplex-forming oligonucleotides have a strong inhibitory effect on MDM2 high-copy tumor cells;
[0221] (3) Figure 3Figure 4 is a graph showing the inhibition of cells by targeting MDM2 triple- forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 in MDM2 high copy cell line SJSA-1 treated for 48 h; it can be seen that compared with the toxicity of transfection reagent liposome nanoparticles (Lip) itself, the targeting MDM2 triple-forming oligonucleotide can significantly inhibit the growth of MDM2 high copy cell line SJSA-1 cells, indicating that the targeting MDM2 triple-forming oligonucleotide has a strong inhibitory effect on MDM2 high copy tumor cells;
[0222] (4) Figure 4 Figure 5 is a graph showing the inhibition of cells by targeting MDM2 triple- forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 in MDM2 low copy cell line SW872 treated for 48 h; it can be seen that compared with the toxicity of transfection reagent liposome nanoparticles (Lip) itself, the targeting MDM2 triple-forming oligonucleotide has no obvious inhibitory effect on the growth of low copy cell line SW872 cells, indicating that the targeting MDM2 triple-forming oligonucleotide has no obvious inhibitory effect on MDM2 low copy tumor cells;
[0223] (5) Figure 5The three-strand oligonucleotide fragments targeting MDM2 are 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, and 31496. The inhibitory effect of oligonucleotides 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, and 31643 on normal cardiomyocyte cell line H9C2 after 48 h of treatment is shown in the figure. It can be seen that compared with the toxicity of the transfection reagent liposome nanoparticles (Lip), the three-strand oligonucleotides targeting MDM2 have no significant inhibitory effect on the growth of normal cardiomyocyte cell line H9C2, indicating that the three-strand oligonucleotides targeting MDM2 have no significant inhibitory effect on normal cells.
[0224] (6) Figures 1-3 These figures illustrate the growth inhibition of tumor cell lines (93T449, 94T778, and SJSA-1) with highly amplified MDM2, treated with triple-stranded oligonucleotides targeting MDM2. The results show that the triple-stranded oligonucleotide fragments targeting MDM2 have a strong inhibitory effect on tumor cells with highly amplified MDM2, demonstrating a highly effective anti-tumor effect.
[0225] (7) Figure 4 This is a graph showing the growth inhibition effect of MDM2-low copy number SW872 cells treated with MDM2-targeting triple-strand-forming oligonucleotides. It can be seen that the MDM2-targeting triple-strand-forming oligonucleotides have no significant inhibitory effect on the growth of tumor cells with low MDM2 copy numbers. Figures 1-3 and Figure 4 It can be found that triple-stranded oligonucleotide fragments targeting MDM2 have a strong targeting effect on killing tumor cells amplified by MDM2.
[0226] (8) Figure 5 This is a graph showing the growth-inhibiting effect of MDM2-targeting triple-strand-forming oligonucleotides on the normal cardiomyocyte cell line H9C2. It can be seen that the MDM2-targeting triple-strand-forming oligonucleotides have no significant growth-inhibiting effect on the normal cardiomyocyte cell line H9C2. Figures 1-3 and Figure 4 and Figure 5 This indicates that the triple-stranded oligonucleotides targeting MDM2 only have a killing effect on tumor cells with highly amplified MDM2, and have no significant killing effect on cells with low MDM2 copies, and have almost no killing effect on normal cells, indicating that the triple-stranded oligonucleotides targeting MDM2 have good safety.
[0227] The cells were collected after being transfected by the above-mentioned transfection method, and the expression levels of cleaved-caspase 3 and cleaved-PARP were detected by Western Blot (WB) to evaluate the early apoptosis of the cells;
[0228] The cells were fixed after being transfected by the above-mentioned transfection method for 12 hours, and the cell photos were taken by confocal microscope Figures 6-8 It can be seen that the triplex-forming oligonucleotide with fluorescent signal enters the MDM2 highly amplified tumor cell line.
[0229] Figure 6 It is shown that the triplex-forming oligonucleotide with fluorescent signal enters the MDM2 gene amplified cell line SJSA-1;
[0230] Figure 7 It is shown that the triplex-forming oligonucleotide with fluorescent signal enters the MDM2 gene amplified cell line 94T778; Figure 8 It is shown that the triplex-forming oligonucleotide with fluorescent signal enters the MDM2 gene amplified cell line 93T449;
Example 6
[0231] Experimental method:
[0232] Culture of cell lines
[0233] (1) MDM4 high copy cell line HT1080, SK-Hep1 was cultured in MEM medium containing 10% fetal bovine serum (Fetal Bovine Serum, FBS) (Nunclon 6-well plate, 5x105 cells / 2ml)
[0234] (3) MDM4 low copy cell line CP-H103 was cultured in DMEM-F12 medium containing 10% fetal bovine serum (Fetal Bovine Serum, FBS) (Nunclon 6-well plate, 5x105 cells / 2ml)
[0235] (4) The cell lines are placed in a 5% CO2, saturated humidity, 37°C incubator for culture
[0236] Transfection of cell lines
[0237] (5) 0.3-2x10^5 cells (HT1080, SK-Hep1, HepG2, CP-H103) are inoculated in 96-well plates 24h before transfection, and the cell confluence is 80-90% at the time of transfection;
[0238] (6) The designed different target MDM4 triplex-forming oligonucleotide fragments are diluted, and the transfection reagent liposome nanoparticles (Lip) are also diluted at the same time;
[0239] (7) The transfection reagent liposome nanoparticles (Lip) and the triplex-forming oligonucleotide diluent are mixed, and the mixture is left to stand at room temperature. The transfection complex is added to the 96-well cell plate, with 6 replicates for each group;
[0240] (8) The cell plate is placed in a 37°C, 5% CO2 incubator for culture for 12-48h.
[0241] CCK-8 method for measuring cell viability
[0242] (9) 10μl of CCK-8 solution is added to each well of the above-mentioned 96-well plate, and the plate is incubated in the incubator for 2h. The absorbance at 450nm is measured using a microplate reader.
[0243] (10) The cell proliferation activity is calculated according to the formula. The relevant data are shown in Table 2 below and Figures 9-12 .
[0244]
[0245] Table 2 Cell proliferation activity statistics
[0246] Analysis of experimental results
[0247] (1) Figure 9 is the inhibition of cells by fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 targeting MDM4 in MDM4 high-copy cell line HT1080 after 48h of treatment. It can be seen that compared with the toxicity of transfection reagent liposome nanoparticles (Lip) itself, the triplex-forming oligonucleotide targeting MDM4 can significantly inhibit the growth of MDM4 high-copy cell line HT1080, indicating that the triplex-forming oligonucleotide targeting MDM4 has a strong inhibitory effect on MDM4 high-copy tumor cells;
[0248] (2) Figure 10Figure 1 is a graph showing the inhibitory effect of MDM4-targeting fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, and 9184 on cells treated for 48 h in an MDM4 high-copy cell line SK-Hep1; it can be seen that, compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the MDM4-targeting triplex-forming oligonucleotides can significantly inhibit the growth of MDM4 high-copy cell line SK-Hep1 cells, indicating that the MDM4-targeting triplex-forming oligonucleotides have a strong inhibitory effect on MDM4 high-copy tumor cells;
[0249] (3) Figure 11 Figure 2 is a graph showing the inhibitory effect of MDM4-targeting fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, and 9184 on cells treated for 48 h in an MDM4 low-copy cell line HepG2; it can be seen that, compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the MDM4-targeting triplex-forming oligonucleotides have no obvious inhibitory effect on the growth of low-copy cell line HepG2 cells, indicating that the MDM4-targeting triplex-forming oligonucleotides have no obvious inhibitory effect on MDM4 low-copy tumor cells; Figure 12 Figure 3 is a graph showing the inhibitory effect of MDM4-targeting fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, and 9184 on cells treated for 48 h in an MDM4 low-copy cell line CP-H103; it can be seen that, compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the MDM4-targeting triplex-forming oligonucleotides have no obvious inhibitory effect on the growth of low-copy cell line CP-H103 cells, indicating that the MDM4-targeting triplex-forming oligonucleotides have no obvious inhibitory effect on MDM4 low-copy tumor cells;
[0250] (5) Figures 9-10 Figure 4 is a graph showing the growth inhibitory effect of MDM4-targeting triplex-forming oligonucleotides on MDM4 highly amplified tumor cell lines (HT1080, SK-Hep1); it can be seen that the MDM4-targeting triplex-forming oligonucleotide fragments have a strong inhibitory effect on MDM4 highly amplified tumor cells, and the anti-tumor effect has strong effectiveness.
[0251] (6) Figures 11-12 Figure 5 is a graph showing the growth inhibitory effect of MDM4-targeting triplex-forming oligonucleotides on MDM4 low-copy cell lines HepG2 and CP-H103; it can be seen that the MDM4-targeting triplex-forming oligonucleotides have no obvious inhibitory effect on the growth of MDM2 low-copy tumor cells, and Figures 9-10 and Figures 11-12It can be found that the triple helix forming oligonucleotide fragment targeting MDM4 has strong targeting effect on the killing of MDM4 amplified tumor cells.
[0252] After the cells are transfected by the above-mentioned transfection method, the early apoptosis of the cells is evaluated by detecting the expression levels of cleaved-caspase3 and cleaved-PARP through Western Blot (WB).
[0253] After the cells are transfected by the above-mentioned transfection method, the early apoptosis of the cells is evaluated by detecting the expression levels of cleaved-caspase3 and cleaved-PARP through Western Blot (WB).
[0254]
Example 7
[0255] Therapeutic drugs: triple helix forming oligonucleotide targeting MDM2 injection and doxorubicin injection, and physiological saline is used for dilution to the corresponding concentration during the experiment.
[0256] Methods and results:
[0257] 1. Animals: nude mice, 6-8 weeks old, all female.
[0258] 2. Generation of tumor model
[0259] 1) Human osteosarcoma SJSA-1 (cells) is purchased from American type culture collection (ATCC), and the cells are identified according to the instructions provided by ATCC, and the cells are cultured in 10% fetal bovine serum RPMI1640 medium at 37°C, 5% carbon dioxide.
[0260] 2) Tumor generation, 5×10^6 SJSA-1 cells are injected subcutaneously into the back of nude mice, and when the tumor grows to about 100mm 3, the mice are randomly divided into groups, and the treatment is started, and the first day is the day when the treatment is started.
[0261] 3) Treatment process
[0262] The triple helix forming oligonucleotide targeting MDM2 is used at a dose of 20 mg / kg, the doxorubicin (DOX) injection is used at a dose of 2 mg / kg, and the control group uses physiological saline, and the drugs are given a total of 3 times within 7 days.
[0263] 4) The experimental results data are shown in Table 3 and Figure 1 Figure 15
[0264]
[0265] Table 3 Pharmacodynamic study of injection of MDM2-targeted triplex-forming oligonucleotide in nude mice
[0266] 5) Results and discussion: From Table 3 and Figure 1, it can be seen that the tumor inhibition effect of the MDM2-targeted triplex-forming oligonucleotide treatment group is equivalent to that of the doxorubicin group, and the tumor growth rate is significantly inhibited. Figure 15
[0267]
Example 8
[0268]
Example 9
[0269] Methods and results:
[0270] 1. Animals: Nude mice, 6-8 weeks old, all female.
[0271] 2. Generation of tumor model
[0272] 1) Human osteosarcoma SJSA-1 cells were purchased from the American Type Culture Collection (ATCC) and identified according to the ATCC's instructions. The cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum at 37°C and 5% carbon dioxide. Cells were passaged every 2 days, and used within 15 passages.
[0273] 2) Tumor formation: 5×10^6 SJSA-1 cells were subcutaneously injected into the back of nude mice. When the tumors grew to at least 100 mm3, the mice were randomly divided into groups and treatment was started. The day of treatment was designated as day 1.
[0274] 3) Treatment process
[0275] MDM2-Lip-TFOs targeting MDM2 were administered at a dose of 2.5 mg / kg, TFOs targeting MDM2 were administered at a dose of 20 mg / kg, doxorubicin (DOX) injection was administered at a dose of 2 mg / kg, and the control group received normal saline. The drugs were administered three times over 7 days.
[0276] 4) The experimental results are shown in Table 3 above and attached. Figure 16 As shown
[0277] 5) Results and Discussion: By Figure 16 It was found that MDM2-Lip-TFOs targeting MDM2 significantly inhibited tumor growth, with better effects than the single TFOs treatment group targeting MDM2 and the doxorubicin group. The single TFOs treatment group targeting MDM2 and the doxorubicin group had comparable tumor-inhibiting effects. Compared with Example 7, the amount of triple-stranded oligonucleotides used in this example was significantly reduced, and the utilization rate of triple-stranded oligonucleotides was greatly improved. Figures 13-14 Images of the treated mouse CDX model and tumors are shown. Mice 1 received MDM2-Lip-TFOs treatment, mice 2 received single TFO injection treatment, and mice 3 served as the control group. It can be seen that both the MDM2-Lip-TFOs injection targeting MDM2 and the single TFOs injection targeting MDM2 have significant inhibitory effects on tumor growth, with the MDM2-Lip-TFOs injection showing a stronger tumor-inhibiting effect.
[0278]
Example 10
[0279] The highly effective and safe drugs for treating MDM2 high-copy tumors obtained in Examples 7 and 8 were injected into patients with advanced tumors that had MDM2 high copy numbers and were resistant to conventional chemotherapy and targeted therapy. The efficacy and safety were observed.
[0280] Clinical recruitment of 20-30 cases of MDM2 high copy of advanced tumor patients who are resistant to chemotherapy and targeted therapy; inject high-efficiency and safe drugs for treating MDM2 high copy tumors into the above patients, and observe the tumor regression of the patients and the related toxic and side reactions such as hematology and heart.
[0281] The above describes preferred embodiments of the present application in detail. It should be understood that those of ordinary skill in the art can make many modifications and changes without creative labor based on the concept of the present application. Therefore, any technical solutions obtained by logical analysis, reasoning or limited experiments based on the prior art according to the concept of the present application shall be within the protection scope defined by the claims.
Claims
1. Use of a pharmaceutical composition comprising a triplex forming oligonucleotide that inhibits amplification of an MDM2 gene and a pharmaceutically acceptable carrier in the manufacture of a medicament for the treatment of a neoplasm, characterized in that, The nucleotide sequence of the triple helix forming oligonucleotide inhibiting amplification of the MDM2 gene is AGACACTTATACTATGAAAGAGG, and the tumor is liposarcoma and osteosarcoma.
Citation Information
Patent Citations
A method for detecting the binding between mdm2 and the proteasome
CN101790583A
Test kit of mouse double minute 2 (MDM2) antagonist and preparation method thereof
CN103954601A