L-beta-galactoglucan II and application thereof

By preparing L-β-galactoglucan II, the problem of differences in bioactivity caused by the complexity of polysaccharide structure was solved, and significant improvements in intestinal health, animal growth and immune function, as well as anti-aging effects were achieved, providing a variety of application potentials.

CN120842452AActive Publication Date: 2025-10-28CHENGDU SYDIX BIOTECH CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511236126.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-04-22
Filing Date
2025-09-01
Publication Date
2025-10-28
Estimated Expiration
2045-09-01

AI Technical Summary

Technical Problem

The structural complexity of polysaccharides leads to significant differences in their physicochemical properties and biological activities, making it difficult for existing technologies to effectively utilize the biological activity and function of polysaccharides produced by Agrobacterium FN01.

Method used

An L-β-galactoglucan II was prepared, and its structure was determined through specific glycosidic bonds and substituents. It was then applied to fermentation broth and crude polysaccharide products to prepare products that can repair the intestinal barrier, regulate intestinal water and salt balance, and regulate intestinal flora.

Benefits of technology

L-β-galactoglucan II significantly relieves constipation, has mucosal repair effects, improves animal growth and gut microbiota balance, enhances immune function, has anti-aging and anti-inflammatory effects, and offers a variety of biomedical and food science applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120842452A_ABST
    Figure CN120842452A_ABST
Patent Text Reader

Abstract

The invention provides an L-beta-galactoglucan II and a preparation method of the L-beta-galactoglucan II. The invention also provides a preparation method of the L-beta-galactoglucan II and the related extract of the L-beta-galactoglucan II. The L-beta-galactoglucan II has good biological activity and can be used for improving states of human beings and animals.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references This application claims priority to Chinese Patent Application No. 2024119073703, filed on December 23, 2024, and Chinese Patent Application No. 2025105042935, filed on April 22, 2025. The full text of the aforementioned Chinese patent applications is incorporated herein by reference. Technical Field

[0003] This invention relates to the field of polysaccharide technology in microbiology, and more particularly to L-β-galactoglucan II produced by Agrobacterium FN01, its preparation method and application. Background Technology

[0004] Agrobacterium is a Gram-negative, aerobic, non-spore-forming rod-shaped bacterium belonging to the Rhizobium family. However, it does not fix nitrogen. Some are perianthous bacteriums, while others are monotrichous bacteriums. They are distributed in the soil, and the vast majority of them can cause plant cancer.

[0005] Polysaccharides are high-molecular-weight carbohydrates composed of at least 10 monosaccharides linked by glycosidic bonds. They are widely found in animal cell membranes and the cell walls of plants and microorganisms. They not only exert a variety of biological activities in various organisms, but also play multiple roles in the interaction between various organisms, making them highly efficient biological response regulators.

[0006] Polysaccharides generally possess a variety of activities, such as multi-immune regulation, anti-tumor activity, hypoglycemia, and lipid-lowering effects. They have attracted great attention from the medical community both at home and abroad and have become a hot topic in research and application in recent years.

[0007] However, the structures of polysaccharide compounds are extremely complex, which leads to the complexity of their physicochemical properties and physiological activities, mainly reflected in the following aspects: (1) Monosaccharide composition and arrangement: Polysaccharides are composed of multiple monosaccharide units, which can be identical (called homopolysaccharides) or different (called heteropolysaccharides). The types of monosaccharides (such as glucose, fructose, galactose, etc.) and their arrangement order will affect the structure and properties of polysaccharides.

[0008] (2) Type of glycosidic bond: Monosaccharide units in polysaccharides are linked together by glycosidic bonds. The type of glycosidic bond (such as α-1,4, β-1,4, etc.) and the linkage mode (such as linear, branched, etc.) have an important influence on the structure and properties of polysaccharides.

[0009] (3) Substituents and modifications: Polysaccharide molecules may have various substituents (such as sulfate, acetyl, etc.) and modifications (such as phosphorylation, sulfation, etc.), which further increase the complexity of polysaccharide structure.

[0010] (4) The stereostructure of polysaccharides can be classified into linear, branched, and helical structures. When the stereostructure of polysaccharides is different, their physicochemical properties and biological activities will also be different. This is because different stereostructures will affect the spatial conformation of polysaccharides and the intermolecular interactions, thereby affecting their solubility, stability, and biological activity.

[0011] Since the properties of polysaccharides depend largely on their structure, even a difference of just one monosaccharide unit can lead to significant changes in the physicochemical properties of the polysaccharide. These changes may manifest in solubility, viscosity, gelation properties, and stability, and may also affect the biological activity and function of the polysaccharide.

[0012] For example, both starch and cellulose are polysaccharides composed of glucose units, but their structures and properties differ greatly. Starch has a helical structure, mainly composed of glucose units linked by α-1,4 glycosidic bonds, and is soluble, while cellulose has a linear structure, composed of glucose units linked by β-1,4 glycosidic bonds, and is insoluble and fibrous. This structural difference leads to their completely different functions and roles in organisms.

[0013] Furthermore, the stereostructure of polysaccharides also affects their interactions with other molecules. For example, some polysaccharides with specific stereostructures can bind to specific proteins or cell surface receptors, thereby exerting specific biological activities. This interaction has important applications in fields such as biomedicine and drug development.

[0014] Therefore, the structural complexity of polysaccharides is reflected not only in the diversity of their composition and arrangement, but also in the diversity of their substituents and modifications. This complexity endows polysaccharides with a wide variety of physicochemical properties and biological activities, providing broad application prospects for fields such as biomedicine and food science.

[0015] The preparation of polysaccharides using Agrobacterium and the determination of their structure and biological activity are of great significance for the treatment of related diseases. Summary of the Invention

[0016] Further research on Agrobacterium FN01 revealed another polysaccharide: L-β-galactoglucan II.

[0017] Specifically, the present invention provides an L-β-galactoglucan II, which is mainly composed of glucose and galactose. It is a galactoglucan whose main chain is composed of β-(1→3)-Glcp, β-(1→4)-Glcp, β-(1→3)-Galp and β-(1→4,6)-Glcp residues, and whose side chain is composed of β-(1→6)-Glcp and terminal glucose (T-Glcp) linked together.

[0018] The average molecular weight should not be less than 100,000 Da. Due to the difficulty in determining the molecular weight of polysaccharides, a molecular weight error of ±0.5 × 10⁻⁶ can be considered. 5 Da, further consideration could be given to ±0.1×10 5 Da.

[0019] In some specific embodiments of the present invention, the weight-average molecular weight is approximately (6.5 ± 0.1) × 10⁻⁶. 5 Da.

[0020] In some specific embodiments of the present invention, the weight-average molecular weight is approximately 4 × 10⁻⁶. 5 Da~4.5×10 5 Furthermore, in certain embodiments of the present invention, the weight-average molecular weight is approximately (4.4 ± 0.1) × 10⁻⁶. 5 Da.

[0021] In some specific embodiments of the present invention, the weight-average molecular weight is approximately 1 × 10⁻⁶. 5 Da.

[0022] In the infrared spectrum, at least at 3324 cm⁻¹ -1 2890cm -1 1630cm -1 1370cm -1 1020 cm -1 893cm -1 There is a characteristic peak at this location.

[0023] In the L-β-galactoglucan II of this invention, the molar ratio of glucose to galactose in the combined GC-MS analysis was approximately (10-11):1.

[0024] Furthermore, its structure also contains trace amounts of rhamnose and glucuronic acid.

[0025] Based on structural characterization data, the main repeating units of the polysaccharide obtained in this invention are inferred to be as follows: .

[0026] The number of repeating units depends on the molecular weight of the polysaccharide.

[0027] This invention also provides a fermentation broth containing L-β-galactoglucan II, the preparation method of which includes the following: Agrobacterium FN01 was inoculated into the fermentation broth and fermented to obtain a fermentation broth containing L-β-galactoglucan II; The fermentation broth comprises: a carbon source selected from one or more combinations of sorbitol, mannitol, and glycerol; a nitrogen source selected from one or more combinations of ammonia, yeast powder, and nitrate; inorganic salts; an antifoaming agent; and water; with a pH of 6.6–7.2.

[0028] This invention also provides a crude polysaccharide containing L-β-galactoglucan II, the preparation method of which includes the following: (1) Inoculate Agrobacterium FN01 into the fermentation culture medium and carry out fermentation to obtain fermentation broth; (2) The fermentation broth was spray-dried to obtain crude polysaccharide containing L-β-galactoglucan II.

[0029] In one specific embodiment of the present invention, a method for preparing L-β-galactoglucan II is provided, comprising the following: (1) Inoculate Agrobacterium FN01 into a fermentation culture medium and ferment to obtain a fermentation broth; the fermentation culture medium includes: carbon source, nitrogen source, inorganic salt, defoamer, and water; pH is 6.6-7.2; (2) Add hydrochloric acid or sodium hydroxide to the fermentation broth, heat, filter, and spray dry to obtain L-β-galactoglucan II; or, treat the fermentation broth with the sevage method, take the aqueous phase and spray dry to obtain L-β-galactoglucan II.

[0030] The inorganic salts used in fermentation are selected from phosphates, dihydrogen phosphates, dihydrogen phosphates, and sulfates.

[0031] In one specific embodiment of the present invention, the culture medium may include the following components: 2-6% carbon source, 0.1-1.0% nitrogen source, 0.1-0.3% potassium dihydrogen phosphate, 0.001-0.5% sulfate, 0.005-0.01% boric acid, and 0.05-0.2% defoamer.

[0032] In one specific embodiment of the present invention, the sulfate is selected from one or more of magnesium sulfate, zinc sulfate, copper sulfate, and manganese sulfate, or a mixture thereof.

[0033] In one specific embodiment of the present invention, the culture medium may include the following components: 2-6% carbon source, 0.1-1.0% nitrogen source, 0.1-0.3% potassium dihydrogen phosphate, 0.01-0.10% magnesium sulfate, 0.001-0.003% zinc sulfate, 0.001-0.003% copper sulfate, 0.0001-0.006% manganese sulfate, 0.005-0.01% boric acid, and 0.05-0.2% defoamer.

[0034] In one specific embodiment of the present invention, the carbon source is selected from one or more combinations of sorbitol, mannitol, and glycerol, and the nitrogen source is selected from one or more combinations of ammonia, yeast powder, and nitrate.

[0035] In one specific embodiment of the present invention, the culture time is 48-65 hours.

[0036] In one specific embodiment of the present invention, the culture temperature is 30-32℃.

[0037] In one specific embodiment of the present invention, during cultivation, the aeration rate is 0.2-0.3 vvm, the stirring speed is 50-120 rpm, and the dissolved oxygen saturation is >20%.

[0038] When hydrochloric acid is added for acid hydrolysis, the pH can be adjusted according to the actual requirements of the target molecular weight.

[0039] In one specific embodiment of the present invention, the pH of acid hydrolysis can be considered to be above 1±0.2, for example, the pH is selected from 1-6.5, or the pH is selected from (1±0.2)-(5.0±0.2).

[0040] This invention also provides the application of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II in the preparation of products that repair the intestinal barrier and / or regulate intestinal water and salt balance and / or regulate intestinal flora.

[0041] The present invention also provides that the product is a product for treating and / or preventing constipation.

[0042] In this invention, the form of the product includes, but is not limited to, drugs, health products, food, cosmetics, skin care products, veterinary drugs, feed, feed additives, etc.

[0043] The product of this invention includes at least one of L-β-galactoglucan, fermentation broth of Agrobacterium containing L-β-galactoglucan, and crude L-β-galactoglucan polysaccharide.

[0044] In one aspect, the present invention provides the use of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II in the preparation of one of the following products: (1) Treatment and / or prevention of rhinitis; (2) Treatment and / or prevention of ulcers; (3) Relieves mucosal damage and / or repairs damaged mucosa; (4) Promotes the growth of farmed animals; (5) Improve the composition of breast milk in livestock; (6) Improves the balance of intestinal microbiota in animals and promotes digestive function in animals; (7) Enhance non-specific immune function; (8) Anti-aging; (9) Anti-inflammatory.

[0045] In some embodiments of the present invention, the product for treating and / or preventing rhinitis is a product that includes the effects of improving nasal inflammation, and / or reducing inflammatory cell infiltration, and / or repairing damaged nasal mucosa.

[0046] In some embodiments of the present invention, the product for treating and / or preventing ulcers refers to a product that includes treatment and / or prevention of oral ulcers.

[0047] In some embodiments of the present invention, the product for treating and / or preventing oral ulcers is a product that includes relieving oral mucosal damage, and / or repairing damaged oral mucosa, and / or improving oral inflammation.

[0048] In some embodiments of the present invention, in products that alleviate mucosal damage or / and repair damaged mucosa, the mucosa includes oral mucosa, nasal mucosa, gastric mucosa, and intestinal mucosa.

[0049] In some embodiments of the present invention, promoting the growth of farmed animals refers to promoting the growth of farmed animals of different ages.

[0050] Furthermore, the term "raised animals" refers to young animals. This invention has found that L-β-galactoglucan II has a good growth-promoting effect on young animals, such as piglets.

[0051] Furthermore, the animals being raised are selected from livestock and pets; the livestock include pigs, cattle, and sheep; the pets include dogs and cats.

[0052] In some embodiments of the present invention, improving the composition of animal breast milk refers to increasing the milk fat content in sow milk and / or reducing urea nitrogen in breast milk.

[0053] In some embodiments of the present invention, a product is provided to improve the balance of intestinal microbiota in animals and promote their digestive function, wherein the animal refers to a human or a domesticated animal.

[0054] In some embodiments of the present invention, the enhancement of nonspecific immune function refers to increasing the number of immune cells and / or regulating the function of immune cells.

[0055] In some embodiments of the present invention, the enhancement of non-specific immune function refers to increasing the number of macrophages.

[0056] In some embodiments of the present invention, the anti-aging refers to inhibiting β-galactosidase activity, increasing SOD activity, and / or increasing telomerase activity.

[0057] In some embodiments of the present invention, the anti-inflammatory term refers to the treatment and / or prevention of inflammation caused by lipopolysaccharide.

[0058] In some embodiments of the present invention, the anti-inflammatory effect refers to reducing the abnormal expression of inflammatory factors.

[0059] The reduction of abnormal expression of inflammatory factors may involve reducing the abnormal expression of pro-inflammatory interleukins.

[0060] The beneficial effects of the present invention are as follows: (1) This invention provides a novel structure of L-β-galactoglucan II; (2) The polysaccharide in this invention has a significant effect on relieving constipation. Its mechanism may be related to repairing the intestinal barrier, regulating the intestinal water and salt balance and regulating the intestinal flora.

[0061] (3) The L-β-galactoglucan II and the fermentation broth containing L-β-galactoglucan II or the crude polysaccharide containing L-β-galactoglucan II in this invention have certain mucosal repair and mucosal damage relief effects, and show good therapeutic potential and safety for rhinitis and oral ulcers, providing new possibilities for the prevention and / or treatment of rhinitis and oral ulcers.

[0062] (4) The L-β-galactoglucan II and the fermentation broth containing L-β-galactoglucan II or the crude polysaccharide containing L-β-galactoglucan II in this invention improve the composition of breast milk of fed animals, effectively promote the growth of fed animals, improve the balance of intestinal microorganisms of animals, and promote the digestive function of animals, bringing new ideas for improving the feeding effect of animals.

[0063] (5) The L-β-galactoglucan II and fermentation broth containing L-β-galactoglucan II or crude polysaccharide containing L-β-galactoglucan II in this invention can improve the balance of intestinal microorganisms and promote the digestive function of animals. They can also be used as dietary supplements or drugs for human use.

[0064] (6) The L-β-galactoglucan II and the fermentation broth containing L-β-galactoglucan II or the crude polysaccharide containing L-β-galactoglucan II in this invention can resist aging and enhance immunity. They can be used as dietary supplements or drugs for specific groups, such as the middle-aged and elderly or other people with low immunity.

[0065] (7) The L-β-galactoglucan II and fermentation broth containing L-β-galactoglucan II or crude polysaccharide containing L-β-galactoglucan II in this invention can reduce the expression of the inflammatory factor IL-6 and can be used in people with abnormally high IL-6 levels.

[0066] (8) The present invention found that L-β-galactoglucan II of different molecular weights all have good biological activity. For example, the weight average molecular weights are about 100,000 Da, 440,000 Da, and 650,000 Da, all of which have shown good effects in reducing the level of the inflammatory factor IL-6. Attached Figure Description

[0067] Figure 1 Analysis of monosaccharide composition and glycosidic bond linkages of L-β-galactoglucan II. A shows the ICS chromatograms of monosaccharide standards and L-β-galactoglucan II PMP-derived hydrolysates; B shows the HPLC chromatograms of monosaccharide standards and L-β-galactoglucan II PMP-derived hydrolysates; C shows the GC-MS total ion chromatogram (TIC) of L-β-galactoglucan II-derived partially methylated sugar alcohol acetates (PMAAs).

[0068] Figure 2 NMR spectra of L-β-galactoglucan II: A is ¹H spectrum, B is ¹³C spectrum, C is COSY spectrum, DG is HSQC spectrum, H is HSQC-TOCSY spectrum;

[0069] Figure 3 NMR spectrum and structural diagram of L-β-galactoglucan II: A and B are HMBC spectra, and C is a structural diagram of L-β-galactoglucan II; Figure 4 The homogeneity and molecular weight characterization of L-β-galactoglucan II. A shows the weight-average molecular weight of L-β-galactoglucan II sample in 0.9% NaCl solution as a function of retention time (Mw, black), and the chromatograms recorded by a multi-angle laser light scattering detector (LS, red) and a differential refractive index detector (RI, blue); B shows the SEC-LLS chromatogram of L-β-galactoglucan II in 0.9% NaNO3 solution at 25°C, detected by laser light scattering and differential refractive index detection; CD shows the specific viscosity / concentration versus concentration plots and the logarithmic relative viscosity / concentration versus concentration plots of L-β-galactoglucan II in 0.9% NaCl aqueous solution and DMSO at 25°C.

[0070] Figure 5 Morphological and thermal characterization of L-β-galactoglucan II. A represents a concentration of 2.0 × 10⁻⁻⁻⁶. 8A) is the AFM image of L-β-galactoglucan II at a concentration of 1.0 × 10⁻³ g / mL; B) is the TEM image of L-β-galactoglucan II at a concentration of 1.0 × 10⁻³ g / mL; C) is the SEM image of L-β-galactoglucan II solution (1.0 × 10⁻³ g / mL) obtained by freeze-drying immediately after freezing in liquid nitrogen; D) is the XRD pattern of L-β-galactoglucan II; E) is the TG-DTG curve of L-β-galactoglucan II.

[0071] Figure 6 Mouse body weight change curve, average body weight change, and average food intake; Figure 7 Absolute organ weight and organ index in mice; Figure 8 Parameters related to mouse defecation; Figure 9 Representative results of hematoxylin-eosin staining of mouse ileal tissue sections; Figure 10 Representative results of hematoxylin-eosin staining of mouse colon tissue sections; Figure 11 Expression of tight junction protein gene in mouse colon; Figure 12 Representative results of AB-PAS staining of mouse colon tissue sections; Figure 13 Expression of mouse colonic aquaporin and ckit genes; Figure 14 α-diversity of mouse cecal microbiota; Figure 15 Mouse body weight change curve, average body weight change, and average food intake; Figure 16 Absolute organ weight and organ index in mice; Figure 17 Mouse defecation-related parameters Figure 18 Effects of L-β-galactoglucan II on mouse body weight; Figure 19 Effect of L-β-galactoglucan II on mouse survival rate; Figure 20 Effects of L-β-galactoglucan on the histopathology of mouse nasal mucosa (HE, low magnification, 4×). Figure 21 Effects of L-β-galactoglucan II on rat body weight; Figure 22 Comparison of the appearance of oral ulcer models in different groups of rats; Figure 23Effects of L-β-galactoglucan on histopathological changes in rat oral tissue (HE, top: low magnification, 4×; bottom: high magnification, 20×). Figure 24 Pathological changes in major organs and tissues of rats by L-β-galactoglucan (HE). Figure 25 Growth curves of experimental pigs during the nursery-finishing period. Detailed Implementation

[0072] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments and effect tests. It should be understood that the specific embodiments and effect tests described herein are merely illustrative of the invention and are not intended to limit the invention. Furthermore, unless otherwise specified, all reagents used in the following embodiments are commercially available or can be synthesized according to methods described herein or known to the public. Reaction conditions not listed are also readily available to those skilled in the art.

[0073] The Agrobacterium sp. FN01 described in this invention was deposited at the China Center for Type Culture Collection (CCTCC) on March 2, 2023, with accession number M2023226, located at Wuhan University, Wuhan, China.

[0074] Fuc is fucose, Rha is rhamnose, Ara is arabinose, Gal is galactose, Glc is glucose, Xyl is xylose, Man is mannose, Fru is fructose, Rib is ribose, Gal-UA is galacturonic acid, Gul-UA is guluronic acid, Glc-UA is glucuronic acid, and Man-UA is mannuronic acid.

[0075] Sugar and protein content were determined as follows: Sugar content was determined using the sulfuric acid-phenol method, with glucose solutions (10, 20, 40, 60, 80, and 100 μg / mL) as standards; Protein content was determined using the enhanced BCA protein assay kit, following the instructions.

[0076] In some embodiments of the present invention, a method for treating and / or preventing rhinitis, and for treating and / or preventing ulcers, is also provided, which involves administering to a patient an effective amount of L-β-galactoglucan II, a fermentation broth containing L-β-galactoglucan II, or a crude polysaccharide containing L-β-galactoglucan II.

[0077] In some embodiments of the present invention, a method for relieving mucosal damage and / or repairing damaged mucosa is also provided, which involves administering to a patient an effective amount of L-β-galactoglucan II, a fermentation broth containing L-β-galactoglucan II, or a crude polysaccharide containing L-β-galactoglucan II.

[0078] In some embodiments of the present invention, a method for promoting the growth of farmed animals is also provided, which involves applying an effective amount of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II to the farmed animals.

[0079] In some embodiments of the present invention, a method for promoting the improvement of breast milk composition in livestock is also provided, which involves administering an effective amount of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II to lactating livestock.

[0080] In some embodiments of the present invention, a method for improving the balance of intestinal microbiota and promoting digestive function in animals is also provided, which involves administering an effective amount of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II to the animal.

[0081] In some embodiments of the present invention, a method for enhancing non-specific immune function is also provided, which involves administering to an animal an effective amount of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II.

[0082] In some embodiments of the present invention, an anti-aging method is also provided, which involves administering to animals an effective amount of L-β-galactoglucan II, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II.

[0083] In some embodiments of the present invention, when used to feed animals, the amount of L-β-galactoglucan II is 200-600 grams per ton of ordinary feed.

[0084] In some embodiments of the present invention, when used in humans, the oral dosage of L-β-galactoglucan II includes, but is not limited to, 0.1 mg / kg·day to 100 mg / kg·day, for example, 0.1, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, and 100 mg / kg·day.

[0085] In some embodiments of the present invention, when used in humans, the oral dose of L-β-galactoglucan II is 1 mg / kg·day to 50 mg / kg·day.

[0086] In some embodiments of the present invention, when used in humans, the oral dose of L-β-galactoglucan II is 1 mg / kg·day to 10 mg / kg·day.

[0087] In some embodiments of the present invention, when used on humans, the concentration of L-β-galactoglucan II for topical application includes, but is not limited to, 0.1~10 mg / mL, for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, and 10 mg / mL.

[0088] In some embodiments of the present invention, when used on humans, the concentration of L-β-galactoglucan II for topical application includes, but is not limited to, 0.1~5 mg / mL.

[0089] In some embodiments of the present invention, when used on humans, the concentration of L-β-galactoglucan II for topical application includes, but is not limited to, 0.5~5 mg / mL.

[0090] In the product of this invention, appropriate auxiliary materials can be added as needed.

[0091] The excipients described in this invention are a general term for all additional materials other than the main component. Excipients should possess the following properties: (1) non-toxic to the body and virtually no side effects; (2) chemically stable and not easily affected by temperature, pH, storage time, etc.; (3) no incompatibility with the main drug and no impact on the efficacy and quality inspection of the main drug; (4) no interaction with packaging materials. The excipients in this invention include, but are not limited to, fillers (diluents), lubricants (flow aids or anti-adhesion agents), dispersants, wetting agents, adhesives, regulators, solubilizers, antioxidants, antibacterial agents, emulsifiers, disintegrants, etc. Binders include syrups, gum arabic, gelatin, sorbitol, astragalus gum, cellulose and its derivatives (such as microcrystalline cellulose, sodium carboxymethyl cellulose, ethyl cellulose, or hydroxypropyl methyl cellulose), gelatin paste, syrup, starch paste, or polyvinylpyrrolidone, etc.; fillers include lactose, powdered sugar, dextrin, starch and its derivatives, cellulose and its derivatives, inorganic calcium salts (such as calcium sulfate, calcium phosphate, dicalcium phosphate, precipitated calcium carbonate, etc.), sorbitol, or glycine, etc.; lubricants include micronized silica gel, magnesium stearate, talc, aluminum hydroxide, boric acid, hydrogenated vegetable oil, polyethylene glycol, etc.; disintegrants include starch and its derivatives (such as sodium carboxymethyl starch, sodium starch glycolate, etc.). The ingredients include: pregelatinized starch, modified starch, hydroxypropyl starch, corn starch, etc.; polyvinylpyrrolidone or microcrystalline cellulose, etc.; humectants include sodium dodecyl sulfate, water or alcohol, etc.; antioxidants include sodium sulfite, sodium bisulfite, sodium metabisulfite, dibutylbenzoic acid, etc.; antibacterial agents include 0.5% phenol, 0.3% cresol, 0.5% chlorobutanol, etc.; regulators include hydrochloric acid, citric acid, potassium hydroxide (sodium), sodium citrate and buffers (including sodium dihydrogen phosphate and disodium hydrogen phosphate), etc.; emulsifiers include polysorbate-80, sorbitan oleate, poloxamer F-68, lecithin, soybean lecithin, etc.; solubilizers include Tween-80, bile, glycerin, etc.

[0092] The administration of L-β-galactoglucan II, the fermentation broth of Agrobacterium containing L-β-galactoglucan II, and the crude polysaccharide containing L-β-galactoglucan II is not particularly limited. Representative administration methods include (but are not limited to): oral, parenteral (intravenous, intramuscular, or subcutaneous), and local administration.

[0093] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active polysaccharide (i.e., L-β-galactoglucan II) is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following components: (a) fillers or compatibilizers, such as starch, lactose, sucrose, glucose, mannitol, and silica; (b) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) humectants, such as glycerin; (d) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginate, certain complex silicates, and sodium carbonate; (e) slowing agents, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, such as kaolin; and (i) Lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets, and pills, the dosage form may also contain a buffer.

[0094] Solid dosage forms such as tablets, sugar pills, capsules, pellets, and granules can be prepared using coatings and shells, such as casings and other materials known in the art. They may contain opacifying agents, and the release of the active polysaccharide in such a composition can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active polysaccharide may also be formed into microcapsules with one or more of the excipients described above.

[0095] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to active polysaccharides, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures thereof.

[0096] In addition to these inert diluents, the composition may also contain auxiliaries such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.

[0097] In addition to active polysaccharides, the suspension may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0098] The dosage forms of the polysaccharides of this invention for topical administration include ointments, powders, patches, sprays, and inhalers. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be necessary.

[0099] The conventional processes and procedures for soil bacteria fermentation mainly include: Preparing the culture medium: First, a culture medium suitable for the growth of Agrobacterium needs to be prepared. This usually includes basic nutrients (such as carbon sources, nitrogen sources, inorganic salts, etc.) and growth factors.

[0100] Strain activation and expansion culture: A small number of cells were selected from the preserved Agrobacterium strain and inoculated onto a plate containing an appropriate culture medium for activation culture. After colonies grew, single colonies were selected and inoculated into seed culture medium for shake-flask culture to expand the cell volume.

[0101] Fermentation Culture: The expanded cultured *Agrobacterium* is inoculated into a fermentation medium for fermentation. Fermentation conditions (such as temperature, pH, stirring speed, and aeration rate) should be optimized according to the characteristics of the strain and product requirements. During fermentation, various indicators of the fermentation broth (such as cell density and metabolite concentration) should be monitored regularly to track the fermentation progress.

[0102] In the purification process of polysaccharides, the addition of alkali can remove impurities such as proteins. Commonly used alkalis are mainly inorganic alkalis, such as sodium hydroxide (NaOH) and potassium hydroxide.

[0103] Filter aids are commonly used to improve filtration efficiency, helping to remove suspended particles and impurities from solutions, thereby accelerating the purification process of polysaccharides. Commonly used filter aids include diatomaceous earth, perlite, and cellulose, which have large specific surface areas and good adsorption properties, effectively removing impurities from solutions.

[0104] In one specific embodiment of the present invention, the alkali in step (3) includes, but is not limited to, sodium hydroxide, potassium hydroxide, and calcium hydroxide; the filter aid is selected from diatomaceous earth and perlite powder.

[0105] The term "rhinitis" refers to an inflammatory disease of the nasal mucosa caused by various etiologies. Its characteristic symptoms include nasal itching, sneezing, clear nasal discharge, and nasal congestion. Among the many types of rhinitis, allergic rhinitis, also known as hay fever, is the most common and best-studied form. Allergic rhinitis is essentially an IgE-mediated type I hypersensitivity reaction (immediate hypersensitivity reaction), involving complex interactions among various immune cells (mast cells, eosinophils, Th2 cells), cytokines (IL-4, IL-6, IL-13, etc.), and adhesion molecules. Clinically, allergic rhinitis can be divided into two main categories: seasonal allergic rhinitis, mainly caused by seasonal inhaled allergens such as pollen and fungi, and perennial allergic rhinitis, mainly caused by perennial indoor allergens such as dust mites, cockroaches, and animal dander.

[0106] In treating rhinitis, in addition to using L-β-galactoglucan II, fermentation broth of Agrobacterium tumefaciens containing L-β-galactoglucan II, or crude polysaccharides containing L-β-galactoglucan II, conventional rhinitis medications can also be used in combination. For example, first-line drugs include nasal corticosteroids such as mometasone furoate, fluticasone propionate, and budesonide; second-generation antihistamines such as cetirizine, loratadine, and fexofenadine; nasal antihistamines such as azelastine and olopatadine; leukotriene receptor antagonists such as montelukast; second-line drugs include nasal decongestants such as oxymetazoline and xylometazoline; and anticholinergic drugs such as ipratropium bromide.

[0107] The term "ulcer" refers to a localized, deep tissue defect or necrosis that occurs on the surface of the skin or mucous membranes (moist tissues that cover the surface of hollow organs and ducts inside the body, such as the walls of the mouth, stomach, and intestines).

[0108] The term "oral ulcer" specifically refers to ulcerative lesions occurring on the oral mucosa (including the inner lips, inner cheeks, tongue, gums, soft palate, and floor of the mouth). It possesses the core characteristics of an ulcer (tissue loss, involvement of deep tissues), but is confined to the oral cavity. The most common manifestation is painful, recurrent aphthous ulcers. A recurrent aphthous ulcer is a superficial, isolated, round or oval ulcer on the oral mucosa that recurs periodically and causes significant burning pain. Its characteristics include recurrence, self-limitation (healing spontaneously without treatment), and significant pain.

[0109] For localized ulcers, in addition to using L-β-galactoglucan II, fermentation broth of Agrobacterium containing L-β-galactoglucan II, or crude polysaccharides containing L-β-galactoglucan II, other conventional drugs can also be used in combination, such as: anti-inflammatory and analgesic drugs: lidocaine gel, benzocaine lozenges; mouthwash (chlorhexidine, cetylpyridinium chloride); recombinant human epidermal growth factor gel, zinc preparations (zinc gluconate); traditional Chinese medicine sprays (watermelon frost, ice borax powder); vitamin supplements: vitamin B2, B12, C and zinc preparations; immunomodulators: glucocorticoids (prednisone), etc.

[0110] The term "mucosal injury" refers to the structural damage and functional impairment of the mucosal tissues covering the inner surfaces of various cavities in the human body (such as the digestive tract, respiratory tract, urinary and reproductive tracts). It encompasses a range of pathological changes from mild inflammation to severe ulceration.

[0111] The term "non-specific immunity," also known as innate immunity, can be divided into the following in the body: tissue barrier immunity (skin and mucous membrane system, blood-brain barrier, placental barrier, etc.); innate cellular immunity (phagocytes, killer cells, dendritic cells, etc.); and innate molecular immunity (complement, cytokines, enzymes, etc.).

[0112] In one specific embodiment of the present invention, the enhancement of non-specific immunity mainly includes, but is not limited to, increasing the number of (innate) immune cells and / or regulating the function of (innate) immune cells. Immune cells refer to cells that participate in or are related to the immune response; immune cells include lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, mast cells, etc. Phagocytes refer to a group of cells in the body with phagocytic function, mainly including the mononuclear phagocytic cell system and neutrophils. The mononuclear phagocytic cell system includes free monocytes in the blood and macrophages that develop after entering various tissues. Macrophages have a strong phagocytic capacity and are also a major type of antigen-presenting cell, playing a key role in the induction and regulation of specific immune responses. Neutrophils are a type of small phagocytic cell that has non-specific immune defense functions and participates in the body's immune response, inflammatory damage, etc.

[0113] Inflammation, or inflammatory response, is a defensive reaction of the body's immune system to harmful stimuli (such as pathogen infection, damaged cells, foreign substances, etc.). Its fundamental purpose is to eliminate harmful stimuli, prevent their spread, and initiate tissue repair processes. Inflammatory factors are key chemical messengers that mediate and regulate inflammatory responses. They are mainly produced and released by immune cells (such as macrophages and lymphocytes) and non-immune cells (such as endothelial cells) upon stimulation.

[0114] Interleukins (ILs) are a very important class of inflammatory factors. Pro-inflammatory interleukins, such as IL-1β, IL-6, IL-8, IL-12, IL-17, and IL-18, mainly promote inflammatory responses.

[0115] IL-6 (interleukin-6) is a key multifunctional inflammatory factor in the human body, playing an important role in responding to infection, injury and maintaining homeostasis: (1) Core regulator of immune defense: Acute phase response: When pathogens (such as bacteria and viruses) invade or tissues are damaged, immune cells rapidly produce IL-6. IL-6 reaches the liver through the blood and stimulates the liver to synthesize a series of "acute phase proteins", such as C-reactive protein (CRP) and fibrinogen. These proteins help to enhance immunity, isolate pathogens and initiate tissue repair. Promote antibody production: IL-6 is a key signal for the differentiation of B lymphocytes into plasma cells. Plasma cells are the factories for producing antibodies, so IL-6 is essential for acquired immunity (i.e., specific immunity). Activate T cells: Promote the activation of cytotoxic T cells and inflammatory T cells, thereby directly attacking infected cells or coordinating immune responses. (2) Metabolic regulation: Participates in regulating blood glucose, lipid metabolism and energy balance. For example, during exercise, muscle cells release IL-6, which helps promote fat breakdown and glucose utilization. (3) Hematopoietic function: Stimulates hematopoietic stem cells to differentiate into various blood cells, which is crucial for maintaining the renewal and quantity of various cells in the blood system. (4) Tissue repair and regeneration: At the site of injury, IL-6 can promote cell proliferation and angiogenesis, thereby helping wound healing and tissue regeneration.

[0116] When IL-6 production becomes uncontrolled and remains at high levels, it can lead to cytokine release syndrome or chronic inflammation, promoting the development of cancer, metabolic diseases, and other conditions. Given the central role of IL-6 in various diseases, products that reduce IL-6 expression are particularly important.

[0117] Lipopolysaccharide (LPS) is a major component of the outer membrane of Gram-negative bacterial cell walls, released when bacteria rupture or die. LPS is one of the most powerful and classic initiating factors in inflammatory responses, especially those caused by bacterial infections.

[0118] The term "aging" refers to the progressive decline in an organism's physiological and psychological adaptability to its environment, gradually leading to death. Aging can be divided into physiological aging and pathological aging. The former refers to the physiological degeneration process that occurs after maturity, while the latter refers to the age-related changes caused by various external factors (including various diseases). Aging is the inevitable result of the combined effects of many pathological, physiological, and psychological processes; it is a biological and psychological process in the final stage of individual growth and development.

[0119] Anti-aging refers to various methods used to slow down the functional decline of various bodily systems in order to maintain health and extend lifespan. Anti-aging aims to prevent or slow down age-related physiological changes, such as the accumulation of cell damage and disordered gene expression. These changes can lead to problems such as decreased organ function and reduced metabolic rate.

[0120] In senescent cells, β-galactosidase not only accumulates in large quantities and lysosomes swell, but its optimal pH also shifts to 6.0, and its activity increases significantly. It is also one of the most widely used biomarkers of cell senescence.

[0121] Telomeres are specialized structures at the ends of chromosomes that gradually shorten with cell division. Telomerase is an enzyme that can repair and lengthen telomeres. In youth, telomerase activity is high, maintaining telomere stability and thus preserving cellular health and vitality. However, with age, telomerase activity gradually decreases, leading to continuous shortening of telomere length and ultimately causing cellular senescence and a decline in bodily functions. Therefore, increasing telomerase activity can lengthen telomeres, reverse cellular senescence, restore the body's circulatory system, maintain vascular elasticity and cell activity, and thus slow down the cellular aging process.

[0122] The term "milk fat" refers to the primary source of energy in breast milk, accounting for approximately 50%-60% of its total energy. It is composed of triglycerides, fatty acids, phospholipids, and also serves as a carrier for some fat-soluble vitamins (such as vitamins A, D, E, and K). Increasing milk fat content can significantly increase weaning weight: higher milk fat means pups can ingest more energy, resulting in a noticeable increase in daily weight gain and thus a greater weaning weight; enhance vitality and survival rate: pups that receive sufficient energy and essential fatty acids are stronger, more vigorous, and have greater resistance to cold and disease, effectively reducing the rate of weak pups and mortality; and promote organ development: particularly, the development of the brain and nervous system is more complete.

[0123] Urea nitrogen (BNi) is the end product of protein metabolism; it is not a nutrient in milk but rather an indicator. BNi levels primarily reflect the degree to which the protein supply in the sow's diet matches her requirements. Appropriately reducing BNi levels means that the sow's dietary protein / amino acid levels are precisely matched to her needs, reducing her metabolic burden and improving her health.

[0124] Gut microbiota refers to the bacterial community that resides in the intestines of humans and animals and coexists with them for a long period. The importance of gut microbiota balance in organisms is mainly reflected in the following aspects: (1) Aid digestion: Intestinal flora can break down and digest certain components in food, such as cellulose, protein, and carbohydrates, and promote the absorption and utilization of nutrients.

[0125] (2) Maintaining intestinal health: Intestinal flora can inhibit the growth of harmful bacteria, maintain the microecological balance of the intestine, and help prevent intestinal infections and diseases. At the same time, as antigens, intestinal flora can stimulate and promote the development and maturation of the immune system, and enhance the body's immunity.

[0126] (3) Promote nutrient absorption: Intestinal flora can secrete a variety of enzymes, which help promote the absorption and utilization of nutrients, such as vitamins and amino acids.

[0127] The benefits of regulating gut microbiota balance for humans and animals are mainly reflected in improving gut health, enhancing immunity, promoting nutrient absorption, and preventing disease. For example, adjusting diet and supplementing with probiotics can regulate gut microbiota balance, thereby improving diarrhea, enhancing the body's resistance, promoting the absorption and utilization of nutrients, and preventing intestinal diseases and tumors. In animals, regulating gut microbiota also helps improve growth performance and enhance disease resistance.

[0128] Feeding livestock (such as pigs, cattle, and sheep) to promote growth often manifests as increased body weight: (1) Economic value: The weight gain of livestock is usually directly related to their economic value. For example, the weight gain of pigs, cattle and sheep can improve their meat quality and yield, thereby increasing farmers' economic income.

[0129] (2) Purpose of raising livestock: The main purpose of raising livestock is to provide meat, dairy products or other agricultural products. Therefore, gaining weight is key to meeting these needs.

[0130] (3) Growth characteristics: Livestock require a large amount of nutritional support during their growth process to meet their growth and development needs. Providing sufficient feed and nutrition can promote the weight gain of livestock and improve production efficiency.

[0131] As used herein, the term “subject” (or “experimenter”, “patient”) refers to an animal, preferably a mammal, and particularly a human or a non-human animal including livestock and domestic animals, including but not limited to cattle, horses, sheep, pigs, goats, rabbits, cats, dogs and other mammals in need of treatment.

[0132] As used in this article, “administration” means providing L-β-galactoglucan II, or other products containing L-β-galactoglucan II, to a subject in need of treatment.

[0133] The term "effective dose" refers to the amount necessary at the intended dose for the desired duration of duration to achieve the desired therapeutic and / or preventive effect. The desired effect may be the relief, reduction, decrease, or cessation of at least one symptom associated with the treated condition. These doses will vary depending on various factors, including but not limited to disease state, age, sex, and individual weight. Effective doses can be determined through in vitro assays, in vivo non-human animal studies, and / or further supported by clinical trials.

[0134] The aforementioned "effective amount" is calculated based on the actual amount of L-β-galactoglucan II used. In actual use, the impact of product purification level on the purity of L-β-galactoglucan II needs to be considered. For example, assuming the purity of L-β-galactoglucan II is 100%, the amount of product used is equal to the actual amount of polysaccharide used. As the purity of L-β-galactoglucan II decreases, the amount of product used will increase in order to meet a comparable actual amount of polysaccharide used. Based on the above description, while ensuring effectiveness, the purity of L-β-galactoglucan II can range from 1% to 100%, for example, approximately 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, etc. Of course, to improve compliance and reduce dosage and frequency, the purity can be adjusted by increasing it, depending on the actual needs of the product.

[0135] This invention has demonstrated that L-β-galactoglucan II with a molecular weight of at least approximately 100,000 Da and above possesses good bioactivity; for example, 100,000 Da, 440,000 Da, and 650,000 Da have been shown to exhibit good anti-inflammatory activity. Therefore, in practical applications, L-β-galactoglucan II with different molecular weights can be prepared to meet specific needs; for example, it can be 1×10⁻⁶. 5 Da, 1.5×10 5 Da, 2×10 5 Da, 2.5×10 5 Da, 3×10 5 Da, 3.5×10 5 Da, 4×10 5 Da, 4.5×10 5 Da, 5×10 5 Da, 5.5×10 5 Da, 6×10 5 Da, 6.5×10 5Da, etc.

[0136] Reducing the molecular weight of polysaccharides in fermentation broths is a common need in the food, pharmaceutical, and biomaterials industries, aimed at improving their solubility, viscosity, bioavailability, or specific biological activities. Therefore, L-β-galactogranosans that satisfy the polysaccharide structure described in this invention should be included within the scope of protection of this invention.

[0137] Methods for reducing the molecular weight of polysaccharides are mainly divided into three categories: physical degradation, chemical degradation, and biodegradation. Acid hydrolysis is the most classic and commonly used method. In acid hydrolysis, under dilute acid (such as dilute sulfuric acid or dilute hydrochloric acid) and heating conditions, H⁺ ions attack the oxygen atoms on the glycosidic bonds, causing them to break. Other common methods include alkaline degradation, oxidative degradation, and specific enzymatic hydrolysis. When choosing different degradation methods, factors such as the target molecular weight and distribution, the structural characteristics of the polysaccharide, cost and scale, product bioactivity requirements, and process convenience should be considered.

[0138] In some embodiments of this invention, acid hydrolysis is used in the purification steps. If a higher molecular weight is required, the acid hydrolysis conditions can be adjusted, such as shortening the hydrolysis time or increasing the pH value. These conditions can be routinely adjusted according to the target molecular weight. Alternatively, the acid hydrolysis step can be omitted, and the fermentation broth can be treated directly using the sevage method; or the broth can be treated under higher pH conditions.

[0139] In some specific embodiments of the present invention, the pH of acid hydrolysis can be considered to be 1±0.2, 1.5±0.2, 2±0.2, 2.5±0.2, 3±0.2, 35±0.2, 4±0.2, 4.5±0.2, 5±0.2, 5.5±0.2, 6±0.2, 6.5±0.2, etc.

[0140] pH adjustment is generally done using common acids and bases, such as hydrochloric acid and sodium hydroxide.

[0141] Example 1: Preparation of L-β-galactoglucan II (1) Preparation of Agrobacterium FN01 seed culture The seed culture medium was formulated using LB medium, with the pH adjusted to 6.5-7.5 using an acid-base solution. After sterilization at 121℃ for 30 min, and cooling, it was inoculated with Agrobacterium tumefaciens FN01 and cultured on a shaker (30℃, 200 RPM) for 16 h to obtain Agrobacterium tumefaciens FN01 seed culture.

[0142] (2) Preparation of fermentation broth Carbon source: 4.0% sorbitol; nitrogen source: 0.2% ammonia (dropwise), 0.1% potassium dihydrogen phosphate, 0.06% magnesium sulfate heptahydrate, 0.001% manganese sulfate monohydrate, 0.001% zinc sulfate, 0.001% copper sulfate pentahydrate, 0.002% boric acid, and 0.1% bleaching agent dissolved in drinking tap water. The pH was adjusted to 6.8-7.2 with sodium hydroxide solution. The mixture was sterilized at 121℃ for 30 min and cooled to obtain the fermentation broth.

[0143] (3) Preparation of fermentation broth The *Agrobacterium* FN01 seed culture was inoculated into the fermentation broth at a volume of 5%. The fermentation conditions were as follows: 1) Temperature controlled at 30-32℃; 2) pH controlled between 6.6 and 7.2 using dilute hydrochloric acid or sodium hydroxide solution; 3) Aeration rate: 0.2-0.3 vvm; 4) Stirring speed: 50-120 rpm. The aeration rate and stirring speed were adjusted to ensure that the dissolved oxygen in the fermentation broth was greater than 20%. Fermentation was completed after 48-65 h of culture, yielding a fermentation broth containing L-β-galactoglucan II.

[0144] (4) Preparation of crude L-β-galactoglucan II The fermentation broth containing L-β-galactoglucan II was spray-dried to obtain crude L-β-galactoglucan II.

[0145] (5) Preparation of pure L-β-galactoglucan II The pH of the fermentation broth was adjusted to 4±0.2 with hydrochloric acid, heated to 95±2℃, filtered, and the filtrate was spray-dried to obtain pure L-β-galactoglucan II.

[0146] Example 2 Preparation of L-β-galactoglucan II (1) Preparation of Agrobacterium FN01 seed culture The seed culture medium was formulated using LB medium, with the pH adjusted to 6.5-7.5 using an acid-base solution. After sterilization at 121℃ for 30 min, and cooling, it was inoculated with Agrobacterium tumefaciens FN01 and cultured on a shaker (30℃, 200 RPM) for 16 h to obtain Agrobacterium tumefaciens FN01 seed culture.

[0147] (2) Preparation of fermentation broth Carbon source: mannitol 4.0%; nitrogen source: yeast powder 0.2%, potassium dihydrogen phosphate 0.1%, magnesium sulfate heptahydrate 0.06%, manganese sulfate monohydrate 0.001%, zinc sulfate 0.001%, copper sulfate pentahydrate 0.001%, boric acid 0.002%, and 0.1% of a foaming agent dissolved in drinking tap water. The pH was adjusted to 6.8-7.2 with sodium hydroxide solution. The mixture was sterilized at 121℃ for 30 min and cooled to obtain the fermentation broth.

[0148] (3) Preparation of fermentation broth The *Agrobacterium* FN01 seed culture was inoculated into the fermentation broth at a volume of 5%. The fermentation conditions were as follows: 1) Temperature controlled at 30–32℃; 2) pH controlled at 6.6–7.2 using dilute hydrochloric acid or sodium hydroxide solution; 3) Aeration rate: 0.2–0.3 vvm; 4) Stirring speed: 50–120 rpm. The aeration rate and stirring speed were adjusted to ensure that the dissolved oxygen in the fermentation broth was greater than 20%. Fermentation was completed after 48–65 h of culture, yielding a fermentation broth containing L-β-galactoglucan II.

[0149] (4) Preparation of crude L-β-galactoglucan II The fermentation broth containing L-β-galactoglucan II was spray-dried to obtain crude L-β-galactoglucan II.

[0150] (5) Preparation of pure L-β-galactoglucan II The pH of the fermentation broth was adjusted to 4±0.2 with hydrochloric acid, heated to 95±2℃, filtered, and the filtrate was spray-dried to obtain pure L-β-galactoglucan II.

[0151] Example 3 Preparation of L-β-galactoglucan II (1) Strains and culture media The pH of LB solid and liquid media was adjusted to 6.5-7.5 and sterilized at 121°C for 30 minutes. The fermentation medium composition (w / v) was as follows: 4.0% sorbitol, 0.2% yeast extract, 0.1% KH₂PO₄, 0.06% MgSO₄·7H₂O, 0.001% MnSO₄·H₂O, 0.001% ZnSO₄, 0.001% CuSO₄·5H₂O, 0.002% H₃BO₃, and 0.1% antifoaming agent. The pH was adjusted to 6.8-7.2 with NaOH solution, followed by sterilization at 121°C for 20 minutes.

[0152] (2) Separation and purification The cryopreserved FN01 strain was streaked onto LB agar plates and revived at 30°C for 72 hours. Single colonies were then transferred to LB liquid medium and cultured at 30°C and 200 rpm on a shaking incubator for 16 hours to prepare a seed culture. Fermentation medium was inoculated with 5% (v / v) of the seed culture and cultured for 48-65 hours under the following conditions: temperature 30-32°C, pH 6.6-7.2, aeration rate 0.2-0.3 vvm, stirring speed 50-120 rpm, and dissolved oxygen saturation >20%.

[0153] The fermentation broth was spray-dried to obtain the crude product.

[0154] The purification process was as follows: The fermentation broth was acidified to pH 4.0±0.2 with HCl and heat-treated at 95±2℃ for 30 minutes. Diatomaceous earth was added as a filter aid, and the mixture was filtered through a plate and frame filter until the filtrate became clear. The clarified liquid was then subjected to ultrafiltration for concentration, desalting, and decolorization. The treated filtrate was spray-dried to obtain the purified product. The total sugar content was determined to be 88.2% by the phenol-sulfuric acid method.

[0155] In addition, the purified L-β-galactoglucan II of this invention has extremely low protein content as determined by the BCA method, and no nucleic acid was detected by ultraviolet spectrophotometry.

[0156] Further property and structural analysis, as well as activity testing, were performed on the product from Example 3.

[0157] Example 4: Physicochemical Properties and Structural Analysis of Polysaccharides 1. Organic elemental analysis Table 1. Organic elemental analysis of L-β-galactoglucan II

[0158] The organic elemental analysis results of L-β-galactoglucan II are shown in Table 1: First test: C, H, O, and N contents were 39.54%, 6.133%, 49.896%, and 0.11%, respectively, with no sulfur (S), and the total percentage was 95.678%; Second test: C, H, O, and N contents were 39.70%, 6.241%, 50.047%, and 0.06%, respectively, with no sulfur (S), and the total percentage was 96.048%. The results indicate that L-β-galactoglucan II is mainly composed of C, H, and O elements, with an average content of approximately 39% C, 6.2% H, 50% O, and 0.1% N. No sulfur (S) content was detected.

[0159] 2. Measurement of optical rotation The optical rotation of the sample solution was measured at room temperature, accurate to 0.1°, with three measurements taken as the average value, showing a significant levorotatory property. Levorotatory polysaccharides typically possess excellent biocompatibility and low immunogenicity, making them suitable for biomedical applications. Furthermore, their levorotatory optical rotation may enhance cell recognition and targeted delivery capabilities, improving drug and gene delivery efficiency. The levorotatory property of L-β-galactoglucan II also holds promise for potential applications in antioxidant and antibacterial fields, expanding its value in biotechnology fields such as drug development and tissue repair.

[0160] 3. Fourier Transform Infrared Spectroscopy (FTIR) Measurement Infrared spectra of water-soluble L-β-galactoglucan II at 3324, 2890, 1630, 1370, and 1020 cm⁻¹ 1The left and right sides show characteristic absorption peaks of polysaccharides. The 893 cm⁻¹ peak... -1 The obvious absorption at this point is a characteristic peak of the -D-glucan glycoside bond, indicating that L-β-galactoglucan II is a -D-glucan.

[0161] Table 2. Infrared functional group analysis of L-β-galactoglucan II

[0162] 4. X-ray diffraction (XRD) measurement X-ray diffraction (XRD) analysis of L-β-galactoglucan II lyophilized powder was performed at room temperature (25 °C). XRD patterns were recorded in the 2θ range of 5–90 °C at a scan rate of 2 ° / min. Thermal analysis of L-β-galactoglucan II was performed using thermogravimetric analysis. Approximately 5 mg of the dried polysaccharide was placed in an open alumina crucible and heated from 30 °C to 800 °C at a heating rate of 10 °C / min under nitrogen protection (20 mL / min).

[0163] X-ray diffraction analysis revealed a broad and weak diffraction peak at 19.9°, with no sharp peaks, indicating that L-β-galactoglucan II is mainly amorphous with low crystallinity.

[0164] Given that industrial processing of dietary fiber typically involves high temperatures, the thermal stability of L-β-galactoglucan II was evaluated using thermal analysis. Thermogravimetric (TG) and derivative thermogravimetric (DTG) measurements were performed. The TG-DTG curves revealed two main weight loss phases. The first phase occurred below 100°C, attributed to water evaporation. The second, more significant phase occurred between 100°C and 350°C, likely corresponding to the decomposition of oxygen-containing functional groups in the polysaccharide. The DTG curve showed a maximum decomposition rate of 8.06% / min at 297.2°C. Above approximately 321°C, the weight loss curves flattened and approached a stable baseline, indicating that the major thermal decomposition was essentially complete.

[0165] Overall, these results indicate that L-β-galactoglucan II exhibits a rigid chain morphology, low crystallinity, and good thermal stability, which supports its potential as a functional component in food systems, particularly in applications requiring thickening, heat resistance, or structural support.

[0166] 5. Monosaccharide composition determination (ICS) and methylation determination (GC-MS) Monosaccharide composition is one of the most crucial pieces of information in polysaccharide structure analysis. Typically, polysaccharides are degraded into monosaccharides through acid hydrolysis for further analysis; trifluoroacetic acid (TFA) is a commonly used acid hydrolysis reagent. Since monosaccharide molecules lack chromophores, they require derivatization before analysis, followed by separation and quantification using ion chromatography (ICS) or high-performance liquid chromatography (HPLC). The specific methods are as follows: L-β-galactoglucan II was prepared into a 100 µg / mL solution, dried under a nitrogen stream, and then hydrolyzed at 121 °C for 2 hours with 1 mL of 2 M TFA solution, followed by drying under a nitrogen stream. The solution was washed with methanol and dried under a nitrogen stream, repeated 2-3 times. The treated L-β-galactoglucan II was dissolved in ultrapure water for ion chromatography (ICS) analysis and dissolved in 1 mL of 0.3 M NaOH solution for high-performance liquid chromatography (HPLC) analysis.

[0167] The ICS conditions for monosaccharide composition analysis were as follows: Dionex™ CarboPac™ PA20 column (150×3.0 mm, 10 μm), mobile phase A (H2O), mobile phase B (0.1 M NaOH), mobile phase C (a mixture of 0.1 M NaOH and 0.2 M NaAc), flow rate 0.5 mL / min, column temperature 30℃, and injection volume 5 μL.

[0168] The monosaccharide composition was analyzed by HPLC as follows: Aliquots (400 μL each) of the mixed monosaccharide standard solution or L-β-galactodextran II hydrolysate were added, and 400 μL of PMP methanol solution was added. The mixture was reacted in a water bath at 70 °C for 2 hours, followed by neutralization with 400 μL of 0.3 M HCl, and then 1.2 mL of water was added. The mixture was extracted twice with 2.4 mL of chloroform, and the aqueous phase was filtered through a 0.45 μm microporous membrane. Chromatographic conditions: mobile phase A (100 mM sodium phosphate buffer, pH 6.7), mobile phase B (acetonitrile); detection wavelength 250 nm; column temperature 30 °C; flow rate 1 mL / min. An HPLC system equipped with a DAD detector and a C18 column (250 mm × 4.6 mm, 5 μm) was used, with an injection volume of 5 μL.

[0169] Methylation analysis is a method for determining the types of sugar residues and their linkages in polysaccharides. First, the polysaccharide reacts with iodomethane to methylate all free hydroxyl groups, forming a fully methylated polysaccharide. Then, acid hydrolysis breaks the glycosidic bonds, generating partially methylated monosaccharide molecules (except for the glycosidic bond break sites, the remaining positions are still substituted with methyl groups). Next, sodium borohydride is used to reduce the partially methylated monosaccharides, reducing the hemiacetal group to a hydroxyl group, generating partially methylated sugar alcohols. These sugar alcohols are then acetylated to generate partially methylated sugar alcohol acetates (PMAA), in which all free hydroxyl groups are acetylated. By determining the acetylation sites, the linkage of the glycosidic bonds can be inferred, thus determining the type of sugar residue. Finally, gas chromatography-mass spectrometry (GC-MS) is used to separate and detect the products, and the obtained chromatographic peaks are compared with standard PMAA mass spectra in a database to determine the type of sugar residue corresponding to each chromatographic peak in the sample. In this invention, the methylation determination uses the NaOH-DMSO-Mel method with some modifications: 5 mg of L-β-galactoglucan II was dissolved in 1 mL of DMSO. Then, 2 mg of NaOH was added and the mixture was incubated for 30 minutes, followed by the addition of 100 μL of CH3I and a reaction time of 1 hour. The reaction was terminated by adding 2 mL of water. The mixture was extracted three times with 4 mL of CH2Cl2, and the aqueous phase was discarded. After evaporation of the CH2Cl2 phase, TFA (200 μL, 2M) was added, and the mixture was hydrolyzed at 121 °C for 90 minutes and dried. Ammonia (100 μL, 2M) and NaBD4 (100 μL, 1M) were added, and the mixture was stirred at room temperature for 2.5 hours. The reaction was terminated by adding 40 μL of acetic acid, and the product was dried under nitrogen, washed twice with 500 μL of methanol, and dried again under nitrogen. Acetylation was performed at 100 °C for 2.5 hours with 500 μL of acetic anhydride, and the reaction was terminated by adding 2 mL of water. The mixture was extracted three times with 2 mL of CH2Cl2. Methylation analysis was performed using gas chromatography-mass spectrometry (GC-MS).

[0170] GC conditions: Agilent BPX70 column (30 m × 0.25 mm × 0.25 μm); injection volume: 1 μL; flow rate: 1 mL / min; carrier gas: high-purity helium; injection port temperature: the initial temperature of the column oven was set to 140℃, held for 2 minutes, and then increased to 230℃ at a rate of 3℃ / min and held for 3 minutes.

[0171] ICS and HPLC analysis results are as follows Figure 1 As shown in Figures A and B. ICS analysis revealed that L-β-galactoglucan II is mainly composed of glucose and galactose, with small amounts of rhamnose and glucuronic acid, in a molar ratio of 81.39:11.02:6.13:1.37. Figure 1A) In ICS analysis, the molar ratio of glucose to galactose was approximately (7-8):1. Similarly, HPLC results confirmed a similar composition, with the molar ratio of the same monosaccharides being 88.68:5.47:4.06:0.85 (Figure 1B), meaning that in HPC analysis, the molar ratio of glucose to galactose was approximately (16-17):1. The low uronic acid content indicates that the sample is primarily a neutral polysaccharide. Neutral polysaccharides have been reported to possess good biocompatibility and a wide range of biological activities, including antioxidant, anti-inflammatory, and immunomodulatory effects. Therefore, the predominantly neutral nature of L-β-galactoglucan II may contribute to its potential applications in the biomedical and functional food fields. In summary, these results indicate that glucose and galactose are the main sugar components of L-β-galactoglucan II.

[0172] Table 3: Glycosidic bond types identified in L-β-galactoglucan II by methylation analysis combined with GC-MS

[0173] To further investigate the glycosidic bond linkages and structural characteristics of L-β-galactoglucan II, methylation was performed and analyzed using GC-MS. Figure 1 As shown in C and Table 3, six types of glycosidic bond linkages were identified, including: terminal Glcp-(1→ (8.90 mol%), →3)-Glcp-(1→ (32.13 mol%), →3)-Galp-(1→ (8.93 mol%), →6)-Glcp-(1→ (11.07 mol%), →4)-Glcp-(1→ (26.89 mol%), and →4,6)-Glcp-(1→ (12.07 mol%). The calculated relative molar contents of glucose and galactose were 91.06% and 8.93%, respectively, indicating that the molar ratio of glucose to galactose in the combined methylation GC-MS analysis was approximately (10-11):1.

[0174] Notably, the high proportion of →3)-Glcp-(1→ links (32.13%) indicates that the backbone of L-β-galactoglucan II is primarily composed of 1,3-linked glucose residues. Furthermore, the significant presence of →4)-Glcp-(1→ links (26.89%) suggests a high proportion of 1→4-linked glucose units within the backbone. Cereal-type mixed-linked β-D-glucans are characterized by alternating (1→3) and (1→4) bonds, and lichen polysaccharides are known to specifically cleave the (1→4) bond immediately adjacent to the (1→3) bond. Methylation analysis revealed that L-β-galactoglucan... The (1→3) / (1→4) linkage ratio of L-β-galactoglucan II is approximately 1:1, prompting an investigation into whether L-β-galactoglucan II belongs to this type of structure. To this end, enzymatic hydrolysis experiments were performed under standard conditions. No observable cleavage products were detected, indicating that L-β-galactoglucan II does not possess the typical structure of cereal-type β-glucan. The abundance of glucose residues linked by (1→3)- and (1→4)- is comparable, suggesting that the backbone of L-β-galactoglucan II is likely a mixture of (1→3)- and (1→4)-linked pyranoglucosyl units, rather than a regular repeating sequence. Furthermore, the detection of (1→4,6)-Glcp-(1→) residues reveals the presence of branching points. Taken together, these results indicate that L-β-galactoglucan II is a structurally complex extracellular polysaccharide with a backbone composed of (1→3) and (1→4)-glucans and side chains.

[0175] 6. Nuclear Magnetic Resonance (NMR) Measurement In this study, the structural characteristics of L-β-galactoglucan II were analyzed in detail using ¹³C NMR and ¹H NMR, and the determination methods are as follows: L-β-galactoglucan II was dissolved in deuterated DMSO (DMSO-d6) to a final concentration of 30 mg / mL and subjected to three freeze-thaw cycles. All homonuclear and heteronuclear NMR measurements were recorded at 333 K using an NMR spectrometer equipped with a CPQCI probe. ¹H and ¹³C NMR spectra, as well as ¹H-¹H correlation (COSY), ¹H-¹H total correlation (TOCSY), ¹H-¹³C heteronuclear single quantum coherence (HSQC), and ¹H-¹³C heteronuclear multi-bond correlation (HMBC) spectra, were processed using known software.

[0176] To further confirm the detailed structure of L-β-galactoglucan II, one-dimensional (¹H and ¹³C) and two-dimensional (COSY, HSQC, HSQC-TOCSY, and HMBC) NMR analyses were performed. Based on the NMR chemical shift values, the six sugar residues identified by methylation analysis (Table 4) were further characterized, and their signal assignments are summarized in Table 2. The ¹H and ¹³C NMR signals in the δ range of 4.30–4.48 ppm correspond to anomeric protons, while the anomeric carbons are distributed in the δ range of 102.6–103.9 ppm, indicating the presence of a β-configuration in L-β-galactoglucan II. Figure 2 A and B).

[0177] In ¹H-¹³C HSQC spectrum ( Figure 2 The signal obtained from the anodic region of D) contains six spin systems with C-1 / H-1 signals located at 103.1 / 4.477, 102.6 / 4.353, 103.6 / 4.384, 103.2 / 4.307, 103.9 / 4.462, and 102.6 / 4.447 ppm, respectively, labeled as residues A to F. The proton chemical shift of residue A was resolved in the COSY spectrum (… Figure 2 A clear spin system was observed in C), showing a continuous coupling mode from H-1 (4.477 ppm) to H-2 (3.295 ppm), H-3 (3.448 ppm), H-4 (3.235 ppm), H-5 (3.275 ppm), and H-6a (6b) (3.705 (3.442) ppm). The corresponding ¹³C chemical shift values ​​were obtained by HSQC spectroscopy ( Figure 2 The DG concentrations were determined to be C-2 (72.6 ppm), C-3 (86.5 ppm), C-4 (68.3 ppm), C-5 (76.2 ppm), and C-6 (60.7 ppm). The significant downward shift of C-3 indicates that this position has been replaced. In the HSQC-TOCSY spectrum (… Figure 2 In the H signal at δ_C 103.1 ppm, the cross-peak correlates with the H signals at δ_H 3.295, 3.448, 3.235, 3.275, and 3.705 / 3.442 ppm, confirming the complete spin system of residue A. Therefore, residue A is assigned to →3)-β-D-Galp-(1→).

[0178] Residue B in HSQC and HSQC-TOCSY spectra ( Figure 2The anomeric carbon / proton signal shown in the D, H) is located at 102.6 / 4.353 ppm. The assignments of the remaining carbon / proton pairs are as follows: C-2 / H-2 (72.2 / 3.227 ppm), C-3 / H-3 (87.3 / 3.438 ppm), C-4 / H-4 (68.2 / 3.254 ppm), C-5 / H-5 (76.0 / 3.220 ppm), and C-6 / H-6a (6b) (61.0 / 3.707 (3.512) ppm). The significant downfield shift of C-3 (87.3 ppm) strongly suggests the presence of glycosylation at this position. The corresponding H-3 signal (3.439 ppm) also aligns with the O-3 position, which is typically observed in 3-substituted β-D-glucopyranosyl units. Residue B was identified as →3)-β-D-Glcp-(1→).

[0179] For residue C, a continuous spin system was identified in the COSY spectrum, with the ¹H chemical shifts from H-2 to H-6a (6b) assigned to 3.078, 3.215, 3.084, 3.207, and 3.702 (3.435) ppm, respectively. Based on the HSQC spectrum, the ¹³C chemical shifts from C-2 to C-6 were assigned to 73.7, 76.0, 70.0, 76.7, and 61.0 ppm, respectively. Notably, the lower-field position of C-4 (70.0 ppm) indicates that this C-4 site is substituted. Residue C was assigned to →4)-β-D-Glcp-(1→).

[0180] The anomeric proton / carbon signal of residue D in the HSQC spectrum is located at 103.2 / 4.307 ppm. The remaining proton / carbon pairs are assigned as follows: C-2 / H-2 (73.3 / 3.024 ppm), C-3 / H-3 (76.3 / 3.183 ppm), C-4 / H-4 (69.7 / 3.174 ppm), C-5 / H-5 (75.3 / 3.295 ppm), and C-6 / H-6a (6b) (68.3 / 3.988 (3.645) ppm). The downfield shift of C-4 (69.7 ppm) and C-6 (68.3,6) indicates that residue D corresponds to the →4,6)-β-D-Glcp-(1→ linker.

[0181] For residues E and F, HSQC spectra showed anodic C-1 / H-1 values ​​of 103.9 / 4.462 and 102.6 / 4.447 ppm, respectively. However, due to significant peak overlap in both COSY and HSQC spectra, more detailed proton assignment was not possible. Residue E was temporarily assigned to a (1→6)-linked β-D-Glcp, and residue F was assigned to a non-reduced terminal β-D-Glcp.

[0182] Based on the proton and carbon chemical shift assignments of residue AF, via HMBC ( Figure 3 (AB) Experiments determined the glycosyl residue sequence of L-β-galactoglucan II and some intra-residue linkage information. As a result, the following residue correlation signals were detected in the HMBC spectrum: H-1 of residue C with C-3 of residue A; H-1 of residue A with C-3 of residue B; H-1 of residue B with C-6 of residue D; and H-1 of residue D with C-6 of residue E.

[0183] Furthermore, methylation analysis provided further structural insights. Based on the established interpretation of the methylation pattern, residue F was identified as an unsubstituted terminal β-Glcp and determined to be linked to residue E at the C6 position via a β-(1→6) glycosidic bond, forming a short disaccharide side chain.

[0184] Based on these data, the repeating unit of L-β-galactoglucan II was identified ( Figure 3 C), characterized by a branched galactoglucan. The main chain of this repeating unit consists of β-(1→3)-Glcp, β-(1→4)-Glcp, β-(1→3)-Galp and β-(1→4,6)-Glcp residues in a molar ratio of 3:3:1:1, and has a side chain consisting of a β-(1→6)-linked Glcp and a terminal Glcp (T-Glcp) residue.

[0185] Table 4: 1D and 2D NMR chemical shifts of L-β-galactoglucan II in DMSO-d6

[0186] 7. Determination of refractive index increment (dn / dc) and molecular weight in polysaccharide water Size exclusion chromatography (SEC), also known as gel permeation chromatography (GPC), operates on the following principle: larger polymers are less likely to enter the pores of a porous packing material, resulting in shorter retention times and preferential elution; smaller polymers, on the other hand, are more likely to enter the pores, have longer retention times, and are subsequently eluted. This method yields a curve showing the relationship between polymer size and retention time (or retention volume), i.e., a chromatogram of molecular weight distribution. This method is a relative measurement and requires a calibration curve to be established using a series of narrowly distributed standards. When size exclusion chromatography is coupled with light scattering (SEC-LLS), no calibration curve is needed, making it an absolute measurement method that can directly determine the weight-average molecular weight (WMI). M w Polydispersion coefficient ( d ) and root mean square radius < S 2 >z 1 / 2 This technology uses two detectors, differential refractive index and light scattering, to simultaneously detect polymers. Each data point represents the concentration and light scattering signal of a fraction of the sample being tested.

[0187] The detection method of this invention is as follows: The molecular weight of L-β-galactoglucan II in 0.9% NaCl aqueous solution was determined using a size exclusion chromatography-multi-angle laser light scattering-differential refractive index-viscosity coupled system (SEC-MALLS-RI-Visco) equipped with a He-Ne laser source (laser wavelength λ = 633 nm). The system included a DSP laser light scattering detector and an LC-20AD pump. Analytical conditions: Shodex-OHpak SB-805 HQ column (8.0 mm × 300 mm), mobile phase 0.9% NaCl aqueous solution, flow rate 0.5 mL / min, column temperature 25°C, scattering angle θ = 90°, injection volume 200 μL.

[0188] The intrinsic viscosity ([η]) of a 1 mg / mL solution of L-β-galactoglucan II in water and DMSO was measured at 25°C using an Ubbelohde capillary viscometer. [η] was calculated using the Huggins and Kraemer equations, neglecting the kinetic energy correction term:

[0189] Where k and β are constants for the same polymer at a given solvent and temperature. sp / c represents the viscosity / concentration ratio, ln r / c represents the logarithmic relative viscosity / concentration ratio.

[0190] Based on the slope of the concentration-differential refractive response curve, the refractive index increment of L-β-galactoglucan II in 0.9% NaCl aqueous solution was calculated to be 0.1438 mL / g. Based on this value, the weight-average molecular weight and number-average molecular weight of L-β-galactoglucan II were measured to be approximately 4.4 × 10⁻⁶. 5 and 3.1×10 5 ( Figure 4 A). The obtained polydispersity index of 1.409 indicates that its molecular weight distribution is highly uniform.

[0191] SEC chromatogram of L-β-galactoglucan II in aqueous solution ( Figure 4B) shows a single main peak at approximately 30 minutes, indicating a relatively homogeneous molecular population. The corresponding static light scattering (θ = 90°) and differential refractive index signals agree well with this main peak, confirming the consistency between molecular weight and concentration distribution. However, the increased light scattering intensity observed before the main peak, and the shoulder peak visible on the tail side, indicate the presence of a small number of high-molecular-weight aggregates and possible degradation fragments. These findings suggest that although L-β-galactoglucan II is predominantly homogeneous, some degree of molecular aggregation exists under the test conditions.

[0192] To evaluate the solution behavior of L-β-galactoglucan II, its intrinsic viscosity in water and DMSO was measured. Figure 4 Medium CD). sp / c to c graph and ln sp The c / c graph showed a good linear relationship in both solvents, confirming typical polymer solution behavior. L-β-galactoglucan II exhibited an intrinsic viscosity as high as 817 mL / g in water, significantly exceeding that of polysaccharides with similar molecular weights, such as lentinan (510 mL / g). This indicates that it possesses a large hydrodynamic volume and a strong thickening effect in aqueous media. In contrast, its intrinsic viscosity in DMSO was significantly lower (203 mL / g), which may be due to the presence of the polar solvent DMSO partially disrupting intramolecular hydrogen bonds and increasing chain flexibility.

[0193] 8. SEM, TEM and AFM analysis The surface morphology of L-β-galactoglucan II was observed using scanning electron microscopy (SEM). The higher-order structural morphology of L-β-galactoglucan II was observed using transmission electron microscopy (TEM). The structural morphology of L-β-galactoglucan II was observed using atomic force microscopy (AFM).

[0194] like Figure 5 As shown in Figure A, at low concentrations (2.0 × 10⁻ 8 At a concentration of 1.0 × 10⁻³ g / mL, AFM imaging of L-β-galactoglucan II revealed a clear worm-like chain structure, indicating that the polysaccharide exhibits a relatively rigid and extended conformation in dilute aqueous solution. TEM analysis at higher concentrations (1.0 × 10⁻³ g / mL) revealed a dendritic aggregate structure. Figure 5B). During sample drying, the trunk length of these dendritic structures extended to several micrometers, which may be attributed to the head-to-tail aggregation mode of the polysaccharide chains. To observe its morphology in aqueous solution, L-β-galactoglucan II samples (1.0 × 10⁻³ g / mL) were rapidly frozen in liquid nitrogen and then freeze-dried. SEM analysis of the resulting freeze-dried samples showed the formation of nanofiber structures with relatively uniform diameters and lengths ranging from tens to hundreds of micrometers. Figure 5 Based on these observations, it is speculated that L-β-galactoglucan II may self-assemble into dendritic hollow fibers in an aqueous environment, possibly similar to branched nanotubes.

[0195] The crystal structure of L-β-galactoglucan II was analyzed by X-ray diffraction. For example... Figure 5 As shown in Figure E, a broad and weak diffraction peak was observed at 19.9°, with no sharp peaks, indicating that L-β-galactoglucan II is primarily amorphous with low crystallinity. Given that industrial processing of dietary fiber typically involves high temperatures, I evaluated the thermal stability of L-β-galactoglucan II using thermal analysis. Thermogravimetric (TG) and derivative thermogravimetric (DTG) measurements were performed. Figure 5 As shown in Figure F, the TG-DTG curves reveal two main weight loss phases. The first phase occurs below 100°C and is attributed to water evaporation. The second, more significant phase occurs between 100°C and 350°C, likely corresponding to the decomposition of oxygen-containing functional groups in the polysaccharide. The DTG curves show a maximum decomposition rate of 8.06% / min at 297.2°C. Above approximately 321°C, the weight loss curves flatten and approach a stable baseline, indicating that the main thermal decomposition is essentially complete.

[0196] Overall, these results indicate that L-β-galactoglucan II exhibits a rigid chain morphology, low crystallinity, and good thermal stability, which supports its potential as a functional component in food systems, particularly in applications requiring thickening, heat resistance, or structural support.

[0197] IV. Conclusion The above experimental results show that L-β-galactoglucan II is mainly composed of glucose and galactose, and its molecular weight is confirmed to be 4.382 × 10⁻⁶. 5 A homogeneous polysaccharide. Methylation analysis and nuclear magnetic resonance analysis further identified L-β-galactoglucan II as a galactoglucan, whose backbone is composed of β-(1→3)-Glcp, β-(1→4)-Glcp, β-(1→3)-Galp and β-(1→4,6)-Glcp residues, and whose side chain is composed of β-(1→6)-Glcp and terminal glucose (T-Glcp) linked together.

[0198] Effect Test 1: Physiological Activity of L-β-galactoglucan II 1. Experimental Materials L-β-galactoglucan II sample was provided by Chengdu Saidico Biotechnology Co., Ltd.; loperamide hydrochloride (LOP) was purchased from MCE Biotech, Inc., USA; gum arabic was from Shanghai Maclean Biotechnology Co., Ltd.; pharmaceutical-grade activated carbon was from Shanghai Maclean Biotechnology Co., Ltd.; TRIPURE total RNA extraction reagent and SuperRealPreMix Plus (SYBR Green) were purchased from Beijing Adley Biotechnology Co., Ltd.; primers were synthesized by Sangon Biotech Co., Ltd.; hematoxylin and eosin (H&E) staining kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd. 2. Main Instruments Multifunctional microplate reader: SpectraMax® M, purchased from Molecular Devices, USA; Autoclave: MLS-3750, purchased from Sanyo Corporation, Japan; Small ultrasonic crusher: XL-2000-101, purchased from SONICA, USA; Horizontal shaker: Orbital shaker TS-1, purchased from Haimen Kylin-Bell Laboratory Instruments Co., Ltd.; Manual slicer: HM315, purchased from Thermo Fisher Scientific, USA; Digital imaging system: DP72, purchased from OLYMPUS, Japan; Standard PCR instrument: DNAengine, purchased from Bio-Rad, USA; Real-time PCR instrument: ABI 7500, purchased from Applied Biosystems, USA; Refrigerated centrifuge: Legend micro 21R, purchased from Thermo Fisher Scientific, USA; Centrifuges: 5810 R, 5804R; purchased from Eppendorf, USA; Biosafety cabinet: HF-safe 1200, purchased from Likang Biomedical Technology Holdings Limited.

[0199] 3 experimental animals Forty 6-8 week old BALB / c mice were used in this experiment. After one week of acclimatization, they were randomly divided into 5 groups of 8 mice each. The groups were: CON group (control group, administered sterile saline by gavage), LOP group (constipation model group, administered 10 mg / kg loperamide hydrochloride by gavage, followed by sterile saline by gavage 1 h later), LOP+LC group (administered 10 mg / kg loperamide hydrochloride by gavage, followed by 200 mg / kg L-β-galactoglucan II by gavage 1 h later), LOP+MC group (administered 10 mg / kg loperamide hydrochloride by gavage, followed by 400 mg / kg L-β-galactoglucan II by gavage 1 h later), and LOP+HC group (administered 10 mg / kg loperamide hydrochloride by gavage, followed by 800 mg / kg L-β-galactoglucan II by gavage 1 h later). During the experiment, all mice were housed in a mouse room at 23–26°C with a fixed 12-hour light / dark cycle daily. All mice were allowed free access to food and water, and their weight, food intake, and water intake were recorded. The experiment lasted for two weeks, and blood and tissue samples were collected at the end of the experiment for subsequent analysis.

[0200] After the experiment, mice were euthanized using carbon dioxide asphyxiation and blood was collected rapidly. The abdominal cavity was opened, and colonic tissue and cecal feces were collected and placed in EP tubes, stored at -80°C. Small segments of ileal and colonic tissue were cut and fixed in 4% paraformaldehyde for 24 h, washed three times with PBS, and stored in 70% ethanol for subsequent tissue section preparation. Colonic tissue used for molecular marker detection was frozen in liquid nitrogen and then transferred to a -80°C freezer. Blood samples were allowed to stand at room temperature for 2 h, centrifuged at 2500 rpm for 15 min, and serum was collected and stored at -80°C for later analysis.

[0201] 4. Bowel movement related indicator testing 4.1 Determination of fecal weight and moisture content Fresh feces excreted by mice in each group within 5 hours were collected, placed in dried EP tubes, and weighed. The wet weight of the feces was recorded. The feces were then placed in a 60℃ oven for 48 hours and weighed to obtain the dry weight. The formula for calculating fecal moisture content is: Fecal moisture content (%) = [(Wet weight of feces - Dry weight of feces) / Wet weight of feces] × 100% 4.2 Whole intestinal transit time On the last day of gavage (day 14), the time of the first black stool in mice was measured. The method was as follows: All mice except the control group were gavaged with loperamide hydrochloride. One hour later, they were gavaged with pre-prepared ink. The time of the first black stool in each mouse was recorded from the time of the ink gavage.

[0202] 4.3 Small intestinal propulsion rate Mice were administered loperamide hydrochloride via gavage for 13 days. On the night of the 13th day, they were fasted overnight. On the morning of the 14th day, all mice except the control group were administered loperamide hydrochloride via gavage. Half an hour later, they were administered pre-prepared ink via gavage. After 20 minutes, the mice were immediately sacrificed. The abdominal cavity was opened, and a segment of the small intestine from the pylorus to the ileocecal junction was cut off. The small intestine was gently stretched into a straight line, and the length of this segment was measured as the "total length of the small intestine." The distance from the pylorus to the ink injection site was measured as the "ink propulsion length." The formula for calculating the small intestine propulsion rate is: Small intestine propulsion rate (%) = Ink propulsion length / Total small intestine length × 100% 5. Histopathological sections Preparation of paraffin sections: Ileal and colonic tissues were removed from 70% ethanol and trimmed for subsequent paraffin section preparation. First, the tissues were dehydrated. The intestinal dehydration process was as follows: intestinal tissue was sequentially immersed in 90% ethanol (30 min), 95% ethanol (30 min), 100% ethanol I (30 min), 100% ethanol II (10 min), xylene I (5 min), and xylene II (3 min). Then, the dehydrated tissue was immersed in paraffin I and paraffin II for 1 h each. After paraffin embedding, an automated embedding machine was used for paraffin embedding. Finally, the tissue was sectioned using a rotary microtome, and the complete sections were placed on adhesive glass slides. The section thickness was 5 μm.

[0203] Hematoxylin-eosin (H&E) staining: First, the prepared sections were placed in a 60℃ oven for 1 h. Then, the tissue sections were successively immersed in xylene I (10 min), xylene II (10 min), 100% ethanol (8 min), 95% ethanol (5 min), 70% ethanol (5 min), 50% ethanol (5 min), and distilled water (5 min) for dewaxing. Subsequently, the liver tissue sections were immersed in hematoxylin staining solution for 2 min and rinsed with running water for 10 min. Then, the tissue sections were immersed in eosin staining solution for 1 min and soaked in distilled water twice, 2 min each time. After staining, the liver tissue sections were successively immersed in 70% ethanol (3 sce), 95% ethanol (3 min), 100% ethanol (5 min), xylene I (5 min), and xylene II (3 min) for dehydration. Finally, neutral resin was dropped onto the tissue sections, covered with coverslips, and allowed to air dry. The tissue morphology was observed and photographed under a microscope.

[0204] AB-PAS staining: After routine dewaxing, colon tissue was immersed in Alicin blue staining solution for 20 min, rinsed three times with distilled water for 2 min each time; immersed in oxidizing agent for 5 min, immediately rinsed with running water, then rinsed three times for 2 min each time; immersed in Schiff staining solution for 15 min, rinsed twice with distilled water for 5 min each time; immersed in hematoxylin staining solution for 1 min, rinsed twice with distilled water for 5 min each time; placed in acidic differentiation solution for 1 sec, rinsed with distilled water; immersed in Scott blue solution for 3 min, rinsed with running water for 3 min. Finally, neutral resin was dropped onto the tissue sections, covered with coverslips, ventilated and dried, and observed and photographed under a microscope.

[0205] 6. RNA extraction, reverse transcription, and quantitative real-time PCR to detect gene transcription abundance (1) RNA extraction: Approximately 15 mg of colon tissue, ground with liquid nitrogen, was lysed in 1 mL of Trizol reagent. 200 μL of chloroform was added, and the mixture was shaken for 15 s. The mixture was allowed to stand at room temperature for 10 min, then centrifuged at 13,800 g for 15 min. The supernatant was collected, and an equal volume of isopropanol was added. The mixture was inverted and allowed to stand at room temperature for 10 min. The mixture was then centrifuged at 13,800 g for 10 min, and the supernatant was discarded. The precipitate was washed with 75% ethanol prepared with DEPC water, centrifuged at 13,800 g for 5 min, and the supernatant was discarded. The precipitate was dried at room temperature, and the RNA was dissolved in DEPC water. The RNA concentration and mass were determined using a micro spectrophotometer. The RNA sample was stored at -80°C.

[0206] (2) Reverse transcription: According to the FastQuant RT Kit instructions, mix the RNA sample with 2 × Hifair® II SuperMix plus reagent from the reverse transcription kit, centrifuge, and perform reverse transcription using a PCR instrument according to the reagent instructions. Dilute the cDNA, centrifuge, and store at -20°C.

[0207] (3) Real-time PCR: Following the reagent instructions, mix water, Hieff® qPCR SYBR GreenMaster Mix reagent from the quantitative PCR kit, upstream primer, downstream primer, and cDNA sample sequentially, then vortex and centrifuge. Perform PCR amplification in a quantitative PCR instrument according to the reagent instructions. Use the GAPDH gene as an internal reference gene to calculate and analyze the significance of the results.

[0208] 7. Untargeted metabolomics of cecal contents Metabolomics analysis was provided by Shenzhen Bioincloud Technology Co., Ltd. (Shenzhen, China). Data analysis was performed on the free online platform Bioincloud (https: / / www.bioincloud.tech / ). Experimental procedures were followed according to the company's instructions.

[0209] 8. 16S rRNA amplicon sequencing analysis of cecal contents microbiota characteristics 16S rRNA sequencing service was provided by Shenzhen Bioincloud Technology Co., Ltd. (Shenzhen, China). Data analysis and images in the results were completed on the free online platform of Bioincloud (https: / / www.bioincloud.tech / ). Experimental procedures were performed according to the company's instructions.

[0210] 9. Data Statistical Analysis All results are expressed as mean ± standard error (Means ± SEM). Statistical analysis was performed using SPSS one-way ANOVA and Duncan's method for multiple comparison tests to determine differences between groups. A p-value < 0.05 was considered statistically significant.

[0211] 10 Results 10.1 Effects of L-β-galactoglucan II on body weight and food intake in constipated mice Compared with the control group (CON), loperamide (LOP)-induced constipation reduced the mean daily weight gain in mice (P < 0.05), while supplementation with 800 mg / kg L-β-galactoglucan II (LOP + HC) significantly restored growth performance in mice, with 200 mg / kg (LOP + LC) and 400 mg / kg L-β-galactoglucan II (LOP + MC) showing a trend towards recovery. Loperamide treatment and L-β-galactoglucan II supplementation had no effect on feed intake in mice. See also Figure 6 .

[0212] 10.2 Effects of L-β-galactoglucan II on organ indices in constipated mice Compared with the control group, loperamide-induced constipation mice showed a significant decrease in absolute liver weight and liver organ index (P < 0.05), while the spleen organ index significantly increased (P < 0.05). Supplementation with low, medium, and high doses of L-β-galactoglucan II significantly restored absolute liver weight and liver index (P < 0.05), while the spleen organ index showed a trend of recovery, with no significant difference compared to the control group. Kidney index also showed a decreasing trend in constipated mice, and L-β-galactoglucan II supplementation reversed this trend to some extent. See also Figure 7 .

[0213] 10.3 Effects of L-β-galactoglucan II on defecation parameters in constipated mice Compared with the control group, loperamide induction significantly reduced the wet weight of feces at 5 hours, fecal water content, and small intestinal transit rate in mice, and significantly increased the whole intestinal transit time (P < 0.05). 400 mg / kg and 800 mg / kg L-β-galactoglucan II significantly improved the above-mentioned defecation parameters, with the addition of 800 mg / kg L-β-galactoglucan II showing the best alleviating effect. 200 mg / kg L-β-galactoglucan II alleviated fecal wet weight, whole intestinal transit time, and fecal water content (P < 0.05), and showed a trend towards alleviating small intestinal transit rate, but the effect was not significant. Figure 8 The addition of L-β-galactoglucan II improved the appearance of feces. Mice in the constipation model group had smaller, drier fecal particles, while mice supplemented with L-β-galactoglucan II had larger, shinier, and softer feces. See also Figure 8 .

[0214] 10.4 Effects of L-β-galactoglucan II on serum biochemical indices in constipated mice As shown in the table, compared with the control group (CON), the serum levels of total protein, triglycerides and total cholesterol in the constipation model group were significantly reduced (P < 0.05), while the supplementation of low, medium and high doses of L-β-galactoglucan II could significantly restore these indicators (P < 0.05), returning them to a level that was no different from that in the control group.

[0215] Table 5 Serum Biochemical Indicators of Mice

[0216] 10.5 Effects of L-β-galactoglucan II on ileal structure in constipated mice HE staining of ileal tissue showed no significant pathological changes in the ileum of both the model group and the treatment groups. (See also...) Figure 9 .

[0217] 10.6 Effects of L-β-galactoglucan II on the colonic barrier in constipated mice The results of hematoxylin-eosin (H&E) staining of colon tissue revealed ( Figure 10 Compared with the control group, the constipation model mice showed mild inflammatory infiltration in the colon, while no obvious inflammatory infiltration was observed after supplementation with 400 mg / kg and 800 mg / kg L-β-galactoglucan II.

[0218] To evaluate the protective effect of L-β-galactoglucan II on the colonic barrier in constipated mice, the expression of colonic tight junction proteins and mucin genes was examined. Compared with the control group, the transcriptional levels of occludin, Claudin3, Claudin4, and Mucin-3 genes in colonic tissue were significantly decreased (P < 0.05), while L-β-galactoglucan II supplementation significantly increased the expression levels of Claudin3, Claudin4, and Mucin-3 genes (P < 0.05), but had no significant effect on occludin gene expression. See also Figure 11 .

[0219] AB-PAS staining further illustrates ( Figure 12 The study found that, compared with the control group, the constipation model group had decreased mucin levels, while L-β-galactoglucan II restored mucin levels.

[0220] 10.7 Effects of L-β-galactoglucan II on the expression of aquaporin and ckit genes in mouse colon Constipation is often accompanied by abnormal expression of aquaporins. Compared with the control group, the transcription of AQP3 and AQP8 genes was significantly downregulated in the constipation model group (P < 0.05). Supplementation with 400 mg / kg and 800 mg / kg L-β-galactoglucan II significantly restored the gene expression levels of AQP3 and AQP8, while 200 mg / kg L-β-galactoglucan II had a significant effect on the recovery of AQP8 and a tendency to upregulate the expression level of AQP3, but no significant effect. Cajal interstitial cells are a key bridge for gastrointestinal motility. When gastrointestinal motility disorders occur, the number of Cajal interstitial cells decreases. The gene expression of c-Kit, a marker of colonic Cajal interstitial cells, and its ligand stem cell SCF was significantly reduced in the constipation model group (P < 0.05). Compared with the constipation model group, supplementation with L-β-galactoglucan II had no significant effect on SCF gene expression. 800 mg / kg L-β-galactoglucan II significantly upregulated ckit gene expression, while 200 mg / kg and 400 mg / kg L-β-galactoglucan II only showed a trend of upregulating ckit gene expression. See also Figure 13 .

[0221] 10.8 Effects of L-β-galactoglucan II on cecal metabolites in constipated mice In both positive and negative ion models, PCA analysis showed complete separation between the model and control groups, demonstrating that loperamide induction significantly altered cecal metabolites in mice. The three different doses of L-β-galactoglucan II groups also separated well from the model group and overlapped with the control group, indicating that L-β-galactoglucan II can alleviate the metabolite changes caused by constipation to some extent. Furthermore, the distance between the three experimental groups and the model group increased with increasing concentration, suggesting a dose-effect relationship in relieving constipation with L-β-galactoglucan II. PLS-DA showed that the differences between the groups under positive ion (R2Y=0.921, Q2=0.602, Q2 intercept of substitution test=-0.5716) and negative ion modes (R2Y=0.646, Q2=0.431, Q2 intercept of substitution test=-0.310) were similar to those observed in PCA, further demonstrating that L-β-galactoglucan II has a mitigating effect on constipation-induced changes in cecal metabolites.

[0222] 10.9 Effects of L-β-galactoglucan II on the cecal microbiota of constipated mice See results Figure 14 Alpha diversity of mouse cecal microbiota.

[0223] discuss This experiment investigated the alleviating effect of L-β-galactoglucan II on loperamide-induced constipation in mice. Loperamide hydrochloride is widely used to induce constipation models. Its mechanism of action is as an opioid receptor agonist, antagonizing smooth muscle contraction by stimulating μ-opioid receptors in the intestinal wall and inhibiting the release of acetylcholine and prostaglandins, thereby reducing intestinal peristalsis and secretion, and prolonging the retention time of intestinal contents. In this experiment, 10 mg / kg of loperamide significantly reduced the 5-hour wet weight of feces, fecal wet weight, and small intestinal propulsion rate in mice, and significantly prolonged the whole intestinal transit time, demonstrating the successful establishment of the constipation model. Supplementation with L-β-galactoglucan II significantly alleviated constipation symptoms, and the alleviating effect showed a dose-response relationship; the medium-dose (400 mg / kg) and high-dose (800 mg / kg) supplementation were more effective than the low-dose group (200 mg / kg).

[0224] Relief from constipation is often associated with a healthy intestinal barrier. Numerous studies have shown that restoring intestinal barrier function helps regulate intestinal fluid secretion and water-electrolysis balance, thereby alleviating constipation. In this study, the decreased transcriptional levels of Claudin3, Claudin4, and Mucin-3 induced by loperamide treatment were significantly restored upon supplementation with L-β-galactoglucan II.

[0225] Aquaporins (AQPs) are a family of proteins that specifically transport water across membranes. Due to their crucial role in the osmotic regulation of water balance, they are closely related to gastrointestinal transport. In this study, L-β-galactoglucan II supplementation significantly reversed the loperamide-induced decrease in AQP3 and AQP8 mRNA levels, restoring normal water and electrolyte balance in the colon. Decreased intestinal motility is often associated with an imbalance of gastrointestinal motility-related factors. Cajal interstitial cells have been reported to be a key bridge for gastrointestinal motility. When gastrointestinal motility disorders occur, the number of Cajal interstitial cells decreases. In this study, the transcriptional levels of c-Kit, a marker of Cajal mesenchymal cells, and its ligand stem cell (SCF) were significantly reduced in mice with loperamide-induced constipation. However, supplementation with L-β-galactoglucan II had no significant effect on the transcriptional level of SCF. Furthermore, only the high-dose group (800 mg / kg) of L-β-galactoglucan II significantly reversed the transcriptional level of c-Kit. This indicates that the constipation-relieving effect of L-β-galactoglucan II is not achieved by increasing the number of ICCs through the SCF / c-Kit signaling pathway.

[0226] The results of this experiment indicate that L-β-galactoglucan II has a significant relieving effect on loperamide-induced constipation, and the relieving effect has a dose-response relationship. Its mechanism may be related to repairing the intestinal barrier, regulating intestinal water and salt balance, and regulating the intestine.

[0227] Efficacy Test 2: Study on the effect of L-β-galactoglucan II in preventing constipation in mice 1. Abstract This study aimed to investigate the preventive effect of L-β-galactoglucan II pretreatment on loperamide-induced constipation in mice. Results showed that, compared with the constipation model group, L-β-galactoglucan II pretreatment significantly shortened the whole intestinal transit time (P<0.05), significantly increased 5-hour fecal weight and water content (P<0.05), and improved fecal characteristics.

[0228] 2 Materials and Methods 2.1 Test Materials The main instruments are the same as those in Experiment 1. 2.2 Main Instruments The main instruments are the same as those used in Experiment 1.

[0229] 2.3 Treatment of experimental animals This experiment used 60 six-week-old BALB / c mice, which were randomly divided into 5 groups of 12 mice each after one week of acclimatization. The groups were: CON, LOP, LOP+LC, LOP+MC, and LOP+HC. The LOP+LC, LOP+MC, and LOP+HC groups were pretreated with L-β-galactoglucan II at doses of 200 mg / kg, 400 mg / kg, and 800 mg / kg, respectively, by gavage for 14 days. The LOP, LOP+LC, LOP+MC, and LOP+HC groups were then induced into a BALB / c model by gavage with 10 mg / kg loperamide hydrochloride for 7 days. The control group was administered physiological saline by gavage. All mice were housed in a mouse room at 23–26°C with a fixed 12-hour light / dark cycle daily. All mice were allowed free access to food and water, and their weight, food intake, and water intake were recorded. The experiment lasted three weeks, and blood and tissue samples were collected at the end of the experiment for subsequent analysis.

[0230] After the experiment, mice were euthanized using carbon dioxide asphyxiation and blood was collected rapidly. The abdominal cavity was opened, and colonic tissue and cecal feces were collected and placed in EP tubes, stored at -80°C. Small segments of ileal and colonic tissue were cut and fixed in 4% paraformaldehyde for 24 h, washed three times with PBS, and stored in 70% ethanol for subsequent tissue section preparation. Colonic tissue used for molecular marker detection was frozen in liquid nitrogen and then transferred to a -80°C freezer. Blood samples were allowed to stand at room temperature for 2 h, centrifuged at 2500 rpm for 15 min, and serum was collected and stored at -80°C for later analysis.

[0231] 2.4 Data Statistical Analysis Statistical analysis was performed using the SPSS One-way ANOVA program and multiple comparisons were performed using Duncan. Numerical values ​​are expressed as mean ± standard error (SEM). P < 0.05 is considered statistically significant.

[0232] 3 Results 3.1 Effects of L-β-galactoglucan II on body weight and food intake in constipated mice Loperamide treatment and L-β-galactoglucan II pretreatment had no significant effect on body weight and feed intake in mice. Figure 15 As shown.

[0233] 3.2 Effects of L-β-galactoglucan II on organ indices in constipated mice In the prevention experiment, compared with the control group (CON), the constipation model group (LOP) mice showed a significant decrease in absolute liver weight and liver organ index (P < 0.05). Pretreatment with low, medium, and high doses of L-β-galactoglucan II tended to alleviate the decrease in absolute liver weight, and there was no significant difference compared with the control group. Figure 16 As shown.

[0234] 3.3 Effects of L-β-galactoglucan II on defecation parameters in constipated mice Compared with the control group, the loperamide-induced constipation model group (LOP) significantly reduced the wet weight of feces at 5 hours, the water content of feces, and significantly increased the whole intestinal transit time in mice (P < 0.05). Pretreatment with three doses of L-β-galactoglucan II significantly improved the above-mentioned related defecation parameters (P < 0.05), with pretreatment at 800 mg / kg L-β-galactoglucan II showing the best relief effect. Figure 17 Pretreatment with L-β-galactoglucan II improved the appearance of feces. Mice in the constipation model group had smaller, drier fecal particles, while mice supplemented with L-β-galactoglucan II had larger, shinier, and softer feces. Figure 17 As shown.

[0235] 4. Summary In the prevention trial, compared with the constipation model group, pretreatment with L-β-galactoglucan II significantly shortened the whole intestinal transit time (P<0.05), significantly increased 5-hour fecal weight and water content (P<0.05), and improved fecal characteristics. This indicates that pretreatment with L-β-galactoglucan II can effectively prevent the occurrence of constipation.

[0236] Efficacy test 3: Anti-rhinitis activity of L-β-galactoglucan II I. Raw Materials As mentioned above, the polysaccharide sample L- β -Galactoglucan II (hereinafter referred to as "biopolysaccharide B"), designated as B.

[0237] II. Experimental Methods and Procedures 2.1 Establishment of a mouse model of allergic rhinitis Fifty-six BALB / c mice (5 weeks old, female, weighing 20 ± 2 g), SPF grade, were selected. The mouse allergic rhinitis model was established in two phases: sensitization and challenge. Sensitization phase: On days 1, 4, 7, 10, 13, and 15, 200 μL of physiological saline suspension containing 100 μg ovalbumin (OVA) and 2 mg aluminum hydroxide was injected intraperitoneally to induce allergic rhinitis. Challenge phase: From days 21 to 30, 20 μL of physiological saline containing 200 μg OVA was administered via nasal drip to challenge the allergen.

[0238] The treatment with biopolysaccharide B was administered via gavage once daily for 10 consecutive days. The gavage dose was 200 μL. Twenty-four hours after the last administration, mice were euthanized by cervical dislocation, and nasal mucosa and major organ samples were collected via dissection. This experimental protocol was approved and implemented by the Animal Care and Use Committee of the Guangdong Academy of Sciences Institute of Biological and Medical Engineering.

[0239] 2.2 Experiment on the anti-allergic rhinitis effect of biological polysaccharide B The experiment employed a randomized controlled trial design. Forty-eight mice with successful modeling were randomly divided into six groups of eight. Administered the drug via gavage, 200 μL per gavage. All administrations were performed two hours prior to the infusion of OVA. Following the FDA-recommended human equivalent dose (HED) conversion method, interspecies dose conversion was performed using the body surface area normalization method. The formula is: HED (mg / kg / day) = Animal dose (mg / kg / day) × (Animal Km coefficient / Human Km coefficient), where the mouse Km coefficient = 3 and the adult Km coefficient = 37. Specific grouping and treatment protocols are as follows: ① Negative control group (CT group): No treatment was given; ② Model group (AR group): Only allergen provocation treatment was performed, without any other treatment intervention; ③ Positive control group (DEX group): AR + 2.5 mg / kg / day dexamethasone; ④ Low-dose group: AR + Biological polysaccharide B (13 mg / kg / day, human equivalent dose 1.05 mg / kg / day); ⑤ Medium-dose group: AR + Biological polysaccharide B (39 mg / kg / day, human equivalent dose 3.15 mg / kg / day); ⑥ High-dose group: AR+ Biopolysaccharide B (78 mg / kg / day, human equivalent dose 6.3 mg / kg / day).

[0240] 2.3 Assessment of physiological behavior in mice ① Weight monitoring: Weigh the mouse daily and record the trend of weight change. If the weight loss exceeds 10% of the initial weight, assess the mouse's health by observing the luster of its fur, activity level, and skin condition. Also, note whether the weight change is correlated with changes in food intake to determine the impact of disease on feeding behavior.

[0241] ② Food intake assessment: Record the daily food intake of the mice, calculate the intake by weighing the amount of food before and after feeding, and observe feeding behavior to assess whether rhinitis symptoms have a restrictive effect on feeding. Also note whether the mice exhibit feeding difficulties due to nasal congestion or runny nose.

[0242] ③ Survival rate recording: Record the changes in the number of live mice once a day. Autopsies are performed on deceased individuals to confirm whether the cause of death is related to rhinitis or related complications.

[0243] 2.4 Dissection and Sample Collection Tissue Sample Collection: Nasal tip tissue was collected for histological analysis to further assess the impact of allergic rhinitis on the respiratory tract. The collected nasal tip tissue samples were immediately fixed in 4% neutral formalin solution. Subsequently, slow decalcification of the nasal tip tissue was performed as follows: the fixed tissue was placed in a perforated PE tube or embedding frame, then placed in a decalcification chamber, and sufficient EDTA decalcification solution was added to ensure complete tissue immersion. The chamber was sealed and placed in a thermostatic drying oven for constant-temperature decalcification. The decalcification solution was changed every 3-5 days. During decalcification, the oven temperature was maintained between 25°C and 30°C, and the shaking speed was controlled at 110-120 rpm. Decalcification progress was checked every two days by gently piercing the tissue with a needle; if the needle could penetrate the tissue, the decalcification process was nearing completion. At this point, a Lycra blade could be used to cut the tissue according to the sampling requirements to accelerate the softening process. After decalcification of the nasal tip tissue, it was routinely embedded in paraffin and sectioned into 5 μm thick sections. Hematoxylin and eosin (H&E) staining was then performed for histological observation and analysis.

[0244] III. Results and Discussion 3.1 Weight Changes like Figure 18 As shown, the body weight of mice in the polysaccharide B group remained stable or showed a slight upward trend throughout the experiment, with no significant difference compared to the normal control group. p > 0.05), indicating that the tested biopolysaccharide B did not have a significant adverse effect on the overall health of the mice. In contrast, the positive control group (dexamethasone group) mice had a significant decrease in body weight ( p <0.01), which is consistent with the known side effects of glucocorticoid drugs.

[0245] 3.2 Survival rate analysis results like Figure 19 As shown, throughout the entire experimental observation period, L- β Mice in the galactoglucan II treatment group, administered via gavage, showed no mortality, with a survival rate of 100%. Daily clinical observation revealed that all mice in the treatment groups maintained normal activity levels, feeding behavior, and physiological status, with no abnormal symptoms such as dyspnea, lethargy, or ruffled fur observed.

[0246] 3.3 Histological Analysis Results like Figure 20 The results of HE staining of nasal tissue from mice in different treatment groups are shown, including histological changes of nasal mucosa under low magnification (4×) and high magnification (20×).

[0247] The nasal mucosa of the negative control mice was structurally intact, covered with pseudostratified ciliated columnar epithelium, with cells arranged regularly and continuously, and no mucosal damage was observed. No goblet cell hyperplasia was observed, the glands in the lamina propria were normally distributed, and there was no vasodilation or hyperplasia, nor was there any infiltration of inflammatory cells or mast cells, indicating that the nasal mucosa was in a healthy and physiological state.

[0248] The nasal mucosa of the model group mice showed obvious pathological changes: some epithelial cell cilia showed edema and fusion, indicating mild mucosal damage; accompanied by significant goblet cell hyperplasia; moderate reduction in the number of glands in the lamina propria; significant vasodilation and hyperplasia; moderate infiltration of inflammatory cells (mainly monocytes and neutrophils), and moderate mast cell infiltration was also observed. Compared with the negative control group, the obvious pathological changes in the nasal mucosa of the model group mice indicated that the rhinitis model was successfully established.

[0249] like Figure 20 As shown, L- β The nasal mucosa tissue structure of mice in the low-dose galactoglucan II group showed slight improvement, but some pathological damage remained. Mild ciliary edema, mild goblet cell hyperplasia, and a slight decrease in glandular numbers were observed in some epithelial areas. Vascular dilation and inflammatory cell infiltration were still present, indicating that the low-dose treatment was not significantly effective. β The medium-dose group of galactoglucan II showed a relatively significant tissue repair effect. The epithelial structure was relatively intact, with clear cilia arrangement and only mild edema in a few areas; goblet cells showed no significant proliferation, and glandular distribution was relatively normal; inflammatory cell infiltration was significantly reduced, and vasodilation was mild, indicating that the medium-dose L- β -Galactoglucan II has good anti-inflammatory effects. L- βThe high-dose galactoglucan II group showed the most significant restoration of nasal mucosal structure. The epithelial cell layer remained intact, cilia morphology was good, and no edema or shedding was observed; goblet cells and glandular structures were essentially normal; inflammatory cells and vasodilation were significantly reduced, and the nasal mucosal morphology was close to normal. The overall effect was similar to the positive control group, indicating that high-dose L- β -Galactoglucan II has significant anti-inflammatory and tissue-protective effects.

[0250] III. Summary This study systematically evaluated the effects of different doses of L-125 on allergic rhinitis by establishing a mouse model of allergic rhinitis. β - Anti-rhinitis activity and biosafety of galactoglucan II. An allergic rhinitis model was successfully established, and the therapeutic effect was observed under different doses via gavage. The results showed that L- β -Galactoglucan II exhibits good anti-inflammatory activity in relieving inflammation of nasal mucosa, improving pathological structure, and reducing inflammatory cell infiltration, with the most significant effect in the high-dose group.

[0251] In summary, L- β -Galactoglucan II has shown good therapeutic potential and safety in the intervention of allergic rhinitis.

[0252] Effect test 4 L- β - Anti-oral ulcer activity of galactoglucan II I. Raw Materials The aforementioned L- β -Galactoglucan II (also known as "L-") β -galactoglucan”).

[0253] II. Experimental Methods and Procedures 2.1 Establishment of a rat model of oral ulcer resistance Fifty-six Sprague Dawley rats (8 weeks old, male, weighing 200-250 g), SPF grade, were used to establish an oral ulcer model using acetic acid chemical induction. The specific procedure was as follows: After anesthetizing the rats with an intraperitoneal injection of 2% sodium pentobarbital (400 μL / g), circular filter paper (6×6 mm) soaked in 70% acetic acid was applied to the oral mucosa for 1 min. Immediate discoloration of the mucosa was observed after acid stimulation. The above procedure was repeated the following day to consolidate ulcer formation.

[0254] L- β-Galactomannan II treatment was administered via a spray to ensure direct application of the drug to the ulcer surface. The treatment was repeated once daily for 8 consecutive days, with each spray dose being 200 μL. Twenty-four hours after the last administration, rats were euthanized by cervical dislocation, and samples of the mandible and major organs were collected. This experimental protocol was approved and implemented by the Animal Care and Use Committee of the Guangdong Academy of Sciences Institute of Biological and Medical Engineering.

[0255] 2.2 L- β - Experimental design for the anti-oral ulcer effect of galactoglucan II The experiment employed a randomized controlled trial design. Forty-eight rats with successfully established models were randomly divided into six groups of eight each. All groups received the medication via oral spray once daily at a dose of 200 μL. Specific grouping and treatment protocols are as follows: ① Negative control group (CT group): No oral ulcer induction treatment was performed; ② Model group: Only oral ulcer induction treatment was performed, without any other treatment intervention; ③ Positive control group: oral ulcer induction + dexamethasone (0.05 mg / mL); ④ Low-dose group: Oral ulcer induction + L- β -Galactoglucan II (0.5 mg / mL); ⑤ Medium-dose group: Oral ulcer induction + L- β -Galactoglucan II (1 mg / mL); ⑥ High-dose group: Oral ulcer induction + L- β -Galactostatin II (5 mg / mL).

[0256] 2.3 Assessment of physiological behavior and wound healing in rats ① Behavioral assessment: Observe the rats’ behavior at the same time every day, with each observation lasting at least 15-20 minutes; ② Weight monitoring: Weigh yourself daily and record any changes. Pay close attention if your weight drops by more than 10% of your initial weight, as this may reflect the impact of the ulcer on your appetite. ③ Food intake assessment: Record the daily food intake of rats, weigh the amount of food before feeding and the amount of food left over, and assess whether eating is restricted by pain; ④ Ulcer area measurement: Rats in each group were anesthetized and treated with the drug. Photos were taken before and after drug administration. The change in ulcer area was used to assess the treatment effect, with particular attention paid to the ulcer healing process. ⑤ Healing time record: The time required for complete epithelialization of ulcers in each group of rats was systematically recorded, and the effect of drugs on the healing process was evaluated in combination with histological analysis results.

[0257] 2.4 Dissection and Sample Collection ① Tissue Sample Collection: Rat mandibles were collected. The tissue samples were immediately fixed in 4% neutral formalin solution. Slow decalcification of the mandibular tissue was then performed as follows: The fixed tissue was placed in a perforated PE tube or embedding frame, then placed in a decalcification chamber. Sufficient EDTA decalcification solution was added to ensure complete tissue immersion. The chamber was sealed and placed in a thermostatic drying oven for constant-temperature decalcification. The decalcification solution was replaced every 3-5 days. During decalcification, the temperature inside the chamber was maintained between 25°C and 30°C, and the shaking speed of the thermostatic shaker was controlled at 110-120 rpm. Decalcification progress was checked every two days by gently piercing the tissue with a needle. If the needle could penetrate the tissue, the decalcification process was nearing completion. At this point, a Lycra blade could be used to cut the tissue according to the sampling requirements to accelerate the softening process. After decalcification of the nasal tip tissue, it was routinely embedded in paraffin and sectioned into 5 μm thick sections. Hematoxylin and eosin (H&E) staining was then performed for histological observation and analysis.

[0258] ② Organ harvesting: To evaluate its biocompatibility in vivo, major organs such as the heart, liver, spleen, lungs, and both kidneys of rats were harvested on day 8 post-treatment. Organ tissues were fixed in 4% neutral formalin, routinely embedded in paraffin, and prepared into sections for H&E staining and observation.

[0259] IV. Results and Discussion 3.1 Weight Changes like Figure 21 As shown, different doses of biopolysaccharide L- β - The rat body weight of galactoglucan II maintained a steady upward trend throughout the experiment, with no significant difference compared to the normal control group. p > 0.05), indicating that the tested L-β-galactoglucan II did not have a significant adverse effect on the overall health of the rats. In contrast, the positive control group (dexamethasone group) rats had a significant decrease in body weight ( p < 0.001), which is consistent with the known side effects of glucocorticoid drugs.

[0260] 3.2 Observation of the appearance of oral ulcers in rats and analysis of changes in ulcer area like Figure 22 As shown, in the rat model of oral ulcer, after two consecutive days of modeling treatment, rats in the model group, the positive control group (dexamethasone), and the L-β-galactoglucan II treatment group all showed obvious pathological features such as tissue discoloration, edema, and bleeding in the lower lip mucosa and lower alveolar region, exhibiting typical oral ulcer symptoms, indicating that the model was successfully constructed.

[0261] Compared with the negative control group, rats in both the positive control group and the L-β-galactoglucan II treatment group showed a significant repair trend during subsequent treatment. Particularly from day 3 to day 5 of treatment, the mucosa in the ulcerated area gradually returned to a pink color, edema decreased, bleeding subsided, and the inflammatory response was significantly alleviated, indicating that both groups had a good healing-promoting effect. Furthermore, a concentration-dose relationship was observed, with higher concentrations showing better activity. The high-dose L-β-galactoglucan II group demonstrated effects comparable to or even better than the positive control group during the recovery process, revealing its potential therapeutic advantages.

[0262] It is noteworthy that in rats in the L-β-galactoglucan II group, a significant whitening of the tooth surface was observed on the 3rd day of treatment, indicating that this polysaccharide may have a certain teeth whitening effect. Although the mechanism of this phenomenon is not yet clear, further systematic research is needed to verify it.

[0263] 3.3 Histological Analysis Results like Figure 23 The results of HE staining of rat gingival tissue in different treatment groups are shown, including pathological changes of gingival mucosa observed under low magnification (4×) and high magnification (20×).

[0264] The negative control group showed intact gingival tissue structure, continuous squamous epithelium, and no ulceration or necrosis. Blood vessels were evenly distributed, and no inflammatory cell infiltration or fibrous tissue hyperplasia was observed.

[0265] The model group showed significant gingival tissue damage, manifested as disruption of epithelial integrity, local ulceration, and necrotic foci. Reduced vascularity and moderate inflammatory cell infiltration were observed, indicating an active inflammatory response; moderate-depth ulcers were also visible in the gingival tissue.

[0266] In the low-dose L-β-galactoglucan II group, mild ulceration, moderate necrosis, slight angiogenesis, scattered inflammatory cell infiltration, and mild fibrous tissue hyperplasia were observed in the gingival tissue. In the medium-dose L-β-galactoglucan II group, mild ulceration, mild necrosis, slight angiogenesis, scattered inflammatory cell infiltration, and mild fibrous tissue hyperplasia were also observed in the gingival tissue. In the high-dose L-β-galactoglucan II group, the gingival structure was basically intact, with no ulceration or necrosis. Vascular morphology was normal, with only a small amount of inflammatory cell infiltration and mild fibrous tissue hyperplasia, indicating that L-β-galactoglucan II can significantly improve gingival tissue damage, reduce inflammatory response, and promote tissue repair. These results confirm that L-β-galactoglucan II has a significant protective and repairing effect on gingival tissue.

[0267] 3.4 Safety assessment of internal organs To assess the systemic toxicity of L-β-galactoglucan II and its potential effects on major organs, histopathological observation of the heart, liver, spleen, lungs, and kidneys of rats in each group was performed using HE staining. The results are as follows: Figure 24 As shown in the figure. In the negative control group, the structures of all organs and tissues remained normal. The liver cords were regularly arranged, the hepatocyte nuclei were normal in morphology, and there was no inflammatory cell infiltration. The glomeruli and renal tubules were intact and clearly defined. The alveoli were clearly structured, without collapse or congestion. The red and white pulp of the spleen were clearly distributed, with no areas of hemorrhage or necrosis. The myocardial fibers were neatly arranged, without breakage, edema, or inflammatory response, indicating that the animals were in a healthy state. No obvious structural disorders or pathological damage were observed in the major organs and tissues of rats in the model group and the groups treated with different doses of L-β-galactoglucan II. The tissue structures of each organ were basically normal, with no abnormalities such as inflammatory cell infiltration, cell necrosis, edema, fibrosis, or hemorrhage. Compared with the negative control group, no significant toxic changes were observed.

[0268] Based on the above results, L-β-galactoglucan II did not produce significant toxic effects on the major internal organs of rats during the experimental dose and dosing period, demonstrating good systemic biosafety. This provides preliminary safety support for its further development in oral topical applications or other potential pharmaceutical uses.

[0269] III. Summary and Next Experiment This study systematically evaluated the anti-ulcer activity and biosafety of L-β-galactoglucan II by establishing a rat oral ulcer model. Experimental results showed that the model was successfully established, and L- β Galactoglucan II showed certain anti-oral ulcer effects at different doses, effectively relieving mucosal damage and inflammatory responses. Among them, the high-dose group showed the most significant efficacy, with accelerated mucosal repair and a significant reduction in inflammation.

[0270] Meanwhile, histological analysis showed that L-β-galactoglucan II did not cause significant pathological damage to the major internal organs (heart, liver, spleen, lung, and kidney) of rats. The structures of each organ remained intact, and no inflammatory infiltration, necrosis, or fibrosis was observed, indicating that the polysaccharide has good biocompatibility and preliminary safety within the experimental dosage range.

[0271] In conclusion, L-β-galactoglucan II demonstrates good therapeutic potential and safety in relieving oral ulcers.

[0272] Effects Experiment 5: Study on the effects of L-β-galactoglucan II on growth, apparent digestibility, and gut microbiota in growing-finishing pigs. 1. Experimental design and diet composition This experiment selected 624 Duroc × Berkshire Ningxiang crossbred piglets aged 30 days and randomly divided them into three groups, supplemented with L-β-galactoglucan II at 400 ppm, 200 ppm, and 0 ppm (control group), respectively. Each group had 16 replicates, with 13 piglets per replicate, and all piglets entered a pre-trial period of approximately 10 days (grouping details are shown in Table 6). The pigs were fed a corn-soybean meal diet, with the basal diet formula formulated according to NRC (2012) and the "Swine Feeding Standard" (NY / T65-2004). The composition and nutrient levels of the formulas for the nursery and finishing periods are shown in Tables 7 and 8. All experimental pigs had free access to feed and water. Pigpens were cleaned and disinfected regularly according to the pig farm's routine cleaning and disinfection procedures, ensuring the pigpens were clean, dry, and at a suitable temperature. Other feeding and management procedures were carried out according to the pig farm's routine practices.

[0273] Table 6 Experimental Groups

[0274]

[0275]

[0276] 2. Sample collection and index determination 2.1 Growth performance After the formal trial began, the pigs in the pen were weighed on an empty stomach each month, and the data was recorded. Feed intake was recorded daily during the trial period, and the feed conversion ratio (FCR) was calculated. Diarrhea and mortality were recorded, and adverse reactions were observed and recorded in detail. The formulas for calculating daily feed intake and FCR per pig are as follows: Daily feed intake = Ending body weight × Total feed intake within the replicate ÷ Total body weight within the replicate ÷ Number of feeding days; FCR = Daily feed intake (kg) ÷ Daily weight gain (kg). Invalid data such as mortality and negative growth were discarded.

[0277] 2.2 Apparent digestibility Three days before slaughter, fresh fecal samples were collected from 10 fattening pigs in each group via anal sampling. The samples were collected for three days, then mixed with fecal samples for three days and stored at 4℃. After drying, the apparent digestibility of dry matter, total energy, and crude protein was determined by acid-insoluble ash (AIA). Feed samples were collected using a quartering method, with 200g samples taken from each treatment. All samples were dried and pulverized at 65℃ for later use. Using AIA as an indicator, the apparent digestibility of each nutrient (dry matter, total energy, crude protein, crude fat, and crude ash) in the diet and feces was determined. Nutrient apparent digestibility = (1 - A1 × F2 / A2 × F1) × 100, where: A1 is the AIA content in the diet (%), A2 is the AIA content in the fecal sample (%), F1 is the content of a specific nutrient in the diet (%), and F2 is the content of a specific nutrient in the fecal sample (%).

[0278] 2.3 Gut microbial sequencing Colonic metagenomic sequencing of microorganisms was performed at Novogene Corporation in Beijing. One μg of genomic DNA from the sample was randomly fragmented into approximately 350 bp fragments using a Covaris ultrasonic disruptor for library construction. The library preparation involved end repair, A-tailing, sequencing adapter addition, purification, and PCR amplification. After library construction, the integrity and insert size of the library fragments were checked using AATI. If the results met expectations, the effective concentration of the library was accurately quantified using Q-PCR (effective concentration > 3 nM) to ensure library quality. After passing the library test, different libraries were pooled according to their effective concentration and the target data volume requirements before PE150 sequencing.

[0279] 2.4 Bioinformatics Analysis The raw data obtained from the NovaSeq sequencing platform was preprocessed using FastP (https: / / github.com / OpenGene / fastp) to obtain clean data for subsequent analysis. The clean data was then assembled and analyzed using MEGAHIT software. The assembled scaffolds were then broken at N-joints to obtain scaffolds without N-joints. MetaGeneMark (http: / / topaz.gatech.edu / GeneMark / ) was used to predict the ORF of scaffolds (>=500bp) for each sample, and information shorter than 100 nt in the prediction results was filtered out using default parameters. The ORF prediction results were then deredundantd using CD-HIT software (http: / / www.bioinformatics.org / cd-hit / ) to obtain a non-redundant initial gene catalogue (here, the non-redundant continuous gene-encoding nucleic acid sequences are referred to as genes), with the following parameter settings: -c 0.95, -G 0, -aS 0.9, -g 1, -d 0. Bowtie2 was used to align the clean data of each sample to the initial gene catalogue, calculating the number of aligned reads for each gene in each sample, thus obtaining the final gene catalogue (unigenes) for subsequent analysis. Based on the number of aligned reads and gene lengths, the abundance information of each gene in each sample was calculated. Based on the abundance information of each gene in each sample from the gene catalogue, basic statistical information, core-pan gene analysis, inter-sample correlation analysis, and Venn diagram analysis of gene number were performed.

[0280] The unigenes were compared with Micro_NR using the DIAMOND software (https: / / github.com / bbuchfink / diamond / ), with the parameters set to blastp, -e 1e-5. Micro_NR consists of bacterial, fungal, archaea, and viral sequences extracted from the NCBI NR database (https: / / www.ncbi.nlm.nih.gov / ). For each sequence alignment, the result with an evalue <= the minimum evalue * 10 is selected. Since each sequence may have multiple alignment results, the LCA algorithm (applied to the systematic classification of MEGAN software (https: / / en.wikipedia.org / wiki / Lowest_common_ancestor)) is used to determine the species annotation information of the sequence. Starting from the LCA annotation results and gene abundance table, the abundance information and gene number table of each sample at each taxonomic level (kingdom, phylum, class, order, family, genus, species) are obtained. The abundance of a certain species in a certain sample is equal to the sum of the gene abundances annotated for that species. Starting from the abundance tables at each taxonomic level, Krona analysis is performed to display the relative abundance overview and the abundance clustering heatmap. Dimensionality reduction analysis is also performed using PCA (Rade4 package), PCoA (Rade4 package), and NMDS (R vegan package); Anosim analysis (R vegan package) is used. The analysis included: 1) Testing for differences between groups; 2) Using MetaGenomeSeq and LEfSe analyses to identify species with differential relationships between groups; 3) Using MetaGenomeSeq to perform hypothesis testing at each taxonomic level to obtain p-values ​​and Q-values; 4) Using LEfSe software (LDAScore default is 4); 5) Applying Random Forest (R pROC and randomForest packages, Version 2.15.3) to select species at the species level according to gradients to construct a random forest model. 6) Using MeanDecreaseAccuracy and MeanDecreaseGin to screen for important species, and then performing cross-validation (default 10-fold) on each model and plotting ROC curves.Functional annotation based on gene catalogues is achieved through the Kyoto Encyclopedia of Genes and Genomes (KEGG), the Evolutionary Genealogy of Genes: Non-supervised Orthologous Groups (eggNOG), and the Carbohydrate-Active Enzymes Database (CAZy).

[0281] 2.5 Statistical Analysis Data were analyzed using SPSS statistical software. One-way ANOVA was used for statistical analysis, and Tukey's test was employed to compare the significance of differences between treatment groups. The significance level was set at [value missing]. P < 0.05, while 0.05 ≤ P A value <0.10 is considered to indicate a significant trend. All data are expressed as mean ± standard error (SEM).

[0282] 3 Results and Analysis 3.1 Growth performance Ten days after pre-feeding, pigs were weighed on an empty stomach at the start of the formal experiment (37 days old; Table 9), nursery period (66 days old), early fattening period (96 days old), mid-fattening period (153 days old), and late fattening period (197 days old). Weights were recorded based on the data for each stage (Table 10), and growth curves were plotted. Figure 25 The growth curves of the pigs clearly show that the pigs fed with 400 ppm L-β-galactoglucan II in their feed exhibited significantly better growth performance than the other two groups after 30 days of feeding.

[0283]

[0284] Table 10 Growth performance of pigs during the nursery-finishing period

[0285] 3.2 Apparent digestibility As shown in Table 11, compared with the control group and the 200 ppm supplementation group, the dietary supplementation of 400 ppm L-β-galactoglucan II significantly promoted the apparent digestibility of dry matter, crude fat, and crude protein in finishing pigs; compared with the control group, 200 ppm and 400 ppm L-β-galactoglucan II significantly promoted the apparent digestibility of energy and crude ash.

[0286] Table 11 Apparent intestinal digestibility of finishing pigs

[0287] 3.3 Gut microbial metagenomic analysis 3.3.1 Diversity analysis of the gut microbiota As shown in Table 12, 200 ppm L-β-galactoglucan II exhibited a species richness-enhancing effect, particularly at the phylum level (Chao1 index), where it was significant. P =0.030). No significant differences were observed between the Shannon and Simpson indices at the phylum, genus, or species level, indicating that the addition of L-β-galactoglucan II had a limited impact on uniformity.

[0288] Table 12 Analysis of intestinal microbial diversity in finishing pigs

[0290] 3.2 Statistical analysis of differences in species and function between groups The MetaGenomeSeq method was used to perform hypothesis testing on the abundance data of species or functions from different levels of species or functions to obtain p-values. After correcting the p-values, q-values ​​were obtained. Finally, based on the q-values, species or functions with significant differences were selected, and box plots of the abundance distribution of different species or functions between groups were drawn.

[0291] The results showed that 400 ppm L-β-galactoglucan II significantly promoted the abundance of Candidatus_Defermicrobacteria at the phylum level compared to the control group. Candidatus_Defermicrobacteria is a provisional classification of uncultured bacteria in the phylum Deferribacteres, which is classified as iron-deferring bacteria. Previous reports have indicated that iron-deferring bacteria possess unique metabolic pathways, including the reversible tricarboxylic acid cycle for CO2 fixation. The results of this study suggest that this phylum has a high metabolic demand for or utilization capacity for glycans.

[0292] The results showed that 400 ppm L-β-galactoglucan II promoted the expression of various bacterial genera, especially cellulolytic bacteria (such as Tuberibacillus and Singulisphaera) and lactic acid metabolism-related bacteria (such as Naumovozyma). 200 ppm L-β-galactoglucan II had a certain promoting effect on some bacterial genera (such as Pararhodospirillum), but the overall effect was weaker than that of 400 ppm. The control group was significantly lacking in certain functional bacterial genera (such as cellulolytic bacteria and lactic acid metabolism bacteria), indicating that the glycan had a significant stimulatory effect on these genera (see Table 13 for details).

[0293] Table 13 Effects of L-β-galactoglucan II on gut microbiota

[0294] Compared to the control group, 400 ppm L-β-galactoglucan II significantly promoted the growth of fiber-degrading bacteria (such as *Paenibacillus silvisoli*) and methanogenic bacteria (such as *Methanobrevibacter wolinii*), enhancing intestinal fiber degradation and energy metabolism. The increase in methanogenic bacteria was associated with improved anaerobic digestion, potentially optimizing feed energy production. Increased abundance of many uncultured bacteria (such as *candidate division WS6 bacterium*) suggests that L-β-galactoglucan II may stimulate the activity of previously unknown functional gut flora. 200 ppm L-β-galactoglucan II significantly promoted the growth of some bacterial species (such as *Terasakiella pusilla* and uncultured bacterium contig00077), but the overall effect was weaker than that of 400 ppm (see Table 14). The lower abundance of most functional bacterial species indicates that the addition of L-β-galactoglucan II has a significant regulatory effect on the gut microbiota.

[0295] Table 14 Effects of L-β-galactoglucan II on gut microbiota

[0296] 3.3.3 KEGG functional protein annotation KEGG annotation of gut microbiota reveals the functional characteristics and metabolic potential of microbial communities by comparing microbial genes or metabolic pathways with reference information in the KEGG database.

[0297] The results showed that 400 ppm L-β-galactoglucan II significantly increased the relative abundance of Solabioose phosphorylase (K25919), V-type H+-transporting ATPase 16kDa proteolipid subunit (K02155), and the two-component system, while decreasing the relative abundance of sporulation sensor kinase A (K02491). Solabioose phosphorylase is an enzyme involved in oligosaccharide degradation and sugar metabolism, participating in carbohydrate degradation and utilization. It may influence host energy metabolism and gut health by providing fermentable sugar substrates and promoting the production of short-chain fatty acids (SCFAs). The V-type H+-transporting ATPase 16kDa proteolipid subunit encodes an important subunit of a V-type proton-transporting ATPase, closely related to energy metabolism and pH balance regulation. The two-component system, sporulation sensor kinase A, encodes a sensory kinase of a signal transduction system, associated with bacterial sporulation, environmental sensing, and adaptation. Spore formation is a stress response of bacteria to adverse environmental conditions (such as nutrient deficiency and high temperature), enabling bacteria to form dormant, stress-resistant spores. Therefore, 400 ppm L-β-galactoglucan II enhances fiber degradation capacity and may promote the growth of beneficial bacteria by enhancing the regulation of energy metabolism and acid-base balance.

[0298] 3.3.4 EggNOG Functional Protein Annotation eggNOG analysis is a homologous gene-based functional annotation method used to predict the function of proteins or genes and classify them into specific functional categories or metabolic pathways. Table 15. EggNOG analysis of gut microbiota

[0300] Compared to the control group, 400 ppm L-β-galactoglucan II significantly increased the relative abundance of Essential cell division protein that coo, Nitrogen-fixing NifU domain protein, and Glucosamine-6-phosphate deaminase, while significantly decreasing the relative abundance of RpoS and Purine nucleoside phosphorylase (DeoD-type). 200 ppm L-β-galactoglucan II significantly increased the relative abundance of Glucosamine-6-phosphate deaminase, Bacterial toxin homologue of phage lysozyme, C-term, and ER retention sequence binding. Essential cell division protein that coo is an essential cell division protein that may be involved in key steps related to cell division (such as the formation of the dividing septum). RpoS is a σ factor of RNA polymerase, associated with environmental stress responses, and is typically activated when the bacterial community faces adverse conditions. Glucosamine-6-phosphate deaminase participates in the metabolism of amino sugars (such as glucosamine) and is an important enzyme in the degradation of glycosaminoglycans. Bacterial toxin homologue of phage lysozyme, C-term, is a bacterial toxin that may have bacteriolytic activity, used to inhibit competing bacterial populations or defend against viral infections. Purine nucleoside phosphorylase (DeoD-type) is a purine nucleoside phosphorylase that participates in the catabolism of purine nucleosides, recovering bases for nucleic acid synthesis. Nitrogen-fixing NifU domain protein is a nitrogen-fixing-related protein that may be involved in the assembly of iron-sulfur clusters or nitrogen metabolism. ER retention sequence binding may be involved in protein transport and quality control.

[0301] Therefore, 400 ppm L-β-galactoglucan II significantly enhanced key metabolic functions such as cell division, nutrient metabolism (e.g., amino sugar metabolism), and nitrogen cycling, while reducing the body's stress response pathways (e.g., RpoS σ factor). 200 ppm L-β-galactoglucan II significantly promoted metabolic pathways such as iron-sulfur cluster assembly and lysotoxin expression, indicating that 200 ppm L-β-galactoglucan II had an ecologically optimizing effect on the bacterial community, while 400 ppm focused more on specific functions.

[0302] 4. Summary Results from a whole-herd feeding trial in pigs showed that, compared to the negative control group and the 200 ppm supplementation group, 400 ppm L-β-galactoglucan II significantly promoted the growth rate of the pigs throughout the entire feeding period, especially after two months of supplementation. Apparent digestibility results from finishing pigs indicated that the 400 ppm supplementation dose significantly promoted the optimal utilization of protein, fat, and minerals, resulting in faster growth and better production performance. Metagenomic data analysis showed that 400 ppm L-β-galactoglucan II increased fiber degradation and carbon metabolism while reducing the relative abundance of stress-related microorganisms. By improving the efficiency of host-microbiota interactions, it improved the ecological balance and metabolic function of the gut microbiota by providing the host with more energy and metabolic intermediates.

[0303] Effects Experiment 6: Study on the Effects of L-β-galactoglucan II Supplementation on Milk Composition and Growth of 21-Day-Old Piglets in Lactating Sows 1. Experimental design and diet composition A total of 56 Ningxiang sows and crossbred sows were randomly assigned to four groups according to the experimental factors and their levels, with 14 replicates per group. After farrowing, sows in each group were supplemented with 600 ppm, 400 ppm, 200 ppm, and 0 ppm of L-β-galactoglucan II, respectively, on top of their basal lactation feed (Table 16). The nutrient levels of the feed were consistent across all groups throughout gestation (Table 17). The health care and immunization programs for sows and piglets followed the farm's regulations. During the experiment, sows and piglets had free access to water.

[0304] Table 16 Experimental Groups

[0306]

[0307] 2. Sample collection and index determination 2.1 Determination of daily weight gain of 21-day-old piglets Record the total number of piglets at birth, the number of live piglets, and the initial litter weight at farrowing (Table 18); weigh each litter of piglets at 21 days of age, record individual weight data, and obtain daily weight gain data; due to the inconsistency of conditions in each group, the weaning age of piglets in each group is different, but the average weaning age of piglets in each group is 24 days.

[0308] Table 18 Grouping

[0309] 2.2 Milk sample collection and milk component analysis Milk was collected from the sow 12 hours after weaning. Immediately after collection, it was diluted with physiological saline at a ratio of 1:4 (5-fold dilution) to a total volume of 25 mL (sample milk), and then placed in a -20°C freezer for subsequent testing.

[0310] 2.3 Data Analysis All data were analyzed using SPSS statistical software. One-way ANOVA was used for statistical analysis, and Tukey's test was employed to compare the significance of differences between treatment groups. The significance level was set at [value missing]. P < 0.05, while 0.05 ≤ P A value <0.10 is considered to indicate a significant trend. All data are expressed as mean ± standard error (SEM).

[0311] 3 Results and Analysis 3.1 Effects of L-β-galactoglucan II on daily weight gain of piglets at 21 days of age Table 19 Effects of L-β-galactoglucan II on daily weight gain of 21-day-old piglets

[0312] As shown in Table 19, compared with the low concentration group, 600 ppm or 200 ppm of L-β-galactoglucan II significantly promoted the daily weight gain of 21-day-old piglets.

[0313] 3.3.2 Effects of L-β-galactoglucan II on sow milk composition Table 20 Milk Component Analysis

[0314] Analysis of sow milk components (Table 20) showed that 200 ppm L-β-galactoglucan II significantly increased milk fat content without negatively impacting other milk components. 600 or 400 ppm L-β-galactoglucan II did not significantly promote milk fat production but significantly reduced urea nitrogen levels in milk, possibly indicating that high concentrations of L-β-galactoglucan II altered metabolic regulation in sows.

[0315] 4. Summary Analysis of the combined results of daily weight gain of piglets and composition of sow's milk indicates that 200 ppm L-β-galactoglucan II is the optimal dosage for sows. This concentration can promote piglet growth by increasing milk fat content and milk energy density.

[0316] Effect Trial 7: Enhanced Immune Function 1. Testing materials 1.1 Sample Preparation Information L-β-galactoglucan II, with standard dilution water as the solvent.

[0317] Positive control: Broken-cell wall Ganoderma lucidum spore powder, batch number 2112001, Jinri Pharmaceutical (China) Co., Ltd., solvent is standard dilution water.

[0318] 1.2 Laboratory Animals Zebrafish were raised in aquarium water at 28 ℃ (water quality: 200 mg of readily soluble sea salt added per 1 L of reverse osmosis water, conductivity 450~550 μS / cm; pH 6.5~8.5; hardness 50~100 mg / L CaCO3), bred and provided by our aquarium. The laboratory animal use license number is: SYXK (Zhejiang) 2022-0004. The husbandry and management met the requirements of international AAALAC certification (certification number: 001458), and the IACUC ethics review number is: IACUC-2024-9143-01.

[0319] 1.3 Instruments, Consumables and Reagents Dissecting microscope (SZX7, OLYMPUS, Japan); CCD camera (VertA1, Shanghai Tusen Vision Technology Co., Ltd., China); Precision electronic balance (CP214, OHAUS, USA); Motorized focusing continuous zoom fluorescence microscope (AZ100, Nikon, Japan); Microinjection apparatus (IM-300, Narishige, Japan); Needle puller (PC-10, Narishige, Japan); 6-well plate (Zhejiang Beilanbo Biotechnology Co., Ltd., China); Ultrasonic cleaner (JP-010T, Shenzhen Jiemeng Cleaning Equipment Co., Ltd., China).

[0320] Vinorelbine tartrate injection (batch number 190401, Jiangsu Hansoh Pharmaceutical Co., Ltd., China); Sodium chloride injection (batch number S21091609, Hunan Kelun Pharmaceutical Co., Ltd., China); Methylcellulose (batch number C2004046, Shanghai Aladdin Biochemical Technology Co., Ltd., China).

[0321] 2. Detection Method 2.1 Evaluation of enhanced immune efficacy (fluorescence intensity of tail vein macrophages) 30 zebrafish with 3 dpf transgenic macrophages and green fluorescent fluorescence were randomly selected and placed in 6-well plates, with each well containing 30 zebrafish. Samples (concentrations shown in Table 21) were administered via water-soluble administration, including a positive control of 15.0 μg / mL Bailin capsules and 125 μg / mL Ganoderma lucidum spore powder. A normal control group and a model control group were also included, with each well containing 3 mL. Except for the normal control group, all experimental groups received intravenous injection of vinorelbine tartrate injection to induce an immunodeficiency model. After treatment at 28℃ for 2 days, 10 zebrafish from each experimental group were randomly selected and photographed under a fluorescence microscope. Data were analyzed and collected using NIS-Elements D 3.20 advanced image processing software. The fluorescence intensity of macrophages in the zebrafish tail vein was analyzed, and the statistical analysis results of this index (tail vein macrophage fluorescence intensity) were used to evaluate the immune-enhancing efficacy of the samples. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS software, with p < 0.05 indicating statistical significance.

[0322] 3. Test Results 3.1 Evaluation of enhanced immune efficacy (fluorescence intensity of tail vein macrophages) Under the conditions of this experiment, L-β-galactoglucan II exhibited immune-enhancing effects, specifically by increasing the number of macrophages. See Table 21 for details.

[0323] Table 21 Evaluation of the immune-enhancing efficacy of the samples (fluorescence intensity of tail vein macrophages) Experimental results (n = 10)

[0324] Compared with the model control group, *p < 0.05, **p < 0.01, ***p < 0.001 Effects Trial 8: Anti-aging Efficacy 1. Testing materials 1.1 Sample Preparation Information L-β-galactoglucan II, with standard dilution water as the solvent.

[0325] Positive control: Resveratrol, white powder, batch number F2121344, Shanghai Aladdin Biochemical Technology Co., Ltd., solvent is DMSO.

[0326] 1.2 Laboratory Animals Zebrafish were raised in aquarium water at 28℃ (water quality: 200 mg of instant sea salt added per 1 L of reverse osmosis water, conductivity 450~550 μS / cm; pH 6.5~8.5; hardness 50~100 mg / L CaCO3), bred and provided by our company's aquarium. The laboratory animal use license number is: SYXK (Zhejiang) 2022-0004. The husbandry and management met the requirements of international AAALAC certification (certification number: 001458), and the IACUC ethics review number is: IACUC-2024-9143-01.

[0327] 1.3 Instruments, Consumables and Reagents Dissecting microscope (SZX7, OLYMPUS, Japan); Precision electronic balance (CP214, OHAUS, USA); CCD camera (VertA1, Shanghai Tusen Vision Technology Co., Ltd., China); 6-well plate (Zhejiang Belamber Biotechnology Co., Ltd., China); Ultrasonic cleaner (JP-010T, Shenzhen Jiemeng Cleaning Equipment Co., Ltd., China); Multifunctional microplate reader (SPARK, TECAN, Austria); High-speed refrigerated centrifuge (Heraeus Fresco17, Thermo Fisher, Germany); Fully automated rapid sample grinder (JXFSTPRP-24L, Shanghai Jingxin Experimental Equipment Technology Department, China); 96-well plate (NestBiotech, China).

[0328] Dimethyl sulfoxide (DMSO, batch number I2229063, Shanghai Aladdin Biochemical Technology Co., Ltd., China); Methylcellulose (batch number C2004046, Shanghai Aladdin Biochemical Technology Co., Ltd., China); Hydrogen peroxide solution (batch number G2023089, Shanghai Aladdin Biochemical Technology Co., Ltd., China); 4% tissue cell fixative (batch number 240001001, Beijing Solarbio Science & Technology Co., Ltd., China); Cell senescence β-galactosidase staining kit (batch number 113023240430, Shanghai Beyotime Biotechnology Co., Ltd., China); Zebrafish TE Elisa Kit (batch number H24Y04, Shanghai Hengyuan Biotechnology Co., Ltd., China); BCA protein concentration assay kit (batch number 19C29C89, Wuhan Boster Biological Engineering Co., Ltd., China); SOD kit (WST-1 method) (batch number 20240520, Nanjing Jiancheng Biotechnology Research Institute); Sodium chloride injection (batch number S21091609, Hunan Kelun Pharmaceutical Co., Ltd., China).

[0329] 2. Detection Method 2.1 Anti-aging effects (β-galactosidase activity) Wild-type AB strain zebrafish, 6 hours post-fertilization (6 hpf), were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well. The samples were administered in water (concentrations shown in Table 22). A positive control of resveratrol at a concentration of 10.0 μg / mL was used. Normal and model control groups were also included, with a volume of 3 mL per well. Except for the normal control group, all other groups were given hydrogen peroxide in water to establish a zebrafish aging model, with the medium changed daily. After 6 days of treatment at 28℃, the zebrafish in each experimental group were stained using a cellular senescence β-galactosidase staining kit. After staining, 10 zebrafish from each experimental group were randomly selected and photographed under a dissecting microscope. Data were collected using NIS-Elements D 3.20 advanced image processing software, and the staining intensity of β-galactosidase in the zebrafish was analyzed. The statistical analysis results of this index were used to evaluate the anti-aging efficacy of the samples (β-galactosidase activity). Statistical results are expressed as mean ± SE. Statistical analysis using SPSS software showed that p < 0.05 was statistically significant.

[0330] 2.2 Anti-aging effects (SOD vitality) Six hpf wild-type AB strain zebrafish were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well. Samples were administered via water-soluble solution (concentrations shown in Table 23). A positive control of resveratrol at a concentration of 10.0 μg / mL was used. A normal control group and a model control group were also included. Each well contained 3 mL of resveratrol. The experiment was repeated in triplicate. Except for the normal control group, all other groups were administered hydrogen peroxide via water-soluble solution to establish a zebrafish aging model. The medium was changed daily during the treatment. After 6 days of treatment at 28℃, zebrafish samples were collected from each experimental group according to the SOD assay kit instructions. SOD activity in the zebrafish was detected using a multi-mode microplate reader. The SOD activity of each experimental group was analyzed, and the statistical analysis results of this index were used to evaluate the anti-aging efficacy (SOD activity). Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS software. p < 0.05 indicated statistical significance.

[0331] 2.3 Anti-aging effects (telomerase activity) Six hpf wild-type AB strain zebrafish were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well. Samples were administered via water-soluble solution (concentrations shown in Table 24). A positive control of resveratrol at a concentration of 10.0 μg / mL was used. A normal control group and a model control group were also included. Each well contained 3 mL of resveratrol. The experiment was repeated in triplicate. Except for the normal control group, all other groups were administered hydrogen peroxide via water-soluble solution to establish a zebrafish aging model, with the medium changed daily. After 6 days of treatment at 28℃, zebrafish samples were collected according to the Zebrafish TE Elisa Kit instructions. Data were collected using a multi-functional microplate reader, and telomerase activity in the zebrafish of each experimental group was analyzed. Statistical analysis of this indicator (telomerase activity) was used to evaluate the anti-aging efficacy of the samples. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS software; p < 0.05 indicated statistical significance.

[0332] 3. Test Results 3.1 Anti-aging effects (β-galactosidase activity) Under the conditions of this experiment, L-β-galactoglucan II exhibits anti-aging effects, specifically by inhibiting β-galactosidase activity. See Table 22 for details.

[0333] Table 22. Experimental results of anti-aging efficacy (β-galactosidase activity) of the samples (n = 10)

[0334] Compared with the model control group, **p < 0.01, ***p < 0.001 3.2 Anti-aging effects (SOD vitality) Under the experimental conditions, L-β-galactoglucan II exhibited the effect of increasing SOD activity. See Table 23 for details.

[0335] Table 23. Experimental results of anti-aging efficacy (SOD activity) of samples (n = 3)

[0336] Compared with the model control group, *p < 0.05, **p < 0.01, ***p < 0.001 3.3 Anti-aging effects (telomerase activity) Under the experimental conditions, L-β-galactoglucan II exhibited the effect of increasing telomerase activity. See Table 24 for details.

[0337] Table 24. Experimental results of anti-aging efficacy (telomerase activity) of samples (n=3)

[0338] Compared with the model control group, **p < 0.01, ***p < 0.001 Example 5 Preparation of L-β-galactoglucan II with different molecular weights (high molecular weight) All other steps are the same as in Example 3, except that the purification process uses the following scheme: The fermentation broth was treated using the sevage method, and the aqueous phase was spray-dried to obtain L-β-galactoglucan II.

[0339] The weight-average molecular weight of the obtained L-β-galactoglucan II was approximately 6.5 × 10⁻⁶, as determined by the method in Example 4. 5 Da.

[0340] Example 6 Preparation of L-β-galactoglucan II with different molecular weights (high molecular weight) All other steps are the same as in Example 3, except that the purification process uses the following scheme: The pH of the fermentation broth was adjusted to 5±0.2, and L-β-galactoglucan II was obtained by heating, filtering, ultrafiltration concentration, and spray drying.

[0341] The weight-average molecular weight of the obtained L-β-galactoglucan II was approximately 6.5 × 10⁻⁶, as determined by the method in Example 4. 5 Da.

[0342] Example 7 Preparation of L-β-galactoglucan II with different molecular weights (low molecular weight) All other steps are the same as in Example 3, except that the purification process uses the following scheme: The pH of the fermentation broth was adjusted to 1±0.2 with hydrochloric acid, then heated, neutralized to 4±0.2 with sodium hydroxide solution, filtered, concentrated by ultrafiltration, and spray-dried to obtain L-β-galactoglucan II.

[0343] The weight-average molecular weight of the obtained L-β-galactoglucan II was approximately 1.0 × 10⁻⁶, as determined by the method in Example 4. 5 Da.

[0344] Effect Experiment 9: Cellular Inflammation Experiment 1. Experimental Basis The experiment was conducted in accordance with the " Cydonia oblonga The study was designed based on the results of Mill. Pulp Callus Inhibits Oxidative Stress and Inflammation in Injured Cells.

[0345] 2. Experimental Objective and Principle 2.1 Experimental Objective The soothing efficacy of the sample was investigated by detecting the relative expression of the inflammatory cytokine IL-6 gene in HaCaT cells after LPS treatment.

[0346] 2.2 Experimental Principle Human immortalized epidermal keratinocytes (HaCaT cells) secrete a large number of inflammatory factors in response to external stimuli, thus responding to the inflammatory response. Lipopolysaccharide (LPS) is an endotoxin that can stimulate cells and induce inflammatory responses. During the inflammatory response, cells can release inflammatory factors such as IL-6, exacerbating the inflammation. By detecting and comparing the relative expression of the inflammatory factor IL-6 gene in HaCaT cells treated with LPS in the model group and the sample group, the anti-inflammatory effect of the samples can be evaluated, thereby exploring the soothing efficacy of the samples.

[0347] 3. Test Materials 3.1 Cells used in experiments Human immortalized epidermal keratinocyte line HaCaT.

[0348] 3.2 Main Instruments and Reagents 3.2.1 Main Test Instruments Carbon dioxide incubator (Thermo Fisher), biosafety cabinet (Telstar Bio II Advance), low-temperature high-speed centrifuge (Beckman), and real-time PCR instrument (Roche LC96).

[0349] 3.2.2 Main test reagents DMEM medium (HyClone, GE Healthcare, US), trypsin (Sigma), fetal bovine serum (FBS, Gibco, US), antibiotics (Sigma), TRIzol (Thermo Fisher).

[0350] 4. Test Methods 4.1 Grouping and Control Reference information: Blank control group: DMEM culture medium; Model control group: DMEM medium + LPS (500 ng / mL); Positive control group: DMEM medium + LPS (500 ng / mL) + dexamethasone (1 μM) Sample grouping: DMEM medium + LPS (500 ng / mL) + 25 μg / mL _SDK_A DMEM medium + LPS (500 ng / mL) + 50 μg / mL _SDK_A DMEM medium + LPS (500 ng / mL) + 100 μg / mL _SDK_A DMEM medium + LPS (500 ng / mL) + 25 μg / mL _SDK_B DMEM medium + LPS (500 ng / mL) + 50 μg / mL _SDK_B DMEM medium + LPS (500 ng / mL) + 100 μg / mL _SDK_B DMEM medium + LPS (500 ng / mL) + 25 μg / mL SDK C DMEM medium + LPS (500 ng / mL) + 50 μg / mL SDK C DMEM medium + LPS (500 ng / mL) + 100 μg / mL SDK C.

[0351] Among them, SDK_A is L-β-galactoglucan II prepared in Example 5, with a molecular weight of approximately 650,000 Da; SDK_B is L-β-galactoglucan II prepared in Example 3, with a molecular weight of approximately 440,000 Da; and SDK_C is L-β-galactoglucan II prepared in Example 7, with a molecular weight of approximately 100,000 Da.

[0352] 4.2 Main operating steps 4.2.1 Cell Culture and LPS Induction The immortalized human epidermal keratinocyte cell line HaCaT was cultured in DMEM containing 10% fetal bovine serum at 37°C in a 5% CO2 cell culture incubator, and passaged every 3 days. HaCaT cell suspensions in logarithmic growth phase were seeded into 6-well plates and cultured at 37°C for 24 h in a CO2 incubator. LPS and the corresponding sample or dexamethasone were added to the adherent cells in the 6-well plates according to the grouping information in section 4.1. Culture was continued at 37°C for 12 h.

[0353] 4.2.2 Cellular RNA Extraction and Reverse Transcription The main steps for extracting RNA from cells using TRIzol are as follows: (1) Remove the culture medium and wash once with 1 mL of pre-cooled PBS; (2) Add 1 mL of TRIzol to each well of a six-well plate, mix thoroughly by pipetting until transparent, transfer to a 1.5 mL centrifuge tube, and let stand on ice for 5 min; (3) Add 0.2 mL of chloroform, vortex to mix for 10 s, and let stand on ice for 5 min; (4) Centrifuge at 4°C and 12,000 rpm for 10 min, and transfer the upper aqueous phase RNA to a new centrifuge tube; (5) Add an equal volume of isopropanol, gently invert 5 times, and let stand on ice for 10 min; (6) Centrifuge at 4°C and 12,000 rpm for 10 min, and discard the supernatant; (7) Wash twice with 75% ethanol before cooling, centrifuge at 8000 rpm for 5 min at 4℃, and discard the supernatant; (8) Add 30 μL of enzyme-free water and mix well.

[0354] The main steps for reverse transcription using the Novizan reverse transcription kit are as follows: (1) Reaction system: Table 25

[0355] (2) Reaction conditions: 37 ℃ for 15 min + 85 ℃ for 5 s 4.2.3 qPCR (1) Primer information: 18S_F:CTTAGTTGGTGGAGCGATTT 18S_R:GCTGAACGCCACTTGTCC IL6_F:TACCCCCAGGAGAAGATTCC IL6_R: TTTTCTGCCAGTGCCTCTTT (2) Reaction system: Table 26

[0356] (3) Reaction procedure: Table 27

[0357] (4) Data processing: Use 2 -△△Ct The method is used to calculate relative gene expression levels. (Using...) t -test to detect significant differences.

[0358] 4.3 Judgment Criteria Table 28

[0359] 5. Test Results The effects of different concentrations of the analyte on the expression level of the inflammatory cytokine IL-6 gene in HaCaT cells are shown in Table 29. After LPS treatment, the relative expression level of IL-6 gene in the model control group cells was 1.63 ± 0.09 ~ 1.73 ± 0.16, with a relative upregulation of 63-73% (…).p <0.01 indicates that the IL-6 inflammation model was successfully constructed (data shows significant difference). Compared with the model control group, the relative expression level of IL-6 gene in the positive control group was 0.43 ± 0.06 ~ 0.64 ± 0.12, which was significantly decreased ( p <0.01), indicating that the positive control group data is valid.

[0360] Under the same conditions, the relative expression levels of IL-6 gene in cells treated with 25 μg / mL, 50 μg / mL, and 100 μg / mL SDK_A for 12 h were 0.75 ± 0.06, 0.94 ± 0.03, and 0.91 ± 0.04, respectively, which were downregulated by 57% (p<0.01), 46% (p<0.01), and 47% (p<0.01) compared with the model control group. This indicates that 25 μg / mL, 50 μg / mL, and 100 μg / mL SDK_A all have the effect of inhibiting IL-6 gene expression (the data show significant differences) and have a soothing effect under these experimental conditions.

[0361] Under the same conditions, after treatment with 50 μg / mL SDK_B (high molecular weight) for 12 h, the relative expression level of IL-6 gene in cells was 0.94 ± 0.17, which was downregulated by 42% compared with the model control group. p The value <0.01 indicates that 50 μg / mL SDK_B has the effect of inhibiting IL-6 gene expression (the data shows a significant difference) and has a soothing effect under these experimental conditions.

[0362] Under the same conditions, after treatment with 25 μg / mL, 50 μg / mL, and 100 μg / mL SDK_C (low molecular weight) for 12 h, the relative expression levels of IL-6 gene in cells were 0.29 ± 0.05, 0.72 ± 0.02, and 0.69 ± 0.04, respectively, which were downregulated by 83% compared with the model control group. p <0.01), 58% p <0.01) and 60% ( p <0.01), indicating that 25 μg / mL, 50 μg / mL and 100 μg / mL SDK_C all inhibited IL-6 gene expression (data showed significant differences), and had a soothing effect under these experimental conditions.

[0363] Table 29 Effects of SDK on the relative expression level of IL-6 gene in HaCaT cells

[0364] 6. Conclusion Treatment of HaCaT cells with 25 μg / mL, 50 μg / mL, and 100 μg / mL SDK_A (L-β-galactoglucan II, approximately 650,000 Da) for 12 h resulted in a 57% (p<0.01), 46% (p<0.01), and 47% (p<0.01) decrease in the relative expression of the IL-6 gene, respectively. This indicates that 25 μg / mL, 50 μg / mL, and 100 μg / mL SDK_A all significantly inhibited IL-6 gene expression.

[0365] After treatment with 50 μg / mL SDK_B (L-β-galactoglucan II, approximately 440,000 Da) for 12 h, the relative expression level of the IL-6 gene in cells was 0.94 ± 0.17, representing a 42% downregulation. p The value <0.01 indicates that 50 μg / mL SDK_B has a significant inhibitory effect on IL-6 gene expression.

[0366] After treatment with 25 μg / mL, 50 μg / mL, and 100 μg / mL SDK_C (L-β-galactoglucan II, approximately 100,000 Da) for 12 h, the relative expression levels of the IL-6 gene in cells were 0.29 ± 0.05, 0.72 ± 0.02, and 0.69 ± 0.04, respectively, with a relative downregulation of 83% ( ). p <0.01), 58% p <0.01) and 60% ( p <0.01), indicating that 25 μg / mL, 50 μg / mL and 100 μg / mL SDK_C all have a significant inhibitory effect on IL-6 gene expression.

Claims

1. An L-β-galactoglucan II, the repeating structural units of its main chain are shown below. 。 2. The L-β-galactoglucan II according to claim 1, characterized in that, The average molecular weight is not less than 100,000 Da.

3. The L-β-galactoglucan II according to claim 1, characterized in that, The weight-average molecular weight is approximately (6.5 ± 0.1) × 10⁻⁶. 5 Da, 4×10 5 Da~4.5×10 5 Da, or (1±0.1)×10 5 Da.

4. The L-β-galactoglucan II according to claim 1, characterized in that, In the infrared spectrum, at least at 3324 cm⁻¹ -1 2890cm -1 1630cm -1 1370cm -1 1020 cm -1 893cm -1 There is a characteristic peak at this location.

5. A fermentation broth containing L-β-galactoglucan II as described in claim 1, characterized in that, Its preparation method includes the following: Agrobacterium FN01 was inoculated into the fermentation broth and fermented to obtain a fermentation broth containing L-β-galactoglucan II; The fermentation broth comprises: a carbon source selected from one or more combinations of sorbitol, mannitol, and glycerol; a nitrogen source selected from one or more combinations of ammonia, yeast powder, and nitrate; inorganic salts; an antifoaming agent; and water; with a pH of 6.6–7.

2.

6. The fermentation broth according to claim 5, characterized in that, The inorganic salt is selected from phosphates, dihydrogen phosphates, dihydrogen phosphates, and sulfates.

7. A crude polysaccharide containing L-β-galactoglucan II as described in claim 1, characterized in that, Its preparation method includes the following: (1) Take the fermentation broth as described in claim 5; (2) The fermentation broth was spray-dried to obtain crude polysaccharide containing L-β-galactoglucan II.

8. The method for preparing L-β-galactoglucan II according to claim 1, characterized in that, Includes the following: (1) Take the fermentation broth as described in claim 4; (2) Add hydrochloric acid or sodium hydroxide to the fermentation broth, and obtain L-β-galactoglucan II by heating, filtering and spray drying; or, treat the fermentation broth by the sevage method, and take the aqueous phase by spray drying to obtain L-β-galactoglucan II.

9. The use of L-β-galactoglucan II as described in claim 1, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II in the preparation of products that repair the intestinal barrier and / or regulate intestinal water and salt balance and / or regulate intestinal flora.

10. The application according to claim 9, characterized in that, The product is for the treatment and / or prevention of constipation.

11. The use of the L-β-galactoglucan II of claim 1, fermentation broth containing L-β-galactoglucan II, or crude polysaccharide containing L-β-galactoglucan II in the preparation of one of the following products: (1) Treatment and / or prevention of rhinitis; (2) Treatment and / or prevention of ulcers; (3) Relieves mucosal damage and / or repairs damaged mucosa; (4) Promotes the growth of farmed animals; (5) Improve the composition of breast milk in livestock; (6) Improves the balance of intestinal microbiota in animals and promotes digestive function in animals; (7) Enhance non-specific immune function; (8) Anti-aging; (9) Anti-inflammatory.

12. The use according to claim 11, characterized in that, The product for treating and / or preventing rhinitis is a product that has the effects of improving nasal inflammation, and / or reducing inflammatory cell infiltration, and / or repairing damaged nasal mucosa.

13. The use according to claim 11, characterized in that, The products mentioned for treating and / or preventing ulcers refer to products that include treatment and / or prevention of oral ulcers.

14. The use according to claim 11, characterized in that, The product for treating and / or preventing oral ulcers is one that includes relieving oral mucosal damage, and / or repairing damaged oral mucosa, and / or improving oral inflammation.

15. The use according to claim 11, characterized in that, In products that alleviate mucosal damage or / and repair damaged mucosa, the mucosa includes oral mucosa, nasal mucosa, gastric mucosa, and intestinal mucosa.

16. The use according to claim 11, characterized in that, Promoting the growth of domesticated animals refers to promoting the growth of domesticated animals of different ages.

17. The use according to claim 11, characterized in that, The term "raised animals" refers to the raising of young animals.

18. The use according to claim 11, characterized in that, The animals being raised are selected from livestock and pets; the livestock include pigs, cattle, and sheep; the pets include dogs and cats.

19. The use according to claim 11, characterized in that, Improving the composition of breast milk in livestock refers to increasing the fat content in sow's milk and / or reducing urea nitrogen in breast milk.

20. The use according to claim 11, characterized in that, Products that improve the balance of gut microbiota in animals and promote their digestive function, wherein the animal refers to a human or a domesticated animal.

21. The use according to claim 11, characterized in that, The enhancement of non-specific immune function refers to increasing the number of immune cells and / or regulating the function of immune cells.

22. The use according to claim 11, characterized in that, The enhancement of non-specific immune function refers to increasing the number of macrophages.

23. The use according to claim 11, characterized in that, The anti-aging effect refers to inhibiting β-galactosidase activity, increasing SOD activity, and / or increasing telomerase activity.

24. The use according to claim 11, characterized in that, The anti-inflammatory effect refers to the treatment and / or prevention of inflammation caused by lipopolysaccharide.

25. The use according to claim 11, characterized in that, The term "anti-inflammatory" refers to reducing the abnormal expression of inflammatory factors.

26. The use according to claim 26, characterized in that, The inflammatory factors were selected from pro-inflammatory interleukins.

Citation Information

Patent Citations

  • Mulberry phellinus igniarius sporocarp mannogalactan as well as preparation and application thereof

    CN114591448A

  • Beta-D-galactoglucan as well as preparation and application thereof

    CN115947876A

  • L-beta-galactoglucan produced by agrobacterium as well as preparation method and application of L-beta-galactoglucan

    CN118791642A

  • Application of L-beta-galactoglucan in veterinary use

    CN118805850A

  • L-beta-galactoglucan produced by agrobacterium as well as preparation method and application of L-beta-galactoglucan

    CN118845817A