Staphylococcus albus capable of highly degrading nitrite and application of staphylococcus albus

By using fish fermentation Staphylococcus piscifermentans XUCSB 029, the problem of incomplete nitrite degradation in the existing technology is solved, and the efficient degradation of nitrite in meat products and the improvement of flavor are achieved.

CN120843341AActive Publication Date: 2025-10-28HEFEI UNIV OF TECH
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510981428.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2025-10-28
Estimated Expiration
2045-07-16

AI Technical Summary

Technical Problem

In the existing technology, the ability of fish fermentation Staphylococcus aureus to degrade nitrite still has room for improvement, especially in significantly reducing the residual nitrite while maintaining the color and flavor of meat products.

Method used

A fish fermentation Staphylococcus piscifermentans XUCSB 029 with high nitrite degradation ability was used. By adding the strain and its fermentation supernatant or lysate during the meat fermentation process, the nitrate reduction ability and protein and fat hydrolysis ability of the strain were utilized to form high-quality fermented meat products.

Benefits of technology

Significantly reduce the residual nitrite in meat products, improve the redness value and flavor complexity of fermented meat, and meet safety and sensory characteristics requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843341A_ABST
    Figure CN120843341A_ABST
Patent Text Reader

Abstract

The invention discloses staphylococcus albus capable of highly degrading nitrite and application of the staphylococcus albus, and belongs to the technical field of microorganism application and meat product processing. The staphylococcus fish fermenti is staphylococcus fish fermenti XUCSB 029, and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation date is June 24, 2025, and the preservation number of the strain is CGMCC No.34992. The staphylococcus fish fermenti has the advantages that the staphylococcus fish fermenti is high in yield and high in safety; the fish fermentation staphylococcus sp. XUCSB 029 strain disclosed by the invention has the beneficial effects that the fish fermentation staphylococcus sp. XUCSB 029 strain has the capability of degrading nitrite in fermented meat, is good in fermentation characteristic, generates flavor substances containing aldehydes, ketones, alcohols, esters, acids and other types, has relatively high safety characteristic, and has excellent fermentation capability and fermentation aroma production capability when the fermented meat is inoculated, so that the fish fermentation staphylococcus sp. XUCSB 029 strain can be used for degrading the nitrite in the fermented meat, and the fish fermentation staphylococcus sp. XUCSB 029 strain can be used for producing the flavor substances containing the aldehydes, the ketones, the alcohols, the esters, the acids and the other flavor substances. And strain resources are provided for producing fermented meat products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial application and meat processing technology, specifically relating to a fish fermentation Staphylococcus strain with high nitrite degradation and its application. Background Technology

[0002] In meat processing, nitrites serve multiple functions, including color development, antibacterial activity, preservation, antioxidant properties, and the ability to impart a cured meat flavor. Common forms of nitrites include sodium nitrite and potassium nitrite. As a preservative, nitrites prevent meat spoilage by inhibiting lipid oxidation. As an antibacterial agent, nitrites enhance the safety of meat and meat products by inhibiting the growth of microorganisms, particularly Clostridium botulinum. As a color-developing agent, the nitric oxide (NO) produced by the reduction of sodium nitrite combines with myoglobin in the presence of deoxymyoglobin to form pink nitrosomyoglobin, a stable red pigment. Consumers generally prefer meat with added nitrites and rate them higher in terms of color acceptability, flavor, and texture. However, unreacted nitrites can remain in meat. Nitrites are classified as Group 2A carcinogens, described as non-carcinogenic or having limited carcinogenic potential. Nitrites in meat can react with secondary amines to form N-nitroso compounds, which are carcinogenic and teratogenic, and closely associated with brain tumors and gastrointestinal cancers. A directive from the European Parliament and the Council has limited the amount of sodium nitrite added to processed meats to 150 mg / kg, with residue levels required to be below 100 mg / kg. The Joint FAO / WHO Expert Committee on Food Additives (JECFA) has set the acceptable daily intake (ADI) of nitrite at 0.07 mg / kg body weight. According to my country's national food safety standard GB 2760-2014, the residue level of nitrite in fermented meat products must not exceed 30 mg / kg. Microorganisms, used as fermenting agents, can reduce the residue level of nitrite in fermented meat. For example, in sausage fermentation, nitrite-degrading microorganisms are typically lactic acid bacteria, nitrate-reducing Staphylococcus, and Micrococcus. In ham production, nitrite-degrading microorganisms typically include Staphylococcus and Micrococcus.

[0003] For traditional fermented meat products, selecting starter cultures from native microbiota can maintain sensory properties, shorten fermentation cycles, and ensure product safety. In fermented meat products, lactic acid bacteria (LAB) and coagulase-negative staphylococci (CNS) are the most active native microorganisms, primarily involved in fat decomposition and protein hydrolysis. Staphylococci have been found in various types of fermented foods, including fermented fish, soy sauce, fermented sausages, and traditional bacon. *Staphylococcus piscifermentans*, a non-pathogenic coagulase-negative staphylococci (CNS), is a Gram-positive bacterium with catalase-positive characteristics, protein decomposition, fat decomposition, nitrate reduction, and inhibition of harmful bacteria. Through the action of nitrate reductase, it generates nitrosomyoglobin, which promotes meat color formation and is one of the starter cultures for meat.

[0004] Patent application CN 117568241A discloses a strain of Staphylococcus aureus FSUJL109 with high nitrate reducing power. This patent describes the nitrite reducing capacity of FSUJL109, showing that after 12 hours of cultivation, the nitrite content in the fermentation broth reached a peak of 2332 μg / mL. The optimal concentration of FSUJL109 was 1.9 × 10⁻⁶. 7 The application of CFU / g in fermented meat products significantly enhances their bright red color and reduces their firmness and chewiness. The fermented meat products exhibit a more vibrant red color, with the a-value of *Staphylococcus aureus* FSUJL109 fermented meat products reaching 17.56±0.33, a 153.76% increase compared to the control group. This represents a 16.37% increase compared to the *Staphylococcus carinatum* ATCC 51365 group. However, the residual nitrite content after fermentation was relatively high at 27.21±3.63 mg / kg. Therefore, further research is needed to improve and enhance this effect. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to provide a fish-fermenting Staphylococcus aureus strain with high nitrite degradation and its application.

[0006] The present invention solves the above-mentioned technical problems through the following technical means:

[0007] The first aspect of the present invention provides a fish-fermenting Staphylococcus strain with a high degree of nitrite degradation, which has the accession number CGMCC No.34992.

[0008] The fish-fermenting Staphylococcus species is Staphylococcus piscifermentans XUCSB 029, which has been deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, with the accession number CGMCCNo.34992 and the classification name Staphylococcus piscifermentans.

[0009] Preferably, the 16S rDNA sequence of the fish fermenting Staphylococcus is shown in SEQ ID NO.1.

[0010] The second aspect of the present invention provides for any of the following applications of the above-mentioned fish-fermenting Staphylococcus aureus:

[0011] (1) Application in the degradation of nitrite;

[0012] (2) Application in the fermentation and preparation of meat products;

[0013] (3) Application in the preparation of meat fermentation inoculants;

[0014] (4) Application in the preparation of products that degrade nitrite.

[0015] A third aspect of the present invention provides a meat fermentation agent that degrades nitrite, the main components of which include one or more of the above-mentioned Staphylococcus aureus, the fermentation supernatant of Staphylococcus aureus, and the lysate of Staphylococcus aureus.

[0016] Preferably, the fermentation supernatant is obtained by culturing the fish-fermenting Staphylococcus aureus in a culture medium for a period of time and then centrifuging to remove the bacterial cells.

[0017] Preferably, the lysate is obtained by culturing the fish-fermenting Staphylococcus aureus in a culture medium for a period of time, followed by ultrasonic disruption and centrifugation to remove the bacterial cells.

[0018] The fourth aspect of the present invention provides a method for reducing the nitrite content in fermented meat products, comprising the following steps: adding the above-mentioned meat fermentation agent during the preparation of the fermented meat products, and then operating the rest according to normal process procedures.

[0019] Preferably, the meat includes, but is not limited to, pork, beef, mutton, or its heart, liver, lungs, kidneys, etc.

[0020] Preferably, the fermented meat products include, but are not limited to, cured meat, sausage, ham, etc.

[0021] Preferably, the main component of the meat fermentation agent is the aforementioned Staphylococcus aureus for fish fermentation, and the addition concentration is 0.5-1.5 × 10⁻⁶. 7 CFU / g.

[0022] Preferably, the method includes the following steps: mincing the meat into granules, then adding 0.5-1.5% glucose, 0.005-0.015% sodium nitrite, and 2-3% salt by weight; and adding Staphylococcus aureus XUCSB 029 to a concentration of 0.5-1.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 1.5-2.5 hours, stuff the mixture into sausages, and hang them in a pre-sterilized constant temperature and humidity chamber for fermentation, drying, and maturation. The procedure is as follows: air dry at 22-27℃ for 20-28 hours with a relative humidity of 40-50%; ferment at 22-27℃ for 2-4 days with a relative humidity of 70-80%; and dry and mature at 16-20℃ with a relative humidity of 60-70% for 10-15 days.

[0023] The beneficial effects of this invention are as follows:

[0024] 1. The *Staphylococcus piscifermentans* strain XUCSB 029 proposed in this invention, with accession number CGMCC NO:34992, exhibits excellent nitrite degradation ability and good fermentation characteristics. It possesses nitrate reduction ability, protein and fat hydrolysis ability, is catalase positive, does not hemolyze, does not produce mucus, produces acid but not gas, does not produce NH3, does not produce H2S, does not produce bio-amines, is resistant to NaCl (10% w / v), resistant to Na2NO2 (150 mg / L), resistant to acid (pH 4.5), and resistant to low temperatures (10℃).

[0025] 2. Breakthrough in nitrite degradation performance, enabling low-nitrite fermented meat products.

[0026] The *Staphylococcus piscifermentans* strain XUCSB 029 proposed in this invention has the ability to degrade nitrite in fermented meat. After 15 days of fermentation, the average nitrite residue in the meat products was 2.24 mg / kg, which was 86.19% lower than that in the control group and far lower than the 30 mg / kg nitrite residue in the fermented meat products. This indicates that *Staphylococcus piscifermentans* strain XUCSB 029 has a good ability to degrade nitrite and produces flavor substances including aldehydes, ketones, alcohols, esters, acids and other compounds.

[0027] 3. Excellent aroma and color development capabilities, enhancing the flavor of fermented meats.

[0028] When the Staphylococcus piscifermentans of this invention was inoculated into fermented sausage, after 15 days of fermentation, the redness value a* was 16.23±0.32, which was 1.54 higher than that of the control group. There were 21 volatile flavor compounds, more than the 11 in the control group, including 1 ketone, 2 alcohols, 6 esters, and 1 acid. Two other compounds were unique to the inoculated Staphylococcus piscifermentans XUCSB 029, making the flavor of the fermented sausage more complex and layered, and promoting the formation of unique sensory flavor characteristics. Attached Figure Description

[0029] Figure 1 The MSA solid plate morphological characteristics and microscopic Gram staining of Staphylococcus piscifermentans XUCSB 029 in Example 1 of this invention.

[0030] Figure 2 This is a phylogenetic tree of Staphylococcus piscifermentans XUCSB 029 (abbreviated as C29) in Example 1 of the present invention.

[0031] Figure 3 This figure illustrates the effect of inoculation with Staphylococcus piscifermentans XUCSB 029 (C29) on the redness value (a*) of fermented sausage in Example 1 of this invention. Note: Different letters in the figure indicate statistically significant differences (P<0.05). Error bars represent standard deviations (SD).

[0032] Figure 4 The nitrite content of the fermented sausage after 15 days inoculated with Staphylococcus piscifermentans XUCSB 029 (C29) in Example 1 of this invention. Note: Different letters indicate statistically significant differences (P<0.05). Error bars represent standard deviation (SD). Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0034] The structures, proportions, sizes, etc., illustrated in the accompanying drawings of this specification are only used to complement the content disclosed in the specification for those skilled in the art to understand and read, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance and any modification to the structure, change of proportions, or adjustment of size is not permitted.

[0035] Unless otherwise specified, the experimental materials and reagents used in the following examples were purchased from conventional consumable and biochemical reagent stores and can be obtained commercially or prepared by known methods.

[0036] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0037] Preservation of microbial strains

[0038] Staphylococcus piscifermentans XUCSB 029 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, with accession number CGMCC No. 34992; deposit address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0039] Example 1: A fish-fermenting Staphylococcus strain with high nitrite degradation and its application

[0040] 1. Experimental materials:

[0041] Sample: Changsha cured pork from Hunan.

[0042] MSA liquid culture medium: 3g beef extract, 10g peptone, 10g NaCl, 10g D-mannitol, 1000mL distilled water, adjust pH to 7.2. Sterilize at 121℃ for 15min.

[0043] MSA solid culture medium: 3g beef extract, 10g peptone, 10g NaCl, 10g D-mannitol, 1000mL distilled water, 18g agar powder, adjust pH to 7.2. Sterilize at 121℃ for 15min.

[0044] 2. Experimental Methods

[0045] 2.1 Sequencing of the strain's 16S rDNA

[0046] Primer 7F was used: CAGAGTTTGATCCTGGCTCAG (SEQ ID NO.2)

[0047] PCR amplification was performed using primer 1540R: AGGAGGTGATCCAGCCGCA (SEQ ID NO.3). The PCR amplification conditions were: 95℃, 5 min; 95℃, 15 s, 55℃, 15 s, 72℃, 1 min 30 s, 34 cycles; 72℃, 5 min; stored at 4℃. The amplified DNA fragments were detected using 1% agarose gel and sent to Shanghai Sangon Biotech for sequencing.

[0048] 2.2 Sample preparation:

[0049] Samples of cured pork were collected from local residents in Changsha, Hunan Province. 25g of cured pork was taken with sterile scissors, chopped, and added to 225mL of physiological saline (0.9% NaCl solution). The mixture was homogenized using a sterile homogenizer (SCIENTZ-09) (SCIENTZ, Ningbo, China) at a speed of 12 times / second for 2 minutes. 1ml of sample was then collected and serially diluted 10-fold with physiological saline. 100µL of each appropriate serial dilution was spread onto MSA solid medium, screened for bacteria at 30℃, and incubated for 72 hours. Colonies with inconsistent morphology were randomly selected and streaked three times until purified.

[0050] 2.3 Determination of physicochemical properties of Staphylococcus piscifermentans XUCSB 029 (fish fermentation strain):

[0051] 2.3.1 Hemolysis characteristics

[0052] Using a sterile inoculating loop, streak activated pure bacteria from MSA liquid medium onto Columbia blood agar plates and incubate at 37°C for 48 hours. Observe whether there is a hemolytic zone around the colony. If a transparent hydrolyzed area appears around the colony, it is β-hemolysis; if a partially hydrolyzed or dark green area appears, it is α-hemolysis; if there is no obvious change around the colony, it is γ-hemolysis (non-hemolysis).

[0053] 2.3.2 Viscosity Generation Experiment

[0054] If a single colony cultured on MSA solid medium is picked up directly with an inoculation needle and no stringing occurs, then no sticky substance is produced.

[0055] 2.3.3 Nitrate reductase activity

[0056] Preparation of nitrate-reducing solid medium: 0.2% potassium nitrate was added to MSA medium and sterilized. The isolated and purified bacterial colonies were inoculated onto the nitrate-reducing solid medium and incubated upside down at 37°C for 8 hours. 1 mL of Griess' reagent A and 1 mL of reagent B were added to the medium, and after one minute of reaction, the remaining liquid was poured off. The appearance of a red color zone around the colonies was observed, and the size of the color zone was compared. The size of the red color zone can, to some extent, reflect the relative activity of nitrate reductase in the bacterial strain.

[0057] 2.3.4 Protease activity

[0058] Add 5% skim milk powder (SM medium) to MSA solid enrichment medium and sterilize at 115℃ for 20 min. Inoculate onto SM medium using the single colony inoculation method and incubate at 37℃ for 48 h, observing the decomposition of the clear zone.

[0059] 2.3.5 Lipase Activity

[0060] Add 1% glyceryl tartrate to MSA solid enrichment medium, dissolve the soluble substance uniformly by sonication, and sterilize at 115℃ for 20 min. Inoculate the glyceryl tartrate medium using the single colony inoculation method, incubate at 37℃ for 72 h, and observe the decomposition of the clear zone.

[0061] 2.3.6 Catalase Experiment

[0062] Take a clean glass slide and place a drop of 3% hydrogen peroxide solution on it. Use an inoculation needle to pick up a single colony of the bacteria to be tested and smear it in the hydrogen peroxide solution. Observe whether bubbles are produced. The production of bubbles indicates a positive catalase reaction of the bacteria; the absence of bubbles indicates a negative reaction.

[0063] 2.3.7 Detection of Glucose Gas and Acid Production

[0064] Glucose fermentation gas-producing medium: 1g peptone, 0.5g NaCl, 1g glucose, add 100mL distilled water, adjust pH to 7.4, add a trace amount of 1.6% bromocresol purple solution (0.16g dissolved in 10mL 95% ethanol) until the solution turns purple, dispense into test tubes, 10mL per tube, invert the Durham tubes into the test tubes and remove air, sterilize at 121℃ for 15min. Then, inoculate 1% bacterial suspension into the test tubes and incubate at 37℃ for 24h. A blank control group is included. If bubbles are produced in the Durham tubes, it indicates that the inoculated bacteria are fermenting glucose to produce gas; if the color turns yellow, it indicates acid production.

[0065] 2.3.8 NH3 production detection

[0066] Arginine ammonia-producing medium: 5g peptone, 5g yeast extract, 5g beef extract, 2.5g NaCl, 0.5g glucose, 2g ammonium citrate, 2g dipotassium hydrogen phosphate, and 10g L-arginine were dissolved in 1000mL distilled water. The pH was adjusted to 5.3. The solution was dispensed into test tubes (10mL per tube), and an inverted Durham tube was added to remove air. The tubes were then sterilized at 121℃ for 15min. The test strain was inoculated with a 1% bacterial suspension into the test tubes containing NH3-producing medium. Sterile liquid paraffin was added to cover the surface of the medium, and the tubes were incubated at 37℃ for 24h. The presence of bubbles in the Durham tubes indicated a positive result for NH3 production.

[0067] 2.3.9 Detection of biological amines

[0068] Amino acid decarboxylase detection medium: 5g peptone, 3g beef extract, 1g glucose, 0.02g bromocresol purple, and 5g amino acids (L-lysine and L-ornithine, respectively) were dissolved in 1000mL distilled water, and the pH was adjusted to 6.8. The solution was dispensed into test tubes (10mL per tube) and sterilized at 121℃ for 15min. The test strain was inoculated with a 1% bacterial suspension into the test tubes containing the different amino acids, covered with sterile liquid paraffin, and incubated at 37℃ for 48h. The color change was observed; if the color first turned yellow and then purple, the result was positive.

[0069] 2.3.10 H2S Detection

[0070] Ferrous sulfate agar medium: 0.3g beef extract, 0.3g yeast extract, 1g peptone, 0.02g ferrous sulfate, 0.03g sodium thiosulfate, 0.5g NaCl, 1.2g agar, dissolved in 100mL distilled water, pH adjusted to 7.4, sterilized at 121℃ for 15min. After sterilization, remove and stand upright until it solidifies into a uniform solid state.

[0071] 2.3.11 NaNO2 Resistance Detection

[0072] A 1% concentration of activated third-generation bacterial culture was inoculated into 150 mg / L MSA liquid medium. Turbidity was observed after 24 hours, and OD was measured. 600 .

[0073] 2.3.12 Acid Resistance Test

[0074] 1% of the activated third-generation bacterial culture was inoculated into MSA liquid medium at pH 4.5, 5, and 5.5. Turbidity was observed after 48 hours, and OD was measured. 600 .

[0075] 2.3.13 Low Temperature Resistance Test

[0076] A 1% concentration of activated third-generation bacterial culture was inoculated into MSA liquid medium and incubated at 10°C for 48 hours. Turbidity was observed, and OD was measured. 600 .

[0077] 2.3.14 Salt tolerance characteristics

[0078] 1% of the activated third-generation bacterial culture was inoculated into MSA liquid medium containing 10% NaCl. After incubation at 37°C for 48 hours, turbidity was observed, and the number of viable bacteria was detected using MSA solid medium.

[0079] 2.4 Antibiotic susceptibility testing

[0080] The antibiotic susceptibility of screened strains was determined using the KB method (disk diffusion method). 100 μL of activated, third-generation bacterial suspension grown to the end-log phase was evenly spread onto MSA solid medium. After the plate surface was slightly dry, antibiotic disks containing a quantitative amount of each antibiotic were affixed to the plate containing the spread bacteria. A total of eight antibiotics were used: rifampin (5 μg), chloramphenicol (30 μg), kanamycin (30 μg), streptomycin (10 μg), tetracycline (10 μg), penicillin (10 μg), vancomycin (30 μg), and gentamicin (10 μg). The plates were incubated at 37°C. The size of the inhibition zone reflected the sensitivity of the screened bacteria to the tested antibiotics. The diameter of the inhibition zone (mm) was measured after 48 hours.

[0081] 2.5 PCR assay for determining enterotoxin and amine-producing genes

[0082] PCR technology is used to directly confirm the presence of pathogenic genes and biogenic amine genes, including the sea, seb, sec, sed, and see enterotoxin genes, as well as hdc (histidine decarboxylase gene), odic (ornithine decarboxylase gene), tdc (tyrosine decarboxylase gene), and ldc (lysine decarboxylase gene).

[0083] 2.6 Staphylococcus piscifermentans XUCSB 029 is used in fermented sausages.

[0084] 2.6.1 Making Fermented Sausage

[0085] The pork raw material was selected from the hind leg of free-range pigs, minced into granules using a meat grinder, with a lean-to-fat ratio of 2:8 (m / m). Seasonings were added: 1% glucose, 0.01% sodium nitrite, and 2.5% salt. The control group received 5% sterile water, while the experimental group received a bacterial solution mixed with 5% sterile water. A single strain of Staphylococcus aureus XUCSB 029 was used at a concentration of 1×10⁻⁶. 7CFU / g. Chop and mix thoroughly. After low-temperature marinating for 2 hours, stuff the mixture into sausages and hang them in a pre-sterilized constant temperature and humidity chamber for fermentation, drying, and maturation. The procedure was as follows: natural air drying at 25℃ for 24 hours, with relative humidity controlled at 45%; fermentation at 25℃ for 3 days, with relative humidity at 75%; drying and maturation at 18℃, with humidity at 65%, for 11 days. Sampling was conducted at 0, 3, 6, 9, 12, and 15 days.

[0086] 2.6.2 Color Changes in Fermented Sausages

[0087] Remove the fat, chop the sample, mix and press into thin slices 1.5 cm thick and 2.5 cm in diameter. Calibrate the colorimeter and measure the redness value (a*) of the sausage. Perform three parallel measurements.

[0088] 2.6.3 Determination of nitrite residue in fermented sausages

[0089] The spectrophotometric method in the national standard GB 5009.33-2016 was used for detection.

[0090] 2.6.4 GC-MS determination

[0091] (1) Sample pretreatment

[0092] Weigh 2.0 g of chopped sample into a 20 mL headspace vial, and add 10 μL of 0.1 g / L 2,4,6-trimethylpyridine as an internal standard. Headspace solid-phase microextraction (SPME) was used. For the first use, a syringe was used for injection, and the SPME extraction tip was preheated at the GC inlet (250 °C) for 20 min. Then, the microextraction needle was inserted into the headspace vial, and extraction was performed for 30 min. The sample was then manually transferred to GC-MS, desorbed for 5 min, and analyzed for volatile flavor compounds.

[0093] (2) GC conditions: The chromatographic column was a DB-5MS capillary column (60m × 0.32mm, 1μm); the carrier gas was high-purity helium; the flow rate was 0.8mL / min; the injection port temperature was 250℃, and the split mode was used with a split ratio of 5:1 and a split flow rate of 4mL / min. Hold for 2min. The initial column temperature was 40℃, and hold for 5min. The temperature program was as follows: increase the temperature to 90℃ at a rate of 2℃ / min, hold for 0min, then increase the temperature to 100℃ at a rate of 5℃ / min, hold for 0min, and then increase the temperature to 230℃ at a rate of 10℃ / min, hold for 8min.

[0094] (3) MS conditions: Full scan mode was used, and the mass spectrometer scanning mass was 45-500 m / z. The ion source was EI, the ion source temperature was 230℃, the electron energy was 70 eV, and the sample inlet temperature was 250℃.

[0095] The content of each volatile component (internal standard: 2,4,6-trimethylpyridine, concentration: 100 ppm, usage: 10 μL) is calculated using the following formula:

[0096] The amount of flavor compound (mg / kg) = (C0*V0 / m)*(A1 / A2), where C0 is the concentration of the internal standard (mg / L), V0 is the injection volume of the internal standard (µL), and m is the mass of the chopped sample (g). A1 is the peak area of ​​the compound, and A2 is the peak area of ​​the internal standard.

[0097] 3. Experimental Results

[0098] 3.1 Isolation, purification, and 16S rDNA sequencing of Staphylococcus piscifermentans XUCSB 029

[0099] Morphological characteristics of *Staphylococcus piscifermentans* XUCSB 029 on MSA plates and Gram staining microscopy at 60x magnification are shown in the figure. Figure 1 The colonies are approximately 0.18 ± 0.12 cm in diameter, opaque, pale yellow in color, with a moist and smooth surface and edges, and a slightly raised center. They stain purple with Gram stain, indicating that Staphylococcus piscifermentans XUCSB 029 is a positive bacterium.

[0100] The sequencing sequence of the 16S rDNA of *Staphylococcus piscifermentans* XUCSB 029 is as follows: (SEQ ID NO.1)

[0101]

[0102] NCBI sequence comparison revealed a 99.58% sequence similarity to strain *Staphylococcus piscifermentans* CIP103958. To further clarify the phylogenetic relationship and taxonomic position of this strain, a phylogenetic tree was constructed. The results showed that *Staphylococcus piscifermentans* XUCSB 029 (C29) and *Staphylococcus piscifermentans* CIP103958 clustered together in the phylogenetic tree, as shown in the phylogenetic tree below. Figure 2 As shown, it was therefore identified as *Staphylococcus piscifermentans*.

[0103] 3.2 Physicochemical properties of Staphylococcus piscifermentans XUCSB 029

[0104] The physicochemical properties of *Staphylococcus piscifermentans* XUCSB 029 were determined as shown in the table below. As can be seen from the table, using agar plate color reaction, *Staphylococcus piscifermentans* XUCSB 029 exhibits high nitrate reducing ability; using Griess color reaction, the diameter of the red circle of the bacteria is 4.20 ± 0.06 cm. Proteases can break down proteins to form free amino acids, and lipases can break down fats to form fatty acids, playing an important role in the special aroma and flavor of fermented meat. Through agar plate hydrolysis zone test, *Staphylococcus piscifermentans* XUCSB 029 possesses good proteolytic and lipolytic abilities, with hydrolysis zone sizes of 2.03 ± 0.12 cm and 0.82 ± 0.02 cm, respectively. Meanwhile, the ability of the fermented meat environment was tested, and Staphylococcus piscifermentans XUCSB 029 could survive under the conditions of low temperature 10℃, 10% sodium chloride and 150 mg / L sodium nitrite, and acidic pH 4.5-5.5.

[0105] Table 1. Fermentation characteristics of Staphylococcus piscifermentans XUCSB 029 for fish fermentation

[0106]

[0107]

[0108] Note: "+" and "-" indicate whether the reaction is positive or negative. The numbers represent OD values. 600 The absorbance at that point.

[0109] 3.3 Antibiotic susceptibility test of Staphylococcus piscifermentans XUCSB 029

[0110] The results of the antibiotic susceptibility test for *Staphylococcus piscifermentans* XUCSB 029 are shown in the table below. As can be seen from the table, using the susceptibility testing method, *Staphylococcus piscifermentans* XUCSB 029 exhibited inhibition zones against all eight commonly tested antibiotics in this study, demonstrating susceptibility. Among them, penicillin, rifampin, and chloramphenicol showed the largest inhibition zones, indicating the highest susceptibility, with inhibition zone sizes of 20.20±1.67 mm, 17.74±1.49 mm, and 13.53±0.73 mm, respectively. This indicates that *Staphylococcus piscifermentans* XUCSB 029 is a non-drug-resistant bacterium, will not cause the spread of drug-resistant genes into the environment, meets GRAS standards, and ensures the safety of fermented foods.

[0111] Table 2. Drug susceptibility of Staphylococcus piscifermentans XUCSB 029

[0112]

[0113] 3.4 Detection of virulence genes in Staphylococcus piscifermentans XUCSB 029

[0114] The PCR results of enterotoxin and amine-producing genes in *Staphylococcus piscifermentans* XUCSB 029 are shown in Table 3. The PCR results indicate that *Staphylococcus piscifermentans* XUCSB 029 does not contain virulence genes, including the enterotoxin-coding genes sea, seb, sec, sed, and see, as well as biogenic amine-forming genes such as histamine (hdc), cadaverine (ldc), putrescine (odc), and tyramine (tdc). Therefore, further safety testing demonstrates that *Staphylococcus piscifermentans* XUCSB 029 has the potential to be relatively safe for use in fermented meat.

[0115] Table 3. PCR detection of enterotoxin and biogenic amine production genes in Staphylococcus piscifermentans XUCSB 029

[0116]

[0117] Note: "+" and "-" indicate whether the phenomenon is positive or negative.

[0118] 3.5 Characteristics of Staphylococcus piscifermentans XUCSB 029 in fermented sausages

[0119] 3.5.1 Color Changes

[0120] The effect of inoculation with Staphylococcus piscifermentans XUCSB 029 on the redness value (a*) of fermented sausage after 15 days was detected using a colorimeter. The results are as follows: Figure 3 As shown. Nitrites, as a food additive, have multiple functions, including improving the color of meat products. Staphylococcus piscifermentans XUCSB 029 possesses nitrate reductase, and the reduction product, nitric oxide (NO), interacts with myoglobin in meat to form the red pigment nitrosomyoglobin. Figure 3It was found that from day 3 until day 15 when the fermented sausages matured, the redness value of the fermented sausages inoculated with *Staphylococcus piscifermentans* XUCSB 029 was significantly higher than that of the uninoculated control group, showing a statistically significant difference (P < 0.05). On day 15, the redness value a* was 16.23 ± 0.32, which was 1.54 higher than that of the CK group. This indicates that *Staphylococcus piscifermentans* XUCSB 029 can promote the formation of red color in fermented sausages.

[0121] 3.5.2 Detection of nitrite residue in fermented sausages

[0122] After 15 days of fermentation, the residual nitrite level in the fermented sausage was as follows: Figure 4 As shown, the nitrite residue in fermented sausages inoculated with *Staphylococcus piscifermentans* XUCSB 029 was 2.24 ± 0.20 mg / kg, compared to 16.22 ± 0.21 mg / kg in the control group, representing a reduction of 86.19%, far below the national standard of 30 mg / kg for nitrite residue in fermented meat products. This indicates that *Staphylococcus piscifermentans* XUCSB 029 has a good ability to degrade nitrite.

[0123] 3.6.3 Detection of volatile flavor compounds in fermented sausages

[0124] The flavor compounds in fermented sausages originate from a series of physical and biochemical changes in fats, proteins, and carbohydrates during sausage production, as well as added flavorings. They are mainly related to the presence of volatile substances such as aldehydes, ketones, esters, alcohols, acids, and phenols. Table 4 shows the results of GC-MS detection of volatile substances in fermented sausages inoculated with *Staphylococcus piscifermentans* XUCSB 029, identifying a total of 23 volatile substances. In the *Staphylococcus piscifermentans* XUCSB 029 group, 21 volatile chemical substances were detected, including 1 aldehyde, 1 ketone, 2 alcohols, 14 esters, 1 acid, and 2 other substances. In the CK group, 11 volatile chemical substances were detected, including 1 aldehyde, 2 ketones, and 8 esters. Compared to the control group, *Staphylococcus piscifermentans* XUCSB 029 exhibited a richer and higher total content of volatile chemical substances, particularly esters, which significantly contribute to the flavor of fermented sausages. These esters were diverse and abundant. Among the volatile chemical substances were ketones such as acetone, two alcohols such as allyl alcohol and 2-nonen-1-ol, six esters such as ethyl 3-methylbutyrate, methyl butyrate, methyl isovalerate, methyl valerate, ethyl 2-methylbutyrate, and ethyl hexanoate, and acids such as 1-aminocyclobutanoic acid. Other substances, such as ethers and acid anhydrides, were specific to *Staphylococcus piscifermentans* XUCSB 029.

[0125] Table 4. Content of volatile flavor compounds in fish sausages inoculated with Staphylococcus piscifermentans XUCSB 029

[0126]

[0127]

[0128] Note: Different lowercase letters indicate significant differences in data from different sample groups on the same line (P < 0.05); ND indicates that the corresponding compound was not detected.

[0129] Esters are formed by the esterification of alcohols and acids, and most of them have an aromatic flavor. Esters containing short-chain acids (<C6) mostly have a fruity aroma, while esters containing long-chain acids (C14 - C18) mostly have a faint oily taste. The free fatty acids produced by fat hydrolysis can also react with alcohols to form esters, which contribute significantly to the unique flavor of sausages. The total ester content in the CK group was 3151.91 ± 276.35 μg / kg, less than that in the Staphylococcus piscifermentans XUCSB 029 group, which was 3807.72 ± 669.24 μg / kg. The top 3 substances with the highest ester content in the CK group were mainly methyl acetate, ethyl acetate, and methyl octanoate. The top 3 substances with the highest ester content in the XUCSB 029 group were mainly ethyl acetate, methyl acetate, and methyl hexanoate, and the ester richness in the XUCSB 029 group was higher than that in the CK group. Aldehydes play an important role in the formation of the special flavor of fermented meat products and can reflect the degree of fat oxidation. The total amount of aldehydes in the XUCSB 029 group was less than that in the CK group, and the richness of substances was the same as that in the CK group, but the threshold was lower, so aldehydes were secondary flavor contributors. Ketones are generally produced by the Maillard reaction and have a buttery taste. Two ketone substances were present in the CK group, and one ketone substance was present in the Staphylococcus piscifermentans XUCSB 029 group, but ketones still belong to the secondary flavor contributors of meat products. Alcohols generally come from carbohydrate metabolism, fat oxidation, and amino acid catabolism. Most unsaturated alcohols have a good fruity and herbal aroma. Among them, the XUCSB 029 group contains unique unsaturated alcohols such as allyl alcohol and 2-nonen-1-ol, which may impart a fruity aroma to the fermented sausage. Acids in fermented sausages are mainly produced by microorganisms metabolizing carbohydrates and, when appropriate, have an aroma of slightly cheesy and fatty taste. 1-aminocyclobutanecarboxylic acid is unique to the Staphylococcus piscifermentans XUCSB 029 group, but it has not been reported as a component contributing to the fermented aroma and still requires further research. Others such as ethyl isopropyl ether are ether compounds, and isobutyric anhydride is an acid anhydride compound, but both account for very little content. Ether compounds usually have an ether aroma and may have a slight fruity or herbal taste. Therefore, ethyl isopropyl ether may have an odor similar to ethers, but is milder than ordinary ether, and may have a fruity or floral note, but is not the main component. Acid anhydrides usually have a pungent sour or fruity taste, are easily decomposed into acids at high temperatures, and may combine with other aldehydes and ketones to form more complex odor characteristics, or generate esters through esterification reactions to increase the fruity or other aromas. Therefore, isobutyric anhydride may impart a fruity aroma or sour taste to the sausage, or interact with other volatile components (such as esters and ketones) to enhance the overall flavor.

[0130] In summary, inoculating fermented sausages with *Staphylococcus piscifermentans* XUCSB 029 can impart a unique flavor and rich aroma, enriching and layering the sausage's flavor, and promoting the formation of its distinctive sensory characteristics. *Staphylococcus piscifermentans* XUCSB 029 is a promising meat fermentation agent that can highly degrade nitrite and promote the development of flavor in fermented meat.

[0131] The strain was derived from Hunan cured pork, a traditional fermented food (Changsha, Hunan, China). Screening methods included nitrate reducing ability, protein and fat hydrolysis ability, catalase positivity, hemolytic characteristics, production of mucus, gas and acid, NH3 production, H2S production, production of bioamines, tolerance to Na2NO2, salt tolerance, acid tolerance, and low temperature tolerance.

[0132] 16S rDNA molecular biological identification and phylogenetic tree construction confirmed it as *Staphylococcus piscifermentans*.

[0133] 1. Highly effective nitrite degradation: After 15 days of fermentation, the average nitrite residue in the fermented sausages inoculated with *Staphylococcus piscifermentans* XUCSB 029 was 2.24 mg / kg, a reduction of 86.19% compared to the control group, and lower than the national standard of 30 mg / kg for fermented meat products. This indicates that *Staphylococcus piscifermentans* XUCSB 029 has a good ability to degrade nitrite.

[0134] 2. Color development ability: Inoculation with 1×10 7 CFU / g of Staphylococcus piscifermentans XUCSB 029 was used to ferment sausages from day 3 until day 15 until maturity. The redness value of the fermented sausages was significantly higher than that of the control group (CK) without inoculation. The redness value (a*) was 16.23 ± 0.32, an increase of 1.54 compared to the CK group. This indicates that Staphylococcus piscifermentans XUCSB 029 promotes red color formation in fermented sausages.

[0135] 3. Aroma production capacity: Inoculation 1×10 7GC-MS analysis of volatile compounds in *Staphylococcus piscifermentans* XUCSB 029 (CFU / g) showed that, compared to the 11 compounds in the control group (CK), *Staphylococcus piscifermentans* XUCSB 029 contained a richer and higher total amount of 21 volatile flavor compounds, of which esters accounted for 3807.72 ± 669.24 μg / kg. Among these, there was one ketone, two alcohols, six esters, and one acid. Two other compounds were specific to *Staphylococcus piscifermentans* XUCSB 029.

[0136] 4. Safety: No hemolytic characteristics; PCR verification showed no enterotoxins or amine-producing genes; antibiotic susceptibility of the selected strains was determined by the KB method paper disk agar diffusion method, and all eight antibiotics were sensitive, meeting the GRAS standard.

[0137] Comparative Example 1:

[0138] Compared with the invention patent application with publication number CN 117568241A, the strain Staphylococcus piscifermentans XUCSB 029 in this embodiment has a yield of 1.0 × 10⁻⁶. 7 After 15 days of maturation following inoculation with CFU / g of fermented sausage, the nitrite residue was only 2.24 ± 0.20 mg / kg, achieving a redness value (a*) of 16.23 ± 0.32. This nitrite residue was 11.15 times lower than that of the *Staphylococcus aureus* (FSUJL109) group. Flavor profile tests of the *Staphylococcus aureus* (FSUJL109) strain after inoculation with fermented sausage have not yet been conducted.

[0139] The literature (Gupta, S.; Indra, R.; K. Maurya, P., et al., Isolation and Characterization of Predominant Bacteria, Staphylococcus piscifermentans Associated with Traditional Fermented Fish Products of Northeast India. International Journal of Current Microbiology and Applied Sciences 2018, 7, (05), 1758-1771.) describes the isolation of 10 strains of Staphylococcus piscifermentans from four traditional fermented fish products in Northeast India. All isolates were non-hemolytic on blood agar plates, non-pathogenic to most antibiotics, and showed antagonistic effects against pathogenic strains of Escherichia coli and Staphylococcus aureus. Further characterization of their probiotic properties revealed good survival ability in bile salts (0.3%) and different pH values ​​(2.0-8.0), indicating resistance to the gastrointestinal environment.

[0140] In the literature (Majumder, RK; Gupta, S., Starter inoculus assisted fermentation of Puntius sp. — Role of Lactiplantibacillus plantarum and Staphylococcus piscifermentans to reduce fermentation time while increasing safety. Journal of Applied Microbiology 2022, 133, (2), 784-795.), Lactobacillus plantarum and Staphylococcus piscifermentans isolated from Sheedal were used as starter cultures for Sheedal. During the fermentation process of Lactobacillus plantarum and Staphylococcus piscifermentans, more α-amino nitrogen and TCA-soluble peptides were dissolved, and the fermentation cycle was significantly shortened from the usual 4-5 months to 75 days, thus improving product quality and safety.

[0141] In the literature (Yu Xiaoqing, Ni Shenpeng, Yao Junjie, et al. Screening of a moderately halophilic bacterium [J]. Food and Fermentation Technology, 2018, 54(04):55-58+65.), the authors isolated a salt-tolerant strain from kimchi, which was identified as *Staphylococcus piscifermentans*. After cultivation in liquid media containing different concentrations of salt and nitrite, it was able to tolerate liquid media containing 180 g / L sodium chloride and 3.0 g / L sodium nitrite.

[0142] The literature (Guo, J.; Luo, W.; Fan, J. et al., Co-inoculation of Staphylococcus piscifermentans and salt-tolerant yeasts inhibited biogenic amines formation during soy sauce fermentation. Food Research International 2020, 137.) investigated the effects of *Staphylococcus piscifermentans* and salt-tolerant yeasts on the formation of biogenic amines (BAs) in high-amino acid nitrogen soy sauce. Co-inoculation with *Staphylococcus piscifermentans* and salt-tolerant yeasts resulted in the lowest BA production. Inoculation with *Staphylococcus piscifermentans* increased the production of major volatile compounds such as alcohols, aldehydes, phenols, and esters. The changes in BA production and volatile compounds may be attributed to the increased abundance of yeasts and *Pichia pastoris*, and the decrease in bacteria such as *Pediococcus*, *Westernella*, and *Streptococcus*.

[0143] Existing reports on Staphylococcus piscifermentans strains for fish fermentation are limited in their sources and characteristics, especially those exhibiting excellent nitrite degradation capabilities. This invention aims to provide a Staphylococcus piscifermentans strain with strong nitrite-reducing and degrading effects. Verification has shown that it possesses high safety characteristics, excellent fermentation capacity, and good aroma-producing ability when inoculated into fermented meat, thus providing a strain resource for the production of fermented meat products.

[0144] Example 2:

[0145] A method for reducing the nitrite content in fermented sausages includes the following steps: mincing meat into granules, then adding 1.5% glucose, 0.015% sodium nitrite, and 3% salt by weight; and adding Staphylococcus aureus XUCSB 029 to a concentration of 1.5 × 10⁻⁶. 7CFU / g; after chopping and mixing, marinate for 2.5 hours, stuff into sausages, and hang in a pre-sterilized constant temperature and humidity chamber for fermentation, drying and maturation of sausages; the procedure is as follows: natural air drying at 27℃ for 28 hours with a relative humidity of 50%; fermentation at 27℃ for 4 days with a relative humidity of 80%; drying and maturation at 20℃ with a relative humidity of 70% for 15 days.

[0146] Example 3:

[0147] A method for reducing the nitrite content in fermented sausages includes the following steps: mincing meat into granules, then adding 0.5% glucose, 0.005% sodium nitrite, and 2% salt by weight; and adding Staphylococcus aureus XUCSB 029 to a concentration of 0.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 1.5 hours, stuff into sausages, and hang in a pre-sterilized constant temperature and humidity chamber for fermentation, drying and maturation of sausages; the program is as follows: natural air drying at 22℃ for 20-28 hours with a relative humidity of 40%; fermentation at 22℃ for 2 days with a relative humidity of 70%; drying and maturation at 16℃ with a relative humidity of 60% for 10 days.

[0148] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fish-fermenting Staphylococcus aureus strain with high nitrite-degrading properties, characterized in that: Its accession number is CGMCCNo.34992.

2. The fish fermentation Staphylococcus as described in claim 1, characterized in that: The 16S rDNA sequence of the fish-fermenting Staphylococcus is shown in SEQ ID NO.

1.

3. The fish fermentation Staphylococcus as claimed in claim 1, in any of the following applications: (1) Application in the degradation of nitrite; (2) Application in the fermentation and preparation of meat products; (3) Application in the preparation of meat fermentation inoculants; (4) Application in the preparation of products that degrade nitrite.

4. A meat fermentation agent with the function of degrading nitrite, characterized in that: Its main components include one or more of the following: fish fermentation staphylococcus as described in claim 1, fermentation supernatant of fish fermentation staphylococcus, and lysate of fish fermentation staphylococcus.

5. The meat fermentation agent according to claim 4, characterized in that: The fermentation supernatant is obtained by culturing the fish-fermenting Staphylococcus aureus in a culture medium for a period of time and then centrifuging to remove the bacterial cells.

6. The meat fermentation agent according to claim 4, characterized in that: The lysate is obtained by culturing the fish-fermenting Staphylococcus aureus in a culture medium for a period of time, followed by ultrasonic disruption and centrifugation to remove the bacterial cells.

7. A method for reducing the nitrite content in fermented meat products, characterized in that: Includes the following steps: During the preparation of fermented meat products, the meat fermentation agent described in claim 4 is added.

8. The method according to claim 7, characterized in that: The meats include pork, beef, mutton, or their heart, liver, lungs, and kidneys; the fermented meat products include bacon, sausage, ham, and cured meat.

9. The method according to claim 7, characterized in that: The main component of the meat fermentation agent is the fish fermentation Staphylococcus as described in claim 1, with an addition concentration of 0.5-1.5 × 10⁻⁶. 7 CFU / g.

10. The method according to claim 7, characterized in that: Includes the following steps: The meat is minced into granules, then 0.5-1.5% glucose, 0.005-0.015% sodium nitrite, and 2-3% salt are added by weight; and the fish fermentation Staphylococcus as described in claim 1 is added, with an addition concentration of 0.5-1.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 1.5-2.5 hours, stuff the mixture into sausages, and hang them in a pre-sterilized constant temperature and humidity chamber for fermentation, drying, and maturation. The procedure is as follows: air dry at 22-27℃ for 20-28 hours with a relative humidity of 40-50%; ferment at 22-27℃ for 2-4 days with a relative humidity of 70-80%; and dry and mature at 16-20℃ with a relative humidity of 60-70% for 10-15 days.

Citation Information

Patent Citations

  • Staphylococcus camosus B1-2 with chromogenic effect and application thereof

    CN109868251A

  • Application of mimic staphylococcus HZ01 for replacing part of nitrite in meat products

    CN116831273A

  • Staphylococcus fish fermentative strain with relatively high reducing power to nitrate

    CN117568241A

  • Lactobacillus rhamnosus and application thereof

    CN118995527A

  • Staphylococcus corticosus PXDB-JCS01 and method for preparing fermented glutinous rice cake chili by using staphylococcus corticosus PXDB-JCS01

    CN119955686A