Neutralizing aptamer specifically binding to human april and its use in the inhibition of antibody secretion

Abstract

The application discloses a neutralizing nucleic acid aptamer capable of specifically combining with human APRIL and application thereof in inhibiting antibody secretion. The neutralizing nucleic acid aptamer of the application can efficiently neutralize extracellular APRIL molecules in vitro and in vivo, thereby blocking the combination of the molecules with a human calcium-binding cyclophilin ligand-interacting molecule (TACI) and a B cell maturation antigen (BCMA) on a B cell membrane, and finally inhibiting the generation and secretion of antibodies. Compared with the existing biological preparation atacicept for targeting and neutralizing APRIL, the APRIL neutralizing nucleic acid aptamer involved in the application has the advantages of high specificity, high affinity, low immunogenicity and low cost, is a novel nucleic acid drug preparation for inhibiting antibody secretion, and has a great clinical application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of screening and application of neutralizing nucleic acid aptamer, and particularly relates to a neutralizing nucleic acid aptamer specifically binding to human APRIL and application thereof in inhibiting antibody secretion. BACKGROUND

[0002] APRIL acts on TACI and BCMA on the membrane of B cells to promote the generation and secretion of antibodies, thereby aggravating autoimmune diseases such as SLE. Therefore, neutralizing APRIL can inhibit the generation and secretion of antibodies to a certain extent, and ultimately alleviate autoimmune diseases represented by SLE. In recent years, the biological agent Telitacicept targeting and neutralizing APRIL has shown certain efficacy on autoimmune diseases such as SLE, but its inhibition efficiency is limited, the treatment effect is poor, and the cost is high. Therefore, it is urgent to develop new, efficient, safe and low-cost new agents targeting and neutralizing APRIL.

[0003] Nucleic acid aptamer is a single-stranded nucleic acid obtained by in vitro screening through SELEX technology, which has similar biological functions to antibodies, and has the advantages of strong specificity, high affinity, low immunogenicity and low cost, and has broad application prospects in the field of biomedicine. The neutralizing nucleic acid aptamer which competes with the ligand of the target molecule to bind to the target molecule can inhibit the binding of the target molecule to its specific ligand, thereby blocking the biological function of the target molecule and playing a role in treating diseases. Based on this, the present application provides a neutralizing nucleic acid aptamer which can efficiently neutralize APRIL to block the binding of APRIL to TACI and BCMA on the membrane of B cells, thereby inhibiting the generation and secretion of antibodies, which has very important clinical significance and scientific value for further developing new targeted treatment programs for autoimmune diseases such as SLE. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a neutralizing nucleic acid aptamer which can effectively neutralize the APRIL molecule which plays an important role in the maturation and differentiation of B cells, and can effectively block the binding of APRIL to TACI and BCMA on the membrane of B cells, thereby inhibiting the generation and secretion of antibodies, and has the advantages of strong specificity, high affinity, small side effects, low cost, etc.

[0005] The technical problem to be solved by the present application is to provide a neutralizing nucleic acid aptamer which can effectively neutralize the APRIL molecule which plays an important role in the maturation and differentiation of B cells, and can effectively block the binding of APRIL to TACI and BCMA on the membrane of B cells, thereby inhibiting the generation and secretion of antibodies, and has the advantages of strong specificity, high affinity, small side effects, low cost, etc.

[0006] The technical problem to be solved by the present application is to provide a neutralizing nucleic acid aptamer which can effectively neutralize the APRIL molecule which plays an important role in the maturation and differentiation of B cells, and can effectively block the binding of APRIL to TACI and BCMA on the membrane of B cells, thereby inhibiting the generation and secretion of antibodies, and has the advantages of strong specificity, high affinity, small side effects, low cost, etc.

[0007] Technical solutions: In order to solve the above technical problems, the present application provides a neutralizing nucleic acid aptamer which specifically binds to human APRIL, and the nucleotide sequence of the neutralizing nucleic acid aptamer is any one of the sequences shown in SEQ ID NO. 1~SEQ ID NO. 5.

[0008] In the neutralizing nucleic acid aptamer, any chemical group, fluorescent molecule, isotope or drug can be modified or coupled to any position of the sequence shown in SEQ ID NO. 1~SEQ ID NO. 5.

[0009] Preferably, the sequence of the neutralizing nucleic acid aptamer of the present application is shown in SEQ ID NO. 2 or SEQ ID NO. 5.

[0010] Preferably, the sequence of the neutralizing nucleic acid aptamer of the present application is modified or coupled to any position of the sequence shown in SEQ ID NO. 2 or SEQ ID NO. 5.

[0011] Preferably, the sequence of the neutralizing nucleic acid aptamer of the present application includes all nucleic acid sequences with a sequence similarity of more than 80% to the sequence shown in SEQ ID NO. 2 or SEQ ID NO. 5.

[0012] The present application also includes the use of the neutralizing nucleic acid aptamer in the preparation of a drug for blocking the binding of APRIL to a ligand.

[0013] The ligand includes one or both of TACI protein or BCMA protein.

[0014] The concentration of the neutralizing nucleic acid aptamer is 10~1000nM.

[0015] The present application also includes the use of the neutralizing nucleic acid aptamer in the preparation of a drug for blocking the binding of APRIL to a ligand.

[0016] The antibody is derived from human PBMC cells.

[0017] The antibody is derived from R848-stimulated human PBMC cells.

[0018] The antibody includes one or more of IgM, IgG1, IgG2 and IgG3 antibodies.

[0019] The concentration of the neutralizing nucleic acid aptamer is 0.5~4µM.

[0020] Beneficial effects: the neutralizing nucleic acid aptamer of the application can efficiently neutralize extracellular APRIL molecules in vitro and in vivo, thereby blocking the binding of the molecules to human calcium binding cyclophilin ligand interacting molecule (TACI) and B cell maturation antigen (BCMA) on the membrane of B cells, and finally inhibiting the generation and secretion of antibodies. Compared with the existing biological preparation of targeting neutralization of APRIL, the APRIL neutralizing nucleic acid aptamer involved in the application has the advantages of high specificity, high affinity, low immunogenicity and low cost, and is a new type of nucleic acid drug preparation for inhibiting antibody secretion, which has great clinical application prospect. Compared with the prior art, the application has the following advantages:

[0021] (1) The neutralizing nucleic acid aptamer described in the application is screened in vitro by using SELEX technology, and compared with biological preparations, has the advantages of short screening period, easy synthesis, no batch difference, high specificity, low immunogenicity and low cost;

[0022] (2) The neutralizing nucleic acid aptamer constructed by precise design and modification has stronger neutralizing ability and inhibitory effect, and is a nucleic acid aptamer targeted preparation with intelligent diagnosis and treatment functions;

[0023] (3) The neutralizing nucleic acid aptamer described in the application can load various chemical drugs or be coupled with drugs to realize efficient and precise combined or synergistic treatment, and improve the efficiency of targeted treatment. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 is a secondary structure prediction result graph of the candidate APRIL neutralizing nucleic acid aptamer.

[0025] Figure 2 is a binding capacity analysis and specificity identification result graph of the APRIL neutralizing nucleic acid aptamer.

[0026] Figure 3 is a truncation, optimization and affinity determination result graph of the APRIL neutralizing nucleic acid aptamer. Figure 3 A in the above is a secondary structure graph of AP-2, Figure 3 B in the above is a secondary structure graph of AP-2a after truncation and optimization, Figure 3 C in the above is an affinity result graph of the nucleic acid aptamer AP-2, Figure 3 D in the above is an affinity result graph of the nucleic acid aptamer AP-2a.

[0027] Figure 4 is a tertiary structure simulation graph of the APRIL neutralizing nucleic acid aptamer AP-2a. Figure 4 A in the above is a secondary structure graph of the neutralizing nucleic acid aptamer AP-2a, Figure 4 B in the above is a tertiary structure graph of the neutralizing nucleic acid aptamer AP-2a.

[0028] Figure 5 Figure 3D is a 3D complex conformation map for docking the neutralizing aptamer AP-2a molecule.

[0029] Figure 6 Figure 3E is a 3D interaction map for docking the neutralizing aptamer AP-2a molecule.

[0030] Figure 7 Figure 4D is a graph of the detection results of the neutralizing target molecule ability of the APRIL neutralizing aptamer.

[0031] Figure 8 Figure 5D is a graph of the detection results of the proliferation ability and toxicity of the PBMC cells of the APRIL neutralizing aptamer.

[0032] Figure 9 Figure 6D is a graph of the detection results of the antibody secretion ability of the PBMC cells of the APRIL neutralizing aptamer. DETAILED DESCRIPTION

[0033] In order to better illustrate the present application, the present application will be described in detail and explained with reference to the accompanying drawings and specific embodiments. However, the following preferred embodiments should not be used as a limitation on the scope of protection of the present application.

[0034] The experimental methods, reagents and equipment used in the following examples are all conventional experimental methods, reagents and equipment in the technical field.

[0035] The main reagents and materials used include: Ficoll solution (Cytiva, catalog number 17-1440-03), DPBS (10x) buffer (Gibco, catalog number 14200075), recombinant human APRIL protein (Jinsirui Biotechnology Co., Ltd., catalog number Z05041), human serum albumin HSA (MedChemExpress, catalog number HY-P1956), human IgG (Shanghai Genechem Co., Ltd., catalog number D110501), carboxyl magnetic beads MNPs-COOH (Shanghai Genechem Co., Ltd., catalog number D149007), streptavidin magnetic beads SA-MNPs (Shanghai Genechem Co., Ltd., catalog number D112005), EDC (Shanghai Genechem Co., Ltd., catalog number C600433), Sulfo-NHS (Shanghai Yuan Ye Biotechnology Co., Ltd., catalog number S30615), carboxyl magnetic bead activation buffer (Shanghai Genechem Co., Ltd., catalog number D601030), carboxyl magnetic bead coupling buffer (Shanghai Genechem, catalog number D601031), HRP-labeled streptavidin SA-HRP (Shanghai Genechem Co., Ltd., catalog number D111054), bovine serum albumin BSA (Shanghai Genechem Co., Ltd., catalog number A600332), salmon sperm DNA (Solabio, D8030), human TACI (Coastal Protein, C07R), human BMCA (Coastal Protein, CS79), human APRIL ELISA detection kit (Proteintech, KE00645), R848 (MedChemExpress, catalog number HY-13740), 1640 medium (Kaiji Biological, catalog number KGL1501), CCK8 kit (Bi Yun Tian, catalog number C0038), etc.

[0036] The single-stranded DNA random library in the following examples, the primer sequence and the subsequent nucleic acid aptamer sequence and biotin modification are synthesized by Shanghai Genechem Co., Ltd.

[0037] SEQ ID NO. 1

[0038] AGCAGAGTTCACGACCCGATAAGCACGCAGTGGCGAGAGGAGAGAAGAGAGATAGTTAGGAGAGAGTTACATACCAATCGTCGCAG

[0039] SEQ ID NO. 2

[0040] AGCAGAGTTCACGACCCGATAAGGACTTCCTCGTACCTAGGAGACTCACATTGACCCTTCGAGTTACATACCAATCGTCGCAG

[0041] SEQ ID NO. 3

[0042] AGCAGAGTTCACGACCCGATAAGTATCCGCCTCGTCCGCTCTGCGTAGTTACCATTTACCAGAGAGTTACATACCAATCGTCGCAG

[0043] SEQ ID NO. 4

[0044] AGCAGAGTTCACGACCCGATAAGCACAGTCCAGTCACCGCAAATAAAGTA AGACCCCAAGCCAGAGTTACATACCAATCGTCGCAG

[0045] SEQ ID NO. 5

[0046] GACTTCCTCGTACCTAGGAGACTCACATTGACCCTTCGAGTTACATAC

[0047] SEQ ID NO. 6

[0048] AGCAGAGTTCACGACCCGATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTACATACCAATCGTCGCAG

[0049] SEQ ID NO. 7

[0050] AGCAGAGTTCACGACCCGATAAG

[0051] SEQ ID NO. 8

[0052] CTGCGACGATTGGTATGTAACTC

[0053] Example 1

[0054] (1) The random library and primer sequence designed in this example are as follows:

[0055] Random library ssDNA:

[0056] AGCAGAGTTCACGACCCGATAAG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTACATACCAATCGTCGCAG

[0057] Upstream primer: AGCAGAGTTCACGACCCGATAAG

[0058] Downstream primer: Biotin-CTGCGACGATTGGTATGTAACTC

[0059] (2) Preparation of 2x binding solution: 10x DPBS buffer was diluted with sterile water to 2x, and then MgCl2 with a final concentration of 10 mM, salmon sperm DNA with a final concentration of 0.2 mg / mL and bovine serum albumin (BSA) with a final concentration of 2 mg / mL were added;

[0060] (3) Preparation of washing solution: 5 mM MgCl2 was added to 1x DPBS buffer;

[0061] (4) Recombinant human APRIL protein, human IgG and human HSA were modified on magnetic nanoparticles (MNPs) respectively by using amidation reaction to prepare APRIL-MNPs, IgG-MNPs and HSA-MNPs. Take the preparation of APRIL-MNPs as an example, the specific operation is as follows:

[0062] 5 mg of MNPs-COOH was taken and washed with pre-cooled carboxyl magnetic bead activation buffer for 3 times, and then added into 1 mL of carboxyl magnetic bead activation buffer containing 2.5 mg of EDC and 2.5 mg of Sulfo-NHS, and incubated at room temperature (20~30 °C) for 20 min. The supernatant was removed by magnetic separation, and 1 mL of carboxyl magnetic bead coupling buffer containing 250 μg of human APRIL protein, 2.5 mg of EDC and 2.5 mg of Sulfo-NHS was added to the activated MNPs-COOH, and incubated at 4 °C in a refrigerator for 12 h. The supernatant was removed by magnetic separation, and 0.5 mL of freshly prepared 2x binding solution was added, and stored at 4 °C in a refrigerator for standby. IgG-MNPs and HSA-MNPs were prepared by using the same preparation procedure.

[0063] (5) 10 nmoL of the newly synthesized single-stranded DNA (ssDNA) random library was dissolved in 500 μL sterilized water, denatured at 95 °C for 10 min and immediately ice-bathed for 10 min, then added to an equal volume of the APRIL-MNPs (2 mg) solution prepared in step (4) and dispersed in 2x binding solution, and incubated at 37 °C with slight shaking for 60 min. After magnetic separation, it was washed with washing solution for 3 times, boiled in a boiling water bath for 10 min, and then magnetic separation was performed to obtain ssDNA sequences combined with APRIL-MNPs.

[0064] (6) Preparation of secondary library: The ssDNA sequences combined with APRIL-MNPs obtained in step (5) were used as templates, and unlabelled upstream primer AGCAGAGTTCACGACCCGATAAG and biotin-labelled downstream primer Biotin-CTGCGACGATTGGTATGTAACTC were added for PCR to amplify the obtained DNA sequences. The specific PCR amplification conditions are shown in Table 1:

[0065] Table 1 PCR amplification conditions

[0066]

[0067] Amplification conditions: 95 °C: 5 min, 95 °C: 30 s, 64 °C: 30 s, 72 °C: 30 s, 72 °C: 5 min, 12 °C storage.

[0068] Then, the ssDNA secondary library was separated by alkaline denaturation: 5 mg of streptavidin magnetic beads (SA-MNPs) were taken and washed with PBS buffer (0.01 M, pH 7.4, same below) for 3 times. Then, 1 mL of biotin-labelled double-stranded DNA obtained by PCR amplification was added to the washed SA-MNPs, and incubated at room temperature for 60 min. After washing with PBS for 3 times, 50 μL of 0.2 M NaOH solution was added, and incubated at room temperature for 5 min. After magnetic separation, the supernatant was transferred to a new centrifuge tube, and an appropriate amount of 0.2 M HCl solution was added to adjust the pH value to 7.0. After desalination with a desalination column, the secondary library was used for the next round of screening.

[0069] (7) Counter-screening and multiple rounds of screening: repeat steps (5) and (6) twice to obtain enough ssDNA sequences that bind tightly to APRIL-MNPs. From the fourth round, increase the counter-screening procedure to remove ssDNA sequences that non-specifically bind to APRIL. First, the secondary library obtained from the previous round of screening is incubated with 500 μg of HSA-MNPs and IgG-MNPs, respectively, at 37 °C with slight shaking for 30 min. After magnetic separation, the supernatant is added to 2 mg of APRIL-MNPs and incubated for 60 min. The supernatant is discarded after magnetic separation, 200 μL of sterilized water is added to the APRIL-MNPs and boiled in a boiling water bath for 10 min. After magnetic separation, the supernatant is taken. Repeat step (6) to prepare a new secondary library for use in the next round of screening.

[0070] (8) Ligand competition screening: from the tenth round of screening, increase the ligand competition to bind APRIL. Repeat step (7), and add 5 μg of ligand protein (human TACI and human BCMA) to the solution during the final reaction with APRIL-MNPs. After magnetic separation, the APRIL-MNPs are washed with the washing solution for 6 times, 200 μL of sterilized water is added to the APRIL-MNPs and boiled in a boiling water bath for 10 min. After magnetic separation, the supernatant is taken. Repeat step (6) to prepare a new secondary library for use in the next round of screening.

[0071] (9) During the screening process, to improve the affinity and specificity of the nucleic acid aptamer, the screening pressure is gradually increased during the screening process, including reducing the secondary library (from 10 nmoles to 100 pmoles), the amount of target (from 2 mg to 200 μg), the amount of IgG-MNPs and HSA-MNPs (from 0.5 mg to 2 mg), shortening the positive screening time (from 60 min to 15 min), increasing the counter-screening time (from 30 min to 90 min), and increasing the number of washes (from 3 times to 6 times). After 15 rounds of screening, the enrichment of the secondary library reaches a plateau, and the product of the last round of screening is selected for PCR amplification, cloning, and sequencing analysis.

[0072] (10) Sequence alignment and analysis are performed using DNAMAN software, and a total of 4 nucleic acid aptamer sequences that can bind to APRIL are identified (named AP-1 (SEQ ID NO. 1), AP-2 (SEQ ID NO. 2), AP-3 (SEQ ID NO. 3), and AP-4 (SEQ ID NO. 4), respectively). Further simulation and prediction of the secondary structure of the 4 nucleic acid aptamers is performed. The results, as shown in Figure 1 , the 4 candidate nucleic acid aptamers all have typical stem-loop structures, which participate in the formation of the higher structure of the nucleic acid aptamer and affect the specificity, affinity, and neutralization ability of the nucleic acid aptamer.

[0073] (11) Identification of the nucleic acid aptamer: The four candidate neutralizing nucleic acid aptamers obtained in step (10) were dissolved in lx binding solution to a concentration of 100 nM, and then added to 96-well plates coated with human APRIL, human HSA and human IgG, 100 μL per well. Incubation was performed at 37°C for 60 min, and then the plates were washed three times with washing solution. Then, 100 μL of SA-HRP working solution was added and incubation was continued for 60 min. The plates were washed six times with washing solution, and then 100 μL of TMB color developing solution was added to each well, and color development was performed at 37°C for 10 min. Finally, 50 μL of stop solution was added, and the absorbance of each well at 450 nm was immediately measured using a microplate reader. The results are shown in Figure 2 , and it was found that the four candidate nucleic acid aptamer sequences could all bind to human APRIL, and the binding ability of AP-2 was relatively strong and the specificity was the best. Therefore, the nucleic acid aptamer AP-2 was selected as a representative for further study.

[0074] Example 2: Truncation and optimization of neutralizing nucleic acid aptamer and determination of its secondary structure and affinity

[0075] According to the secondary structure of AP-2 (A in Figure 3 ), the nucleic acid aptamer was truncated and optimized to obtain a neutralizing nucleic acid aptamer with a shorter sequence and higher affinity (B in Figure 3 ). The affinities of the nucleic acid aptamer before and after optimization were further determined. Biotin-modified neutralizing nucleic acid aptamers of different concentrations (0 nM, 1 nM, 5 nM, 30 nM, 50 nM, 100 nM, 200 nM, 300 nM, 400 nM, 500 nM) were added to 96-well plates coated with human APRIL (the amount of human APRIL coated in each well was the same), and the subsequent operations were the same as in step (11) in Example 1. Then, the difference between the average absorbance of each group and the absorbance of the blank control was taken as the vertical coordinate, and the concentration of the neutralizing nucleic acid aptamer was taken as the horizontal coordinate. Curve fitting was performed according to the nucleic acid aptamer affinity calculation formula Y = Bmax X / (Kd + X) (Y: relative average absorbance value; Bmax: maximum absorbance value; X: concentration of neutralizing nucleic acid aptamer; Kd: dissociation constant), and the Kd value was calculated. The smaller the Kd value, the greater the affinity, and vice versa. The results are shown in Figure 3 C and D, and it was found that after structural modification, the sequence length of the neutralizing nucleic acid aptamer was shortened from 83 bp to 48 bp, and the Kd value was reduced from 79.4 ± 27.6 nM (C in Figure 3 ) to 10.27 ± 6.9 nM (D in Figure 3 ).

[0076] Example 3: tertiary structure simulation and molecular docking of neutralizing aptamer

[0077] According to the secondary structure of the neutralizing aptamer with the optimized sequence as shown in SEQ ID NO. 5 (A in Figure 4 , B in Figure 4 ), the tertiary structure of the neutralizing aptamer was simulated using 3dRNA / DNA software (A in Figure 5 , B in Figure 6 ), and then the crystal structure file of the APRIL protein (PDB ID: 4zch) was downloaded from the RCSB PDB Database. The protein structure was pre-processed using PyMOL, the heteroatoms (solvent molecules, small molecules, etc.) were deleted and repaired, and the A chain in the APRIL protein was retained as the protein structure for docking. Finally, molecular docking was performed using the HDOCK program. The results are shown in Figure 5 and Figure 6 . The neutralizing aptamer can form salt bridges, attractive charges, hydrogen bonds, carbon-hydrogen bonds, Pi hydrogen bonds, and hydrophobic (Pi-Sigma, Pi alkylation) interactions with the APRIL protein. The docking index reached -379.14 at a confidence level of 0.990, indicating that the neutralizing aptamer has strong binding ability with APRIL.

[0078] Example 4: determination of neutralizing ability of APRIL neutralizing aptamer

[0079] The ELISA detection kit for human APRIL (Proteintech, KE00645) was used to detect the neutralizing ability of the neutralizing aptamer as shown in SEQ ID NO. 5. First, 100 µL of different concentrations (0 nM, 10 nM, 100 nM, 500 nM, 1 µM) of the neutralizing aptamer (SEQ ID NO. 5) were mixed with 100 ng / mL of human APRIL protein, and then added to the 96-well enzyme-labeled plate coated with human TACI or human BCMA protein (the same amount of human TACI or human BCMA protein was coated in each well). Each group had 6 replicate wells, and the mixture was incubated at 37°C for 60 min. After washing 3 times with washing buffer, 100 µL of biotin-conjugated APRIL antibody in the kit was added to each well, and the mixture was incubated at 37°C for another 60 min. After washing 3 times with washing buffer, 100 µL of SA-HRP solution was added to each well, and the mixture was incubated at 37°C for another 60 min. After washing 6 times with washing buffer, 100 µL of TMB color developing solution was added to each well, and the mixture was color developed at 37°C for 10 min. Then, 50 µL of stop solution was added to each well to stop the color developing reaction. Finally, the absorbance of each well at 450 nm was measured using an enzyme-labeled instrument. The results are shown in Figure 7As shown, the absorbance value of each well gradually decreased with the increase of the concentration of the neutralizing aptamer. When the concentration of the neutralizing aptamer reached 1 µM, the absorbance value no longer decreased, which indicated that the neutralizing aptamer at a concentration of 1 µM could better block the binding of APRIL to its ligand.

[0080] Example 5: Determination of the toxicity of the APRIL neutralizing aptamer to human PBMC

[0081] The peripheral blood mononuclear cells (PBMC) of a healthy person were isolated, and the specific steps were as follows: 1 mL of 2.5 U / mL heparin sodium solution was mixed with 12.5 mL of whole blood of a healthy person and 11.5 mL of PBS uniformly, and then 7.5 mL of Ficoll solution was slowly added along the wall of the tube. Centrifugation was performed at 18°C, 600 g for 30 min, and the middle layer of the liquid was carefully aspirated to obtain the PBMC. The PBMC was washed once with 15 mL of PBS solution, and finally centrifuged at 4°C, 500 g for 10 min, and the precipitate was resuspended with freshly prepared 1640 complete culture medium and counted. Subsequently, the cells were added to a 96-well plate for culture, 5×10 5 cells per well, and 1 μg / mL of R848 was added for stimulation, and the culture was performed at 37°C, 5% CO2 for 24 h. Then, 0 µM, 0.1 µM, 0.5 µM, 1 µM, 2 µM, and 4 µM of the neutralizing aptamer as shown in SEQ ID NO. 5 were added to each experimental group, and the culture was performed at 37°C, 5% CO2 for 24 h. Subsequently, 10 μL of CCK8 reagent was added to each well of cells, and the culture was continued for 4 h. The absorbance value of each well at 450 nm was detected by using an enzyme label instrument. The results are shown in FIG. 5. Figure 8 As shown, the cell viability of the experimental group and the control group was equivalent, and there was no significant difference, which indicated that the neutralizing aptamer had low toxicity and good biological safety to PBMC cells.

[0082] Example 6: Determination of the inhibition of the antibody secretion ability of human PBMC by the APRIL neutralizing aptamer

[0083] The PBMC of a healthy person were isolated (the operation was the same as in Example 5), and the cells were added to a 24-well plate, 2×10 6 cells per well, and 3 repeats were set in each group, and 1 μg / mL of R848 was added for stimulation and culture, and then 0 µM, 0.5 µM, 1 µM, 2 µM, and 4 µM of the neutralizing aptamer as shown in SEQ ID NO. 5 were added to each experimental group, and the culture was performed at 37°C, 5% CO2

[0084] for 5 d, and the cell culture supernatant was collected, and the secretion of each type of antibody was detected by using ELISA. The results are shown in FIG. 6. Figure 9As shown, with the increase of the concentration of the neutralizing aptamer, the secretion of IgM, IgG1, IgG2 and IgG3 showed a gradually decreasing trend. When the concentration of the neutralizing aptamer reached 2 µM, the secretion of IgM and IgG1 had a very significant difference compared with the control group. When the concentration of the neutralizing aptamer reached 4 µM, the secretion of IgG2 and IgG3 had a very significant and significant difference compared with the control group, respectively. The above results showed that the neutralizing aptamer could significantly inhibit the secretion of IgM, IgG1, IgG2 and IgG3 antibodies of R848-stimulated human PBMC when the dosage of the neutralizing aptamer reached a certain concentration, which had great potential and clinical transformation prospects for the treatment of autoimmune diseases caused by excessive secretion of autoantibodies.

Claims

1. A neutralizing nucleic acid aptamer that specifically binds to human APRIL, characterized in that, The nucleotide sequence of the neutralizing nucleic acid aptamer is shown in SEQ ID NO.2 or SEQ ID NO.5.

Images