Method for regulating soluble sugar in tea tree by CsCDCAa gene and application of CsCDCAa gene
By constructing a CsCDCAa gene silencing vector to silence the expression of the CsCDCAa gene in tea plants, the problem of low soluble sugar content in tea plants was solved, thereby improving the quality of tea and the dissolution rate of effective components.
Patent Information
- Application Number
- CN202510880056.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-10-28
AI Technical Summary
There is a lack of effective gene regulation methods in the current technology to increase the content of soluble sugars in tea plants, which affects the quality of tea.
By constructing CsCDCAa gene silencing vectors, especially pTRV2-CsCDCAa, the expression of the CsCDCAa gene in tea plants was silenced, thereby increasing the content of soluble sugars in tea leaves.
It significantly increased the content of soluble sugars in tea leaves, improved the quality of tea, reduced the cellulose content, and provided a foundation for the production of high-quality tea.
Smart Images

Figure CN120843534A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method and application of the CsCDCAa gene in regulating soluble sugars in tea plants. Background Technology
[0002] The tea plant (Camellia sinensis L.) is a perennial economic crop. Its tender shoots and leaves, processed into tea, are rich in beneficial health-promoting components such as tea polyphenols, free amino acids, caffeine, and sugars. The quality of tea leaves determines its potential economic value. The formation of tea quality mainly depends on changes in the flavor and aroma compounds; however, tea quality is influenced by various factors. Among these, the composition and structure of the tea leaves not only affect the tea itself but also its processing.
[0003] For example, harder tea leaves can affect the shaping of tea leaves, while less flexible leaves are more prone to breakage. Furthermore, the composition and structure of tea leaves also influence the extraction rate of flavor compounds in the finished tea product. Therefore, by regulating the structural components of tea leaves, high-quality tea with excellent appearance and easily soluble active ingredients can be produced. However, apart from environmental influences, substances affecting the quality of tea leaves, such as soluble sugars and cellulose, are mainly controlled by genes, and currently, there are almost no reports on the relevant regulatory genes.
[0004] Therefore, it is necessary to provide a method and application for regulating the soluble sugars in tea plants using the CsCDCAa gene, in order to solve or at least alleviate the technical problem of how to increase the soluble sugars in tea plants through gene regulation. Summary of the Invention
[0005] The main objective of this invention is to provide a method and application for regulating the soluble sugar content of tea plants using the CsCDCAa gene, aiming to solve the aforementioned technical problem of how to increase the soluble sugar content of tea plants through gene regulation.
[0006] To achieve the above objectives, the present invention provides a CsCDCAa gene, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides a recombinant plant expression vector for expressing the CsCDCAa gene as described above.
[0008] The present invention also provides a recombinant plant expression vector, wherein the construction process of the recombinant plant expression vector includes inserting a nucleotide sequence as shown in SEQ ID NO.2 between the EcoRI and SmaI restriction sites of the pSH737 vector.
[0009] The present invention also provides a gene silencing vector for silencing the CsCDCAa gene in tea plants.
[0010] Furthermore, the gene silencing vector comprises pTRV2-CsCDCAa.
[0011] Furthermore, the construction process of the gene silencing vector includes inserting the nucleotide sequence shown in SEQ ID NO.4 between the EcoRI and BamHI restriction sites of the pTRV2 vector.
[0012] The present invention also provides the application of gene silencing vectors as described above in improving the quality of tea tree leaves.
[0013] Furthermore, the leaf material includes one or more of soluble sugar content and cellulose content.
[0014] Furthermore, the quality of the tea tree is Wuniuzao.
[0015] The present invention also provides a method for regulating the soluble sugars of tea plants by the CsCDCAa gene, comprising: introducing a gene silencing vector as described above into Agrobacterium, and culturing tea plants after vacuum infection with the Agrobacterium.
[0016] Compared with the prior art, the present invention has at least the following advantages:
[0017] This invention provides a CsCDCAa gene for regulating tea leaf quality. By silencing the CsCDCAa gene in tea plants and reducing its expression, the soluble sugar content in tea leaves can be increased, thereby regulating tea leaf quality and producing high-quality tea with excellent appearance and easily soluble active ingredients. This invention analyzes the traits of CsCDCAa transgenic lines and measures leaf quality, laying the foundation for breeding new varieties using the CsCDCAa gene. Specifically, in this invention, while the relative expression level of the CsCDCAa gene in all pTRV2-CsCDCAa lines is significantly lower than that in WT and pTRV2 lines, the soluble sugar content (fresh weight) of all pTRV2-CsCDCAa lines is not lower than that of WT and pTRV2 lines, and the overall trend is higher than that of WT and pTRV2 lines. The cellulose content is also higher than that of WT and pTRV2 lines. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.
[0019] Figure 1 The images show actual tobacco callus, regenerated buds, and regenerated plants of WT and CsCDCAa gene transgenic plants in Example 4 of this invention; in the images, WT is a wild-type tobacco plant and CsCDCAa is a transgenic tobacco plant.
[0020] Figure 2 The images show actual photos of wild-type plants and CsCDCAa gene-transgenic tobacco plants transplanted 5 days prior in Example 5 of this invention, as well as identification images obtained through GUS staining. From top to bottom, the first and second horizontal rows are actual photos, and the third horizontal row is an identification image obtained through GUS staining. From left to right, columns (a) and (b) are wild-type plants, and columns (c) to (g) are CsCDCAa gene-transgenic tobacco plants, corresponding to CsCDCAa-1 to CsCDCAa-5 respectively.
[0021] Figure 3 The images show wild-type plants and CsCDCAa gene-transgenic tobacco plants and leaves transplanted 20 days prior in Example 5 of this invention; A is a front view, B is a top view, C is the fourth leaf, columns (a) and (b) are wild-type plants, and columns (c) to (g) are CsCDCAa gene-transgenic tobacco plants, corresponding to transgenic lines CsCDCAa-1 to CsCDCAa-5 respectively.
[0022] Figure 4 The soluble sugar content of wild-type plants and CsCDCAa gene-transgenic tobacco plants in Example 6 of this invention; Figures 4-6 Among them, WT-1 to WT-2 are wild-type lines 1 and 2, and CsCDCAa-1 to CsCDCAa-5 are transgenic lines 1 to 5;
[0023] Figure 5 The relative expression levels of the CsCDCAa gene in wild-type plants and transgenic tobacco plants in Example 7 of this invention;
[0024] Figure 6This is an analysis of tea tree branches with VIGS-silenced CsCDCAa gene in Example 10 of the present invention; WT is a wild-type tea tree branch, pTRV2 is a tea tree branch with empty vector control, and pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-6 are tea tree branches with VIGS-silenced CsCDCAa gene; in the first horizontal row from top to bottom, except for WT and pTRV2, they are arranged from left to right in the order of pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-6; in the figure, WT is wild-type, pTRV2 is empty vector control, and pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-6 are silenced lines 1-6;
[0025] Figure 7 This is an analysis of the soluble sugar content in the branches and leaves of VIGS-silenced CsCDCAa tea trees in Example 10 of the present invention; in the figure, WT is the wild type, pTRV2 is the empty control, and pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-7 are the silenced strains 1-7.
[0026] Figure 8 This is an analysis of the cellulose content in the branches and leaves of VIGS-silenced CsCDCAa tea trees in Example 10 of the present invention; in the figure, WT is the wild type, pTRV2 is the empty control, and pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-7 are the silenced strains 1-7.
[0027] Figure 9 This is an analysis of the relative expression level of CsCDCAa in VIGS-silenced CsCDCAa tea plants in Example 11 of the present invention; in the figure, WT is wild type, pTRV2 is empty control, and pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-7 are silenced strains 1-7.
[0028] The realization of the objective, functional characteristics and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation
[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0030] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.
[0031] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention, as well as the prior art known to those skilled in the art and the description of this invention, may be implemented using any prior art methods, devices, and materials similar to or equivalent to those described, used, or made of materials in the embodiments of this invention.
[0032] This invention provides a CsCDCAa gene, the nucleotide sequence of which is shown in SEQ ID NO.1, the coding region nucleotide sequence of which is shown in SEQ ID NO.2, and the amino acid sequence of the protein encoded by which the CsCDCAa gene is shown in SEQ ID NO.3. This invention uses data obtained from differences in leaf denticles among different populations of ancient tea trees, combined with tea tree genome data, to locate this gene using genome-wide association analysis.
[0033] In this invention, the nucleotide sequence of SEQ ID NO.1 is as follows:
[0034] Genomic Sequence
[0035] >TEA031660Scaffold566:2391705-2399880
[0036]
[0037]
[0038]
[0039]
[0040] In this invention, the nucleotide sequence of SEQ ID NO.2 is as follows:
[0041] CDS Sequence
[0042] >TEA031660Scaffold566:2391705-2399880
[0043]
[0044] In this invention, the amino acid sequence of SEQ ID NO.3 is as follows:
[0045] Protein Sequence
[0046] >TEA031660Scaffold566:2391705-2399880
[0047]
[0048] This invention also provides a recombinant plant expression vector for expressing the CsCDCAa gene. The construction process of the recombinant plant expression vector includes inserting a nucleotide sequence as shown in SEQ ID NO.2 between the EcoRI and SmaI restriction enzyme sites of the pSH737 vector. The recombinant plant expression vector comprises pSH737-35S-CsCDCAa-GUS.
[0049] This invention also provides a gene silencing vector for silencing the CsCDCAa gene in tea plants; the vector is a virus-mediated gene silencing vector; the gene silencing vector comprises pTRV2-CsCDCAa. The construction process of the gene silencing vector includes: inserting the UTR region of CsCDCAa, i.e., the nucleotide sequence shown in SEQ ID NO.4, between the EcoRI and BamHI restriction enzyme sites of the pTRV2 vector.
[0050] In this invention, the nucleotide sequence of SEQ ID NO.4 is as follows:
[0051]
[0052] The present invention also provides an application of the CsCDCAa gene in increasing the soluble sugar content of tea plants. In this application, the quality of tea leaves is improved by inhibiting the expression of the CsCDCAa gene in tea plants. Specifically, this can be achieved by silencing the CsCDCAa gene in tea plants, thereby increasing the soluble sugar content of tea plants.
[0053] The present invention also provides an application of the gene silencing vector as described above in improving the leaf quality of tea plants. In this application, the gene silencing vector is introduced into Agrobacterium, the Agrobacterium is used to vacuum-infect tea plant tissues, and then the tea plant tissues are cultured to obtain tea plants that can improve leaf quality.
[0054] In this invention, the leaf material includes one or more of soluble sugar content and cellulose content; specifically, it can be soluble sugar content, or cellulose content, or both soluble sugar content and cellulose content.
[0055] Preferably, the quality of tea trees is improved by increasing the content of soluble sugars in tea leaves; specifically, improving the quality of tea leaves means increasing the content of soluble sugars in tea leaves.
[0056] In this invention, the quality of the tea tree is Wuniuzao.
[0057] The present invention also provides a method for regulating the soluble sugar content of tea plant by the CsCDCAa gene, comprising: introducing a silencing vector of the tea plant CsCDCAa gene into Agrobacterium, specifically introducing a gene silencing vector as described above into Agrobacterium; and culturing the tea plant by vacuum infection with the Agrobacterium, specifically by vacuum infection of the tea plant tissue with the Agrobacterium and then culturing the tea plant tissue.
[0058] During the experiment, the sequence of the CsCDCAa (putative cell division cycle ATPase) gene in tea was cloned to obtain its complete sequence. Subsequently, bioinformatics analysis was performed on it. By constructing a plant expression vector, the target fragment was linked to initiate the expression of the GUS reporter gene. The recombinant plant vector was then used to genetically transform tobacco, thereby verifying the function of CsCDCAa. The traits of the CsCDCAa transgenic lines were analyzed, and leaf quality was measured, laying the foundation for breeding new varieties using the CsCDCAa gene.
[0059] The experimental process of this invention includes:
[0060] (1) Obtaining the target gene sequence;
[0061] (2) Bioinformatics analysis of genes;
[0062] (3) Construction of plant expression vectors and virus-mediated gene silencing vectors;
[0063] (4) The plasmid containing the target gene was introduced into Agrobacterium GV3101 by the freeze-thaw method;
[0064] (5) Genetic transformation of target plants using Agrobacterium tumefaciens-mediated methods;
[0065] (6) Virus-mediated gene silencing in tea tree branches;
[0066] (7) Analysis of gene expression in target plants.
[0067] The main reagents used in the experiments of this invention include:
[0068] (1) YEP solid medium: 10 g / L peptone + 10 g / L yeast extract + 5 g / L sodium chloride + 7.5 g / L agar powder, pH = 7.2;
[0069] (2) YEP liquid medium: 10 g / L yeast extract + 10 g / L peptone + 5 g / L sodium chloride, pH = 7.2;
[0070] (3) Tea tree branch resuspension: 4.474 g / L MS + 30 g / L sucrose + 2 mg / L 6-BA + 0.1 mg / L NAA + 20 mg / L LAS, pH = 5.8-6.0;
[0071] (4) Tea tree branch culture medium: 0.2 mg / L 6-BA + 0.3 mg / L GA3 + 25 mg / L chloramphenicol, pH = 5.8-6.0;
[0072] (5) Tobacco resuspension: 4.74 g / L MS + 30 g / L sucrose + 20 mg / L AS, pH = 5.8-6.0;
[0073] (6) Tobacco co-culture medium: 4.74 g / L MS + 30 g / L sucrose + 7 g / L agar powder + 1.0 mg / L 6-BA + 0.1 mg / L NAA, pH = 5.8-6.0;
[0074] (7) Tobacco screening medium: 4.74 g / L MS + 30 g / L sucrose + 7 g / L agar powder + 1.0 mg / L 6-BA + 0.1 mg / L NAA + 100 mg / L Tim + 50 mg / L Kana, pH = 5.8-6.0;
[0075] (8) Tobacco rooting medium: 2.39 g / L MS + 30 g / L sucrose + 6.5 g / L agar powder, pH = 5.8-6.0.
[0076] The following are specific examples of the present invention:
[0077] Example 1
[0078] Target gene sequence obtained:
[0079] Data obtained from the differences in leaf tooth characteristics of ancient tea trees were used to analyze the CsCDCAa (TEA031660.1) gene sequence obtained by genome-wide association analysis (GWAS) and combined with the tea tree genome database, as shown in SEQ ID NO.1.
[0080] Example 2
[0081] Bioinformatics analysis of the CsCDCAa gene:
[0082] Online software was used to predict the conserved domains of CsCDCAa, and the results showed that the CsCDCAa protein belongs to the P-loop_NTPase superfamily and the AAA_assoc superfamily.
[0083] Example 3
[0084] pSH737-35S-CsCDCAa-GUS recombinant plasmid (constructed by the company) was introduced into Agrobacterium:
[0085] 1. Take 100 μL of GV3101 Agrobacterium competent cells stored at -80℃ and thaw them on ice or at room temperature;
[0086] 2. Under aseptic conditions, add 1 μg of pSH737-35S-CsCDCAa-GUS plasmid DNA (volume not exceeding 1 / 10 of the competent cell volume) to the freshly thawed competent cell suspension, mix gently, and incubate in an ice-water bath for 5 min.
[0087] 3. Place the centrifuge tubes in liquid nitrogen for 5 minutes to freeze quickly;
[0088] 4. Quickly place the centrifuge tubes in a 28°C water bath for 5 minutes, without shaking the cultured bacterial solution.
[0089] 5. Place the centrifuge tubes back into the ice-water bath and keep them there for another 5 minutes;
[0090] 6. Under aseptic conditions, add 700 μL of antibiotic-free YEB or LB liquid medium and incubate at 28°C with shaking for 2-3 hours;
[0091] 7. Centrifuge at 6000 rpm for 1 min to collect the bacteria. Retain approximately 100 μL of supernatant and gently resuspend the cells by pipetting. Add this to a YEP solid medium plate containing the appropriate antibiotic. Spread the cells evenly using a sterile bacterial spreader. After the liquid in the plate has been completely absorbed, invert the plate and incubate at 28°C for 2-3 days (72-90 h at 28°C if the plate contains 50 μg / mL Rif; 48-60 h at 28°C if the plate contains 50 μg / mL Kana and 20 μg / mL Rif), until single colonies appear.
[0092] 8. Strain preservation: Pick a single colony and incubate overnight in 10 mL of YEP liquid medium containing 50 mg / L Rif and 50 mg / L Kana with shaking until OD... 600 When the concentration reaches 1.0, add 500 μL of glycerol and 500 μL of bacterial solution to a 1.5 mL sterile centrifuge tube, mix gently, seal with sealing film and label, freeze quickly in liquid nitrogen, and then store in an ultra-low temperature freezer at -80°C.
[0093] Example 4
[0094] Agrobacterium-mediated CsCDCAa genetic transformation of tobacco:
[0095] 1. Agrobacterium activation and culture:
[0096] Agrobacterium strain GV3101 containing the pSH737-CsCDCAa plant expression vector, which was transformed and preserved in Example 3, was taken from a -80℃ freezer and inoculated onto YEP solid medium (50 mg / L Rif, 50 mg / L Kana) and cultured upside down in a 28℃ incubator for 2–3 days. A single colony was picked and inoculated into 10 mL of YEP liquid medium (50 mg / L Rif, 50 mg / L Kana) and cultured at 28℃ with shaking at 200 rpm for 24 h. 1 mL of the above bacterial culture was then inoculated into 50 mL of YEP liquid medium (50 mg / L Rif, 50 mg / L Kana) for expansion culture and cultured at 28℃ with shaking at 200 rpm. Measure the OD600 value of the bacterial suspension based on its turbidity. When the OD600 is between 0.3 and 0.6, transfer the bacterial suspension into a 50 mL centrifuge tube, centrifuge at 4°C and 5000 rpm for 10 min, discard the supernatant, and resuspend in an equal volume of resuspension.
[0097] 2. Agrobacterium-mediated genetic transformation in tobacco:
[0098] Use leaves from sterile tobacco seedlings as explants (if not sterile seedlings, disinfect the explants first: disinfect with 75% alcohol for 1 minute, rinse with sterile water, then disinfect with 2% sodium hypochlorite for 30 minutes, and rinse with sterile water). Cut the leaves into 1cm×1cm cubes with a sterile blade and immerse them in the resuspension for 6-8 minutes, shaking continuously to ensure full contact between the bacterial solution and the leaves. Remove the leaves and blot the bacterial solution from the leaf surface with sterile absorbent paper. Arrange the leaves tightly in the co-culture medium with the leaf surface facing down, label them, seal them with sealing film, and co-culture them in a 25℃ dark incubator for 2 days. Cut tobacco leaves into 1cm×1cm cubes, leaving half for infection with the resuspension (method as above) as a control, and keep the culture conditions unchanged.
[0099] 3. Selection and rooting of resistant buds:
[0100] Tobacco leaves that have undergone dark culture were transferred to a selection medium (50 mg / L Kana, 100 mg / L Tim) and cultured in a light-controlled tissue culture room at 25°C. The medium was changed every 14 days, and contaminated medium was removed promptly. When the resistant buds grew to about 1-2 cm, they were cut off and transferred to a rooting medium (50 mg / L Kana, 100 mg / L Tim). When the root system of the tobacco tissue culture seedlings was fully developed, hardening-off treatment was performed and the seedlings were transplanted.
[0101] 4. Hardening off and transplanting of tobacco seedlings:
[0102] When the tobacco plants grow to 6-8cm and have a relatively complete root system, remove the culture bottles from the light-lit tissue culture room and place them outdoors in a shaded area. Remove the sealing film and allow them to harden off for about 7 days (during which time it is important to ensure that the leaves do not lose too much water). After that, wash the culture medium off the roots with water and transplant them into greenhouse soil for cultivation. (Observe whether there are any differences in morphology between wild-type plants and transgenic plants during the growth process).
[0103] In this embodiment, please refer to the actual images of tobacco callus, regenerated buds, and regenerated plants transformed with the CsCDCAa gene. Figure 1 As shown.
[0104] Example 5
[0105] Identification of T0 generation transgenic tobacco plants:
[0106] 1. GUS histochemical staining of transgenic plants:
[0107] After the transplanted tobacco plants have survived (5 days), cut small leaves from the tobacco plants and put them into centrifuge tubes. Add 200 μl of GUS staining solution to completely submerge the leaves. After labeling, place the centrifuge tubes in a 37°C incubator overnight. Discard the GUS staining solution and decolorize the leaves in ethanol solutions of different concentrations in a gradient until the leaves turn white. Observe and take pictures.
[0108] In this embodiment, the actual images of wild-type plants and CsCDCAa transgenic tobacco plants, as well as the identification diagram of GUS staining, are shown below. Figure 2 As shown.
[0109] In addition, wild-type plants transplanted 20 days prior and CsCDCAa gene-transgenic tobacco plants and leaves are also shown in the attached image. Figure 3 As shown.
[0110] 2. DNA extraction from tobacco plants:
[0111] DNA was extracted from tobacco leaves 5 days after transplanting. The DNA from the plant samples was extracted using the CTAB method, and the specific steps are as follows:
[0112] (1) Grinding of materials: Take about 0.1g of leaves and grind them into fine powder in liquid nitrogen, then place them in a solution containing 1mL of DNA extraction solution.
[0113] (2) Incubate in a 65°C water bath for 45 minutes, mixing every 15 minutes. Cool to room temperature.
[0114] (3) Add 500 μL of chloroform:isoamyl alcohol = 24:1, mix vigorously for 15 s to emulsify, let stand for 10 min, and centrifuge at 13000 rpm for 10 min; take the supernatant into a new EP tube. Repeat this step once.
[0115] (4) Add an equal volume of pre-cooled isopropanol and mix gently.
[0116] (5) Place in -20℃ for 1 hour, then centrifuge at 13000 rpm for 10 minutes.
[0117] (6) Discard the supernatant and keep the white precipitate. Wash with 1 mL of 75% ethanol. Repeat this step once.
[0118] (7) Use a pipette to remove all the liquid at the bottom.
[0119] (8) Open the tube cap and place it in a fume hood to dry until there is no alcohol smell (DNA is not easy to dissolve when it is too dry).
[0120] (9) Add 50 μL of RNafress H2O to dissolve.
[0121] (10) Detect DNA concentration using a nucleic acid concentration analyzer.
[0122] 3. PCR identification of tobacco genomic DNA:
[0123] The primer design is as follows:
[0124] CsCDCAa-F:GGACAGGTTTGTGAAGAGAAGA;
[0125] CsCDCAa-R:TGACCAAAGCCCACCAATAA.
[0126] The target gene was amplified using tobacco genomic DNA as a template. The reaction system consisted of 20 μL (2.0 μL template DNA, 7.0 μL ddH2O, 0.5 μL 5' primer, 0.5 μL 3' primer, and 10 μL Premix Ex Taq), with the reaction program set according to the primer annealing temperature. The PCR products were detected by agarose gel electrophoresis (concentration determined by the size of the amplified DNA fragment). The results showed that all five transplanted tobacco plants were positive transgenic plants.
[0127] Example 6
[0128] Determination of soluble sugars in T0 generation transgenic tobacco plants:
[0129] 1. Determination of soluble sugars in transgenic tobacco (anthrone colorimetric method):
[0130] (1) Reagent preparation: Prepare a 200 μg / mL glucose standard solution (glucose is prepared after being dried to constant weight in an oven at 80℃); prepare a 1 g / L anthrone-dilute sulfuric acid reagent (dilute sulfuric acid is prepared by diluting 760 mL of concentrated sulfuric acid to 1000 mL).
[0131] (2) Extraction of soluble sugars: Weigh 0.5g of fresh plant leaves, add 4mL of 80% alcohol to a mortar, grind carefully into a homogenate, pour into a centrifuge tube, place in an 80℃ water bath and stir continuously for 30min, centrifuge at 5000rpm for 10min, collect the supernatant in a 10mL graduated test tube, add 2mL of 80% alcohol to the residue and extract once more, combine the supernatants. Add 0.5g of activated carbon to the supernatant, decolorize in an 80℃ water bath for 30min, make up to 10mL, filter, and take the filtrate (diluted 10 or 20 times) for analysis.
[0132] (3) Colorimetric analysis: Take 1 mL of the above sugar extract and place it in a clean, dry test tube. Add 5 mL of anthrone reagent and mix. Boil in a water bath for 10 min, remove and cool. Then measure the absorbance on a spectrophotometer at a wavelength of 625 nm. Find the sugar content in the filtrate from the standard curve (or calculate using a linear regression formula), and then calculate the percentage of sugar in the sample.
[0133] (4) Plotting the standard curve: Dilute the standard glucose solution to prepare a series of solutions with different concentrations, namely 0, 30, 60, 90, 120, 150, and 180 μg of glucose per mL. Measure the absorbance of each solution using the method described above, and then plot the A curve. 625 A sugar concentration curve can be obtained, or a linear equation can be derived through linear regression.
[0134] (5) Calculate the sugar content in the sample: Soluble sugar content (%) = (C×V) / (W×10) 6 )×100%; Let V be the volume of the diluted plant sample (mL); C be the sugar content of the extract (μg / mL); and W be the fresh weight of the plant tissue (g).
[0135] See Figure 4 As shown, the results indicate that, except for strain 2, the soluble sugar content of other transgenic strains decreased. Specifically, the soluble sugar contents of WT-1, WT-2, CsCDCAa-1 to CsCDCAa-5 were 0.21%, 0.22%, 0.16%, 0.28%, 0.11%, 0.16%, and 0.17%, respectively.
[0136] Example 7
[0137] Expression level of the CsCDCAa gene in transgenic tobacco plants:
[0138] The leaves of T0 generation tobacco were rapidly frozen with liquid nitrogen and then stored in a -80°C freezer for later use.
[0139] 1. RNA extraction from tobacco leaves (follow the instructions for the RNA extraction kit):
[0140] (1) Place the weighed leaves into a pre-cooled mortar, pour in liquid nitrogen and grind into powder, then transfer to a centrifuge tube.
[0141] Simultaneously, add 400 μL of lysis buffer and 400 μL of dilution buffer to a centrifuge tube, mix thoroughly, incubate at room temperature for 5 min, and centrifuge at maximum speed for 5 min.
[0142] (2) Take 400 μL of anhydrous ethanol and add it to a 1.5 mL centrifuge tube prepared in advance. Add the supernatant to the tube and pipette it thoroughly 3-4 times. After mixing thoroughly, add it to the filter column and centrifuge at 13000 rpm at room temperature for 1 min. Discard the filtrate (if one is not enough, it can be added to the column in two batches).
[0143] (3) Add 600 μL of washing solution to the column, centrifuge at 13000 rpm at room temperature for 1 min, and discard the filtrate;
[0144] (4) Add 50 μL of incubation solution (40 μL of nuclease-free water and 10 μL of DNase I dilution) to the column and incubate at room temperature for 15 min;
[0145] (5) Add 600 μL of washing solution to the adsorption column, centrifuge at 13000 rpm at room temperature for 1 min, discard the filtrate, repeat once, centrifuge for 2 min, and discard the collection tube.
[0146] (6) Place the adsorption column into a new collection tube, add 60 μL of nuclease-free water to the center of the membrane to dissolve the RNA precipitate, incubate at room temperature for 5 min, centrifuge at 12000 rpm at room temperature for 1 min, aspirate the liquid below again and add it to the adsorption column, incubate at room temperature for 2 min, centrifuge at 12000 rpm at room temperature for 1 min (in order to improve RNA yield).
[0147] (7) Concentration detection: The concentration of RNA samples was determined using a micro spectrophotometer, and the samples were stored at -80℃ after the concentration was found to be qualified.
[0148] 2. RNA is reverse transcribed into cDNA:
[0149] (1) Calculate the amount of RNA required for reverse transcription based on the concentration, and construct a 20 μL system;
[0150] (2) Melt the reagents in the reverse transcription kit at room temperature. After melting, briefly centrifuge to allow the sample on the wall to settle to the bottom of the tube, and then place it on ice. Prepare the reverse transcription mixture (pre-mix the large sample) as follows: 4 μL of 5×tureReaction Mix, 1 μL of Oligo, the amount of Total RNA calculated according to the concentration, and RNase-Free ddH2O to 20 μL;
[0151] (3) Mix the prepared reverse transcription solution thoroughly by pipetting, incubate in a 42℃ metal bath for 20 min, incubate in an 85℃ metal bath for 5 min, and then store in a -20℃ refrigerator after cooling to 4℃.
[0152] 3. Detection of CsCDCAa gene expression level by real-time PCR:
[0153] (1) Using the online quantitative primer design software IDT (https: / / sg.idtdna.com / pages / tools), specific quantitative primers were designed based on the specific sequence of the target gene's CDS, as follows:
[0154] CsCDCAa-F:GACACTATCTGGGCTGCTTAAT;
[0155] CsCDCAa-R:CTGGGTCTAGTCTGTCTTTGTG.
[0156] (2) Take 1 μL of the cDNA solution obtained by reverse transcription as a template, prepare the reaction mixture (mix the large sample first), mix well and dispense into PCR eight-tube tubes. The reaction mixture preparation system is as follows: 10 μL of 2×SYBR Buffer, 1 μL of cDNA template, 0.5 μL of 5' primer, 0.5 μL of 3' primer, 8 μL of RNase-Free ddH2O, and a total system of 20 μL.
[0157] (3) Briefly centrifuge to ensure no bubbles are generated. If bubbles are present, gently tap the tube wall. Place the tube in a real-time quantitative PCR instrument and set the PCR program according to the primer characteristics.
[0158] (4) The obtained data is analyzed and exported using software.
[0159] See Figure 5 As shown, the results indicate that the expression levels of all transgenic tobaccos were higher than those of WT. The relative expression levels of the CsCDCAa gene in the WT-1, WT-2, CsCDCAa-1 to CsCDCAa-5 lines were 1.01, 0.68, 45.96, 15.63, 151.71, 35.64, and 29.16, respectively.
[0160] Example 8
[0161] pTRV2-CsCDCAa recombinant plasmid (constructed by the company) was introduced into Agrobacterium (refer to Example 3):
[0162] In this embodiment, when constructing the pTRV2-CsCDCAa recombinant plasmid, the UTR region of CsCDCAa, namely SEQ ID NO.4, is inserted between the EcoRI and BamHI restriction sites of the pTRV2 vector.
[0163] Example 9
[0164] Virus-mediated silencing of the CsCDCAa gene in tea tree branches (VIGS):
[0165] 1. Agrobacterium activation and culture:
[0166] (1) Take the frozen bacterial solution (pTRV2-CsCDCAa, pTRV2, pTRV1 Agrobacterium strains) out of the -80℃ freezer and thaw at room temperature. Use an inoculation loop to take the bacterial solution and streak it on YEP solid medium (containing 50 mg / L Kana, 50 mg / L Rif), and incubate upside down at 28℃ for 2 days;
[0167] (2) Pick a single colony and inoculate it into 10 mL of YEP liquid medium (containing 50 mg / L Kana and 50 mg / L Rif), and culture at 28°C and 200 rpm for 18 h with shaking.
[0168] (3) Take 2-3 mL of the above bacterial culture and inoculate it into 250 mL of YEP liquid medium (containing 50 mg / L Kana and 50 mg / L LRif), and incubate at 28°C with shaking at 200 rpm until OD. 600 Reached 1.2;
[0169] (4) Centrifuge (4℃, 5000-6000 rpm, 10 min), discard the supernatant, and resuspend in an equal volume of resuspension (or with a final concentration OD of 1.2). Mix the resuspended pTRV2-CsCDCAa and pTRV1 Agrobacterium (experimental group), and mix pTRV2 and pTRV1 Agrobacterium (control group). After mixing, sonicate for 1 min and activate by shaking at 28℃ for 1 h.
[0170] 2. Preparation and vacuum inoculation of plant materials:
[0171] (1) Cut the tea tree branches (semi-lignified) into 15-20cm sections with axillary buds, leaving 1-2 intact leaves.
[0172] (2) Place the prepared tea tree branches into a vacuum bottle containing a mixed bacterial solution of pTRV2-CsCDCAa and pTRV1 Agrobacterium, or a mixed bacterial solution of pTRV2 and pTRV1 Agrobacterium, and evacuate the vacuum twice. (WT uses a resuspension for vacuuming)
[0173] (3) Remove the branches and thoroughly dry the excess bacterial liquid on the branches and leaves.
[0174] (4) Place the branches in the culture solution and incubate in the dark for 3 days.
[0175] (5) After dark culture, culture in an artificial climate chamber for 30 days, and change the culture medium every 10 days.
[0176] Example 10
[0177] 1. For the condition of some tea tree branches of the WT (vacuum-suspended), pTRV2 (corresponding to a mixed culture of pTRV2 and pTRV1 Agrobacterium), and pTRV2-CsCDCAa (corresponding to a mixed culture of pTRV2-CsCDCAa and pTRV1 Agrobacterium) strains cultured for 30 days in Example 9, please refer to [the original text is missing]. Figure 6 As shown.
[0178] 2. The soluble sugar content of new leaves from tea branches after 30 days of culture of the WT, pTRV2, and pTRV2-CsCDCAa strains in Example 9 was detected, referring to Example 6.
[0179] See Figure 7 As shown, the soluble sugar content (fresh weight) of all pTRV2-CsCDCAa strains was no less than that of the WT and pTRV2 strains; specifically, the soluble sugar contents of WT, pTRV2, pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-7 were 1.99%, 2.08%, 2.08%, 3.33%, 5.84%, 2.27%, 5.02%, 5.91%, and 2.52%, respectively.
[0180] 3. Cellulose content in tea leaves was determined by anthrone colorimetric method after 30 days of cultivation.
[0181] (1) Main reagents: concentrated H2SO4, anthrone.
[0182] 2% Anthrone Reagent: Dissolve 2g of anthrone in 100mL of ethyl acetate and store in a brown reagent bottle.
[0183] Cellulose standard solution: Accurately weigh 100 mg of pure cellulose and place it in a 100 mL volumetric flask. Place the flask in an ice bath, then add 60-70 mL of cold 60% H₂SO₄. Digest under cold conditions for 20-30 min, then dilute to the mark with 60% H₂SO₄ and mix well. Pipette 5.0 mL of this solution into another 50 mL volumetric flask, place the flask in an ice bath, and dilute to the mark with distilled water. Each mL contains 100 μg of cellulose.
[0184] (2) Plot the standard curve for cellulose:
[0185] a. Take 6 small test tubes and add 0, 0.40, 0.80, 1.20, 1.60, and 2.00 mL of cellulose standard solution, respectively. Then add 2.00, 1.60, 1.20, 0.80, 0.40, and 0 mL of distilled water, respectively, and shake well. Each tube will then contain 0, 40, 80, 120, 160, and 200 μg of cellulose, respectively.
[0186] b. Add 0.5 mL of anthrone reagent to each tube, then add 5.0 mL of concentrated H2SO4 along the tube wall, stopper the tube, and shake gently to promote the hydrolysis of ethyl acetate. When anthrone flocculents appear in the tube, shake vigorously to promote the dissolution of anthrone. Then immediately place the tube in a boiling water bath and heat for 10 minutes, then remove and cool.
[0187] c. Measure the absorbance at a wavelength of 620 nm. Plot a cellulose standard curve with the measured absorbance as the ordinate and cellulose content as the abscissa.
[0188] (3) Sample determination:
[0189] a. Accurately weigh the air-dried leaves, grind them, weigh 100mg, put them into a 100mL volumetric flask, place the volumetric flask in an ice bath, add 60-70mL of cold 60% H2SO4, digest under cold conditions for half an hour, then dilute with 60% H2SO4 to the mark, shake well, and filter.
[0190] b. Take 5.0 mL of the above filtrate and put it into a 50 mL volumetric flask. Place the volumetric flask in an ice bath, add distilled water to the mark, and shake well.
[0191] c. Take 2.0 mL of the supernatant, add 0.5 mL of 2% anthrone reagent, then add 5.0 mL of concentrated H2SO4 along the tube wall, stopper the tube, and then proceed as with the cellulose standard solution. Measure the absorbance of the sample at a wavelength of 620 nm.
[0192] (4) Calculation of results:
[0193] The absorbance of the sample was measured, and the cellulose content in the sample solution was calculated using a standard curve. Then, the cellulose content in the tea leaves was calculated using the following formula: X = (A × 10⁻⁶) / (A × 10⁻⁶)-6 ×C) / B×100%, where:
[0194] A: The cellulose content (μg) obtained from the standard curve;
[0195] B: Sample weight (g);
[0196] 10 -6 : The coefficient for converting μg to g;
[0197] C: The dilution factor of the sample;
[0198] X: Fiber content (%) in the sample.
[0199] See Figure 8 As shown, the cellulose contents of WT, pTRV2, pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-7 are 31.71%, 32.01%, 33.96%, 36.90%, 48.22%, 38.29%, 46.85%, 49.55%, and 34.89%, respectively.
[0200] Example 11
[0201] Expression level of CsCDCAa gene in new leaves of transgenic tea tree branches:
[0202] Referring to Example 7, the expression level of the CsCDCAa gene was determined in the new leaves of tea branches after 30 days of culture of the WT, pTRV2 and pTRV2-CsCDCAa lines in Example 9.
[0203] See Figure 9 As shown, the relative expression levels of the CsCDCAa gene in all pTRV2-CsCDCAa lines were significantly lower than those in the WT and pTRV2 lines. Specifically, the relative expression levels of the CsCDCAa gene in WT, pTRV2, pTRV2-CsCDCAa-1 to pTRV2-CsCDCAa-7 were 1.00, 0.98, 0.78, 0.75, 0.54, 0.77, 0.59, 0.51, and 0.73, respectively.
[0204] The above-described technical solutions provided by this invention are merely preferred embodiments and do not limit the scope of the patent. Any equivalent structural transformations made using the description and drawings of this invention under the technical concept of this invention, or direct / indirect applications in other related technical fields, are included within the scope of patent protection of this invention.
Claims
1. A CsCDCAa gene, characterized in that, The nucleotide sequence of the CsCDCAa gene is shown in SEQ ID NO.
1.
2. A recombinant plant expression vector, characterized in that, The recombinant plant expression vector is used for the expression of the CsCDCAa gene as described in claim 1.
3. A recombinant plant expression vector, characterized in that, The construction process of the recombinant plant expression vector includes inserting the nucleotide sequence shown in SEQ ID NO.2 between the EcoRI and SmaI restriction sites of the pSH737 vector.
4. A gene silencing vector, characterized in that, The gene silencing vector is used to silence the CsCDCAa gene in tea plants.
5. The gene silencing vector according to claim 4, characterized in that, The gene silencing vector includes pTRV2-CsCDCAa.
6. The gene silencing vector according to claim 4, characterized in that, The construction process of the gene silencing vector includes inserting the nucleotide sequence shown in SEQ ID NO.4 between the EcoRI and BamHI restriction sites of the pTRV2 vector.
7. The application of a gene silencing vector as described in any one of claims 4-6 in improving the quality of tea tree leaves.
8. The application according to claim 7, characterized in that, The leaf matter includes one or more of soluble sugars and cellulose.
9. The application according to claim 7, characterized in that, The tea tree in question is of the Wuniuzao variety.
10. A method for regulating the soluble sugars in tea plants using the CsCDCAa gene, characterized in that, include: The gene silencing vector as described in any one of claims 4-6 is introduced into Agrobacterium, and tea plants are cultured after being vacuum-infected with the Agrobacterium.