Protein CAG1 for regulating and controlling Cd transport and application thereof

By blocking the expression of the CTD phosphatase CAG1 and using gene editing technology to reduce cadmium accumulation in rice grains, the problem of cadmium accumulation in plant grains under heavy metal pollution was solved, and a significant reduction in cadmium accumulation and improvement of crop varieties were achieved.

CN120843572APending Publication Date: 2025-10-28CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410521026.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-04-28
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce the accumulation of the heavy metal cadmium (Cd) in plant grains, especially in rice grown on farmland contaminated with heavy metals, which affects food safety and ecosystem health.

Method used

By blocking the expression of CTD phosphatase CAG1, gene knockout or downregulation can be achieved using gene editing technologies such as the CRISPR-Cas9 system, leading to the inactivation of CTD phosphatase CAG1 and thus reducing the accumulation of cadmium in plant seeds.

Benefits of technology

It significantly reduces the accumulation of cadmium in plant seeds without affecting the yield and growth phenotype of the plants, providing genetic resources for breeding new crop varieties with low seed Cd accumulation, and improving food safety and environmental protection value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004815095500000011
    Figure HDA0004815095500000011
  • Figure HDA0004815095500000021
    Figure HDA0004815095500000021
Patent Text Reader

Abstract

The invention discloses a method for inhibiting Cd accumulation of plant grains by taking a CAG1 gene as a target, which comprises the following steps: down-regulating expression of CTD phosphatase CAG1 in a wild type plant chromosome genome, inactivating, weakening functions or knocking out, and reducing Cd accumulation of the plant grains. The invention provides a genetic strategy for cultivation of low-Cd accumulation plants and creation of plant germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to a protein CAG1 that regulates Cd transport and its uses. Specifically, it relates to a method for reducing Cd accumulation in plant seeds by blocking the expression of CTD phosphatase CAG1. Background Technology

[0002] In my country, approximately 20 million hectares of arable land are contaminated with heavy metals, accounting for about 20% of the total arable land area. Cadmium (Cd) enters the biosphere through plant absorption and is transferred through the food chain, causing serious harm to ecosystems and human health. In the early 20th century, a strange disease emerged in Toyama Prefecture, Japan, causing patients to experience bone softening, atrophy, and limb deformities. This disease, known as "bone cancer" or "Itai-Itai Disease," was caused by the long-term consumption of "Cd rice" and drinking Cd-contaminated water. For non-smokers, over 90% of Cd comes from food. A nationwide dietary study showed that the average Chinese person gets 56% of their total Cd intake from rice (Oryza sativa), while this proportion rises to 65% in southern China; wheat and vegetables account for 12% and 10% of total Cd intake, respectively (Song Y, Wang Y BN, Mao WF, et al. Dietary cadmium exposure assessment among the Chinese population[J]. PLoS One, 2017, 12.). Studying the regulatory mechanism of Cd in rice can provide important theoretical basis for breeding varieties with low Cd accumulation in grains and cultivating remedial rice varieties that address Cd accumulation in specific tissues.

[0003] The inventors previously reported a gene, Os02g0629800(CAL1), in patent CN108250280B that can control Cd accumulation in rice leaves. Patent document CN116716312A also reported an RLC gene that regulates Cd content in rice grains, and that knocking out this RLC gene can reduce the Cd content in rice grains. Summary of the Invention

[0004] In our research on reducing Cd accumulation in rice grains in Cd-contaminated fields, our research group discovered a gene, CAG1, through QTL map-based cloning of both parents. CAG1 regulates Cd accumulation in rice grains, and it positively regulates Cd accumulation. By performing a frameshift mutation on its coding region to inactivate the CTD phosphatase CAG1, we found a significant reduction in Cd in rice grains with minimal impact on grain yield and growth phenotype. This gene has the potential to be used as a target for breeding new plant varieties with low Cd accumulation in rice grains. Based on these findings, this invention includes the following technical solution.

[0005] A method for reducing Cd accumulation in plant grains by targeting the CAG1 gene includes the following steps: downregulating, inactivating, weakening or knocking out the expression of CTD phosphatase CAG1 (NCBI number Os02g0639000, amino acid sequence SEQ ID NO:1) in the chromosomes of wild-type plants, thereby reducing Cd accumulation in plant grains such as rice.

[0006] The nucleotide sequence of the expression gene CAG1 of the above-mentioned CTD phosphatase CAG1 (NCBI number Os02g0639000, amino acid sequence SEQ ID NO:1) is SEQ ID NO:2, which consists of a 5'UTR region, a 3'UTR region, introns and exons (coding region, i.e., CDS); wherein the nucleotide sequence of the exon (coding region, i.e., CDS) in the expression gene CAG1 is SEQ ID NO:3.

[0007] In one implementation, the above method is carried out in the following manner:

[0008] (1) Knock out the gene CAG1 (NCBI number Os02g0639000) from the chromosome of wild-type plants;

[0009] (2) Downregulate the expression level of gene CAG1 (NCBI code Os02g0639000) in the chromosomes of wild-type plants;

[0010] (3) Replace the CAG1 gene in the chromosome of wild-type plants with a CAG1 mutant that has lost or downregulated coding function; and / or

[0011] (4) Block, inhibit or interfere with the expression of gene CAG1 in the chromosomes of wild-type plants.

[0012] Specifically, method (2) can be selected from the following group:

[0013] (2-1) Mutations in the promoter region and / or coding region of the CAG1 gene lead to downregulation of the expression level of the CAG1 gene;

[0014] (2-2) Mutations in the upstream regulators of the CAG1 gene lead to downregulation of CAG1 expression; or

[0015] (2-3) Introduce interacting proteins of CTD phosphatase CAG1 into wild-type plants to alter the function of the CAG1 gene.

[0016] Optionally, the mutation in the coding region described in method (2-1) is a frameshift mutation, which leads to inactivation or loss of function of CTD phosphatase CAG1.

[0017] In one implementation, the mutation in the coding region described in method (2-1) above is a frameshift mutation, selected from the following group of forms:

[0018] (a) The coding region of gene CAG1 (NCBI number Os02g0639000), i.e., the CDS nucleotide sequence SEQ ID NO:3, has the base G deleted after position 213, forming the mutant cag1. TN1 -1, which causes the translation of CTD phosphatase CAG1 amino acid sequence to terminate at amino acid position 98 of SEQ ID NO:1;

[0019] (b) A codon such as ACA or AAT is inserted after position 214 in the coding region of gene CAG1 (NCBI number Os02g0639000), i.e., the CDS nucleotide sequence SEQ ID NO:3, forming the mutant cag1. TN1 -2, which causes the translation of CTD phosphatase CAG1 amino acid sequence to terminate at amino acid position 79 of SEQ ID NO:1.

[0020] Accordingly, in one embodiment, the gene CAG1 mutant described in method (3) above can be the mutant cag1. TN1 -1 or the mutant cag1 TN1 -2.

[0021] Optionally, the steps of the method described above are implemented using gene editing technology, antisense nucleic acids, and transcriptional regulation.

[0022] Although theoretically, overexpressing the exogenous gene CAG1 mutant, such as cag1, in plants like rice can be achieved... TN1 -1 or the mutant cag1 TN1 While mutations such as -2 may achieve the goal of reducing Cd accumulation in plants by altering the plant genome, considering that overexpression of exogenous genes often leads to abnormalities in plant physiological homeostasis, this invention preferably uses gene editing technology, antisense nucleic acids, and transcriptional regulation to change the plant genome.

[0023] In one implementation, the gene editing technology described above may be selected from the group consisting of: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0024] Alternatively, conventional recombinant plasmid transformation protocols that enable plants, such as rice, to overexpress exogenous gene CAG1 mutants can be implemented in conjunction with gene editing technologies such as CRISPR systems.

[0025] The aforementioned plants may be monocotyledonous plants, preferably grass crops, selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum, with rice being the preferred plant.

[0026] A second aspect of the invention provides a low-seed Cd-accumulating plant, which is constructed according to the method described above.

[0027] A third aspect of the present invention provides a method for identifying rice varieties with low Cd accumulation in their grains, comprising the following steps:

[0028] Sequencing of the rice gene Os02g0639000, and / or

[0029] The determination was made to determine whether the protein expressed by the rice cells contained a polypeptide with the amino acid sequence shown in SEQ ID NO:1.

[0030] When the detection results show that the nucleotide sequence of the corresponding gene Os02g0639000 in the rice genome is not SEQ ID NO:1, or the coding region, i.e., the CDS nucleotide sequence, is not SEQ ID NO:3, or the protein expressed by rice cells does not contain the amino acid sequence CTD phosphatase CAG1 as shown in SEQ ID NO:1, it indicates that the rice has a low Cd accumulation trend in the grains, and this rice variety is selected as a candidate for a low Cd accumulation variety in the grains.

[0031] The advantage of the aforementioned gene identification scheme lies in the fact that it is possible to pre-assess, solely in the laboratory, whether candidate plant varieties have the potential to reduce Cd accumulation in plant grains. Since the entire life cycle of crops such as rice is typically one year or six months, normally examining their biological traits and phenotypes through field cultivation would inevitably consume a significant amount of time and resources, incurring substantial land and labor costs. In contrast, the gene identification scheme can be completed in the laboratory, allowing for gene sequencing in a short period, such as on seedlings within a few weeks, or even just on seeds. This significantly improves efficiency and substantially saves time, space, and labor costs, resulting in substantial economic benefits.

[0032] The aforementioned gene locus Os02g0639000 is of significant social and environmental value in addressing the food safety issue of Cd accumulation in rice grains. Approximately 20 million hectares of arable land in my country are contaminated with heavy metals, accounting for about 20% of the total arable land area. This is particularly severe in major rice-producing areas such as Hunan. Therefore, the importance of analyzing gene loci such as Os02g0639000, which are related to the regulation of Cd accumulation in grains, for the breeding of rice varieties with low Cd accumulation in grains is self-evident.

[0033] A fourth aspect of the present invention provides a kit for carrying out the above-described identification method, comprising the following PCR primers for amplifying the gene CAG1:

[0034] Forward primer RT-CAG1-F: ACCATGCACCGTCAAGATAC (SEQ ID NO:4),

[0035] Reverse primer RT-CAG1-R: CTCCACCTTAGAACCACACTTC (SEQ ID NO:5).

[0036] Preferably, the above-described kit may further include the following PCR primers for detecting the internal reference gene Actin2:

[0037] Forward primer RT-ACTIN2-F: AGGTATCGCTGACCGTATGAG (SEQ ID NO:6),

[0038] Reverse primer RT-ACTIN2-R: CATCTGCTGGAATGTGCTGA (SEQ ID NO:7).

[0039] Furthermore, the kit also includes an instruction manual, which describes the steps and identification criteria for detecting the rice gene Os02g0639000.

[0040] For example, the instructions can be written on bottles, test tubes and similar objects, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper document with an operation demonstration video app download window or a QR code. The instructions can also be in multimedia form, such as a CD, USB flash drive, or cloud storage.

[0041] This invention newly discovered a CTD phosphatase CAG1 (NCBI ID Os02g0639000, amino acid sequence SEQ ID NO:1), which regulates Cd transport in rice. Certain CAG1 molecules... TN1 Mutants, such as the cag1 frameshift mutant formed by deleting the base G after position 213 of the coding gene SEQ ID NO:3. TN1 The frameshift mutant cag1 is formed by inserting a base such as ACA or AAT after position -1 or after position 214. TN1 -2 has the effect of reducing Cd accumulation in rice grains, and has little impact on agronomic traits such as yield and biomass of rice. Therefore, this gene mutation strategy can be applied to the improvement of crop varieties, reduce the accumulation of Cd in grains of crops in Cd-contaminated fields, and provide a very valuable gene resource for the development of new crop varieties with low grain Cd accumulation. It has the value of promotion and application. Attached Figure Description

[0042] Figure 1This diagram illustrates the process of map-based cloning of the gene CAG1, which controls Cd accumulation in rice grains. Figures A and B show the QTL site CAG1, which regulates Cd accumulation in rice grains. Fine mapping revealed it to be located within a 32 kb genetic region between molecular markers RM324 and RM450 on chromosome 2, ultimately identifying gene Os02g0639000 as the target gene CAG1. This gene encodes a CTD phosphatase. Six single nucleotide polymorphisms (SNPs) in the CAG1 coding region caused amino acid alterations between the two parents, CJ06 and TN1 (Figure B). In Figure B, A, B, and H represent the genotypes of rice varieties CJ06, TN1, and heterozygous, respectively. The vertical axis of the bars in Figure B, R1-R4 and CKB, represent near-isogenic lines containing the target QTL region and carrying different TN1 fragments. CKA represents a near-isogenic line selected with the target QTL region of CJ06. The six sites refer to amino acids, showing the differences in the nucleotide sequences causing the changes at these six amino acid sites.

[0043] Figure 2 The expression pattern and subcellular localization analysis of CAG1 are shown. AB: Bar graphs showing the expression levels of CAG1 in rice roots and shoots in response to cadmium stress. The subjects were rice seedlings at the two-leaf-one-heart stage, treated with 10 μM CdCl2, with Actin2 as the internal reference gene. C: Bar graphs showing the expression levels of CAG1 in different rice tissues, including roots, lower leaf sheaths, lower leaf blades, flag leaf sheaths, flag leaf blades, Node I, Node II, internode I, rachis, and spikelets. Values ​​= mean ± standard deviation, n = 3 or 4. Statistical analysis: One Way ANOVA Turkey (A, B), * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; Student's t test (C); DE: CAG1 TN1 GUS activity assay of root tips (Figure D) and root maturation zones (Figure E) of Pro-GUS transgenic genetic material; FG: CAG1 TN1 Promoter GUS activity is mainly located in the vascular sheath cells of the root tip (Fig. F) and root maturation zone (Fig. G); HK: CAG1 TN1 Transient expression and colocalization analysis of the -eYFP fusion protein and nuclear localization marker NLS-RFP in rice protoplasts.

[0044] Figure 3 This shows that the CAG1 mutation reduces Cd accumulation in rice grains. A: Wild-type rice TN1 (i.e., cag1) TN1 ) and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Bar graph showing the difference in Cd content in rice grains; B: Wild-type rice TN1 (i.e., cag1) TN1 ) and mutant cag1 TN1 -1 or the mutant cag1 TN1 -2 Bar graph showing the difference in Cd content in brown rice of rice; C: SR-μXRF analysis of wild-type rice TN1 and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Differences in the distribution and content of Cd in brown rice; C: wild-type rice TN1 and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Rice; D: Wild-type rice TN1 and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Differences in Cd accumulation in the aboveground parts (shoot) of rice; E: Wild-type rice TN1 and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Differences in Cd accumulation in rice roots; F: Wild-type rice TN1 and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Phenotypic photographs of rice plants; G: Wild-type rice TN1 and mutant cag1 TN1 -1 and the mutant cag1 TN1 -2 Analysis of yield differences per rice plant. This figure also suggests that the CTD phosphatase CAG1 may have the function of inhibiting the translocation of Cd from the plant roots to the aboveground parts.

[0045] Figure 4The phylogenetic analysis of CAG1 is shown. Haplotypes Hap1, Hap2, and Hap3 are three subtypes of CAG1 in rice varieties. A: The three haplotypes of CAG1; "0" indicates that the left bases of the first row of bases at the SNP position are identical, and "1" indicates that the right bases of the first row of bases at the SNP position are identical. B: Distribution of CAG1 haplotypes in Indica and Japonica rice. C: Differentiation of CAG1 in rice populations; the numbers represent Fst, which characterizes population differentiation: less than 0.15 indicates insignificant differentiation, 0.15-0.25 indicates significant differentiation, 0.25-0.5 indicates substantial differentiation, and greater than 0.5 indicates highly significant differentiation. D: Phylogenetic tree of CAG1 populations. E: Differences in Cd accumulation in grains of rice varieties with the three CAG1 haplotypes. Detailed Implementation

[0046] In our research on cadmium reduction technology in rice, our research group discovered that CTD phosphatase CAG1 (NCBI number Os02g0639000) and other enzymes are involved in regulating C transport.

[0047] Further research revealed that, compared to wild-type plants such as rice, frameshift mutations in the CTD phosphatase CAG1 gene (NCBI code Os02g0639000) SEQ ID NO:3, involving the deletion of the base G after position 213 or the insertion of the bases ACA or AAT after position 214, reduced Cd accumulation in grains. These frameshift mutations are positive mutations with a negative regulatory effect on Cd accumulation in grains. This finding provides a design strategy for gene mutations in improving rice and other crop varieties, enabling them to adapt to cultivation in Cd-contaminated fields.

[0048] The CTD phosphatase CAG1 in rice (Oryza sativa) is sometimes referred to as OsCAG1, and is usually abbreviated as CAG1, which is easily understood by those skilled in the art.

[0049] As used in this article, the term "wild type" refers to native plants such as rice TN1 and CJ06 that have a normal phenotype and express the normal CTD phosphatase CAG1 gene (NCBI number Os02g0639000).

[0050] Correspondingly, the terms "low-grain Cd-accumulating plants," "transgenic plants," and "genetically engineered plants" in this article have the same meaning, all referring to plants that have low grain Cd accumulation after being genetically engineered from wild-type plants or plants with the original normal biological phenotype.

[0051] For ease of description, mutants expressing CTD phosphatase CAG1, such as cag1, may sometimes be used. TN1-1 or the mutant cag1 TN1 Transgenic plants with a mutation rate of -2, such as rice, retain the name of the mutant enzyme. For example, they could use the name CAG1. TN1 -1 or cag1 TN1 -2 is used to indicate that the transgenic rice expressing this mutant enzyme is a rice mutant / mutant plant.

[0052] In some implementations, the term "(grain Cd accumulation or grain Cd content) reduction" or "reduction" can mean a decrease of at least 10% compared to a reference level (e.g., normal plant), such as a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a decrease of 100%, or any decrease between 10% and 100%, or a decrease of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0053] In this document, for the sake of simplicity, the gene CAG1 (NCBI ID Os02g0639000, encoding amino acid sequence SEQ ID NO:1) of a certain protein, such as CTD phosphatase CAG1, is sometimes used interchangeably with the name of its encoding gene (DNA). Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or category of CTD phosphatase CAG1 (NCBI ID Os02g0639000), it refers to a protein; when describing it as a gene, it refers to the gene encoding the enzyme.

[0054] There are various techniques for inactivating, attenuating, and / or preventing the expression of CTD phosphatase CAG1 in plants. These techniques can be used individually or in combination. For example, one inactivation method is to mutate the gene encoding CTD phosphatase CAG1, causing an alteration in the amino acid sequence of the polypeptide and / or terminating translation. For instance, a frameshift mutation deleting the base G after position 213 of the CAG1 gene in SEQ ID NO:3 leads to translation termination at amino acid 98 of SEQ ID NO:1, or a frameshift mutation inserting the bases ACA or AAT after position 214 leads to translation termination at amino acid 79 of SEQ ID NO:1.

[0055] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0056] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0057] Example

[0058] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0059] In the embodiments, if the operating temperature is not specifically specified, it generally refers to room temperature (15-35°C).

[0060] Materials and methods

[0061] The gene sequencing and primer synthesis in this embodiment were outsourced to Sangon Biotech (Shanghai) Co., Ltd.

[0062] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0063] It should be noted that, for ease of description, in the embodiments, the plant number and gene number, such as cag1, can be used. TN1 -1 or cag1 TN1 -2 share the same number, which is easily understood by those skilled in the art, meaning that the same number can refer to different biological forms in different environments.

[0064] Example 1: Map-based cloning of the CAG1 gene and its sequence information

[0065] The initial population for Cd accumulation in grains was a double haploid obtained by crossing the high-Cd-accumulating parent TN1 with the low-Cd-accumulating parent CJ06. The genotype and grain Cd accumulation phenotype of each individual plant in the population were statistically analyzed, and major QTL loci were calculated using Map Marker / QTL software. To clone CAG1, we used CJ06 as the recurrent parent and TN1 as the donor parent, and after multiple generations of backcrossing, screened individual plants from a genetic population of 3651 BC3F3 plants that exhibited crossovers in the target chromosomal region. The Cd accumulation in the BC3F4 progeny of these individual plants was then determined. Through genotype-ion-phenotype linkage analysis, near-isogenic lines containing the 32Kb substitution fragment on chromosome 2 belonging to TN1 were screened, and candidate genes were analyzed by sequencing.

[0066] Figure 1 This illustrates the process of map-based cloning of the gene CAG1, which controls Cd accumulation in rice grains. Map-based cloning and sequencing analysis confirmed that the cloned gene regulating Cd accumulation in rice grains is the CTD phosphatase CAG1 gene (Os02g0639000). See [link to documentation]. Figure 1 The nucleotide sequence of the gene CAG1 is SEQ ID NO:2, which consists of a 5'UTR region, a 3'UTR region, introns, and exons (coding region, i.e., CDS); the nucleotide sequence of the exons, i.e., CDS, is SEQ ID NO:3.

[0067] Example 2: CAG1 Expression Pattern and Subcellular Localization Analysis

[0068] Expression of CAG1 in near-isogenic rice lines with TN1 and CJ06 backgrounds and its regulatory relationship with cadmium stress ( Figure 2 AC). Near-isogenic lines were hydroponically grown to the two-leaf-one-heart seedling stage, treated with 10 μM CdCl2, and roots and aboveground parts were collected to analyze the correlation between CAG1 expression under TN1 and CJ06 backgrounds and cadmium stress. Figure 2 (AB). Analysis of CAG1 expression patterns in different tissues of near-isogenic rice lines with TN1 and CJ06 backgrounds ( Figure 2 The near-isogenic line (C) was grown in the Songjiang field until the rice heading stage, and samples were collected from different parts for analysis. Total RNA was extracted from the plants using TRIZOL reagent from Yingjun Company, following the reagent's instructions. Reverse transcription and real-time quantitative PCR were performed according to (Li et al., 2010), and the primers used are listed in Appendix 1. The internal control gene was Actin2.

[0069] Table 1. List of PCR primers

[0070]

[0071] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0072] We constructed CAG1 TN1 Transgenic materials with promoter-driven GUS (β-glucuronidase, reporter gene) expression, CAG1 was found to have GUS activity through analysis. TN1 It is mainly expressed in the vascular tissue of the root. Microscopic observation of semi-thin root sections showed that CAG1... TN1 It is mainly expressed in bundle sheath cells. 35S pro:CAG1 TN1 Transiently transformed rice protoplasts with the -eYFP and 35S pro:NLS-RFP plasmids, CAG1 was observed under a microscope. TN1 Localized within the cell nucleus. Analysis results showed... Figure 2 In DK.

[0073] Example 3: CAG1 gene of wild-type rice TN1 TN1 Mutation reduces Cd accumulation in rice grains but does not reduce yield.

[0074] We used the CRISPR-Cas9 tool to edit the CAG1 gene in the TN1 background, obtaining two homozygous mutants with different editing types.

[0075] I. The specific steps for constructing the CRISPR / Cas9 vector are as follows:

[0076] 1. First, the knockout target site of the target gene is selected, and the adapter is designed. The target primer for the CPL1 adapter is:

[0077] CAG1-U3-F: 5'ggcaGTCCAGGCTGCCCAAGGCAG 3',

[0078] CAG1-U3-R: 5'aaacCTGCCTTGGGCAGCCTGGA3'.

[0079] 2. Target adapter preparation: Dissolve the adapter primers in ddH2O to prepare a 100 μM stock solution. Take 1 μl of each upstream and downstream primer and add them to 98 μl of ddH2O to dilute to 1 μM. Reaction conditions: 90℃, denaturation for 30 s, then cool to room temperature for later use.

[0080] 3. gRNA expression cassette edge-cutting and ligation reaction (10 μl): 1 μl CutSmart Buffer, 0.25 μl BsaI (~5 U), 1 μl T4 DNALigase Buffer, 0.03 μl T4 DNALigase (~35 U), 0.5 μl target adapter, 1 μl gRNA vector plasmid (10~20 ng), 6.22 μl ddH2O. Reaction conditions: 37℃, 5 min; 20℃, 5 min, 5 cycles.

[0081] 4. First round of gRNA expression cassette amplification: Amplification was performed using two pairs of primers: a downstream primer of the U-F+ adapter and an upstream primer of the gRNA-R+ adapter. Each pair of primers corresponds to one target site, and the working primer concentration was 1 μM. The reaction system (15 μl) consisted of: 1.5 μl 10×KOD Plus Buffer, 1.5 μl 2 mM dNTPs, 0.75 μl 2.5 mM MgSO4, 0.5 μl cleavage-ligation product, 3 μl primer UF (gRNA-R), 3 μl downstream primer (upstream primer), 0.4 μl KOD Plus, and 4.35 μl ddH2O. Reaction conditions: 95℃, 10 s; 60℃, 15 s; 68℃, 20 s, 25–28 cycles.

[0082] 5. Second round of gRNA expression cassette amplification: Dilute the reaction products from the first round of amplification 10-fold, and mix 1 μl of each product as the template for this round. Amplification is performed using two primer pairs: B1'+B2 and B2'+BL, corresponding to U3 and U6a respectively. The primer working solution concentration is 1.5 μM. Reaction system (30 μl): 3 μl 10×KOD Plus Buffer, 3 μl 2 mM dNTPs, 1.5 μl 2.5 mM MgSO4, 2 μl template, 3 μl primers B1'+B2 (B2'+BL), 0.75 μl KOD Plus, 16.75 μl ddH2O. Reaction conditions: 95℃, 10 s; 58℃, 15 s; 68℃, 20 s, 15–20 cycles.

[0083] 6. gRNA expression cassette ligation to CRISPR / Cas9 vector: The ligation-by-cut method was used. Reaction system (15 μl): 1.5 μl CutSmart Buffer, 0.5 μl BsaI (~10 U), 1.5 μl T4 DNALigase Buffer, 0.03 μl T4 DNALigase (~35 U), 0.57 μl pYLCRISPR / Cas9 plasmid (60-80 ng), 20-30 ng gRNA vector plasmid (10-15 ng per target site), add ddH2O to 15 μl. Reaction conditions: 37℃, 2 min; 10℃, 3 min, 20℃, 5 min, 37℃, 2 min, 10-15 cycles.

[0084] 7. The ligation product was transformed into E. coli, and single clones were selected for identification to obtain CRISPR / Cas9 positive transformants.

[0085] 8. Use a plasmid extraction kit to extract plasmids from positive transformants to obtain CRISPR / Cas9 plasmids.

[0086] II. Escherichia coli transformation

[0087] 1. After removing the competent E. coli cells stored at -80℃, place them on ice for freeze-thaw cycles;

[0088] 2. Add the DNA ligation product or CRISPR / Cas9 plasmid obtained in step one, gently mix, and incubate on ice for 30 minutes.

[0089] 3. Then place it in a 42℃ water bath for 30 seconds for heat shock, and then quickly place it on ice to cool for 2 minutes;

[0090] 4. Add 600 μl of antibiotic-free LB or 2YT liquid medium and incubate at 37°C and 200 rpm for 1 h;

[0091] 5. Centrifuge at 4000 rpm for 1 min, remove excess supernatant, resuspend the bacterial cells by pipetting, and spread them onto LB or 2YT solid medium containing carrier resistance.

[0092] 6. Invert the petri dish into a 37℃ incubator and incubate for 1 day to obtain positive transformants.

[0093] 7. Plasmids were extracted from positive transformants using a plasmid extraction kit to obtain plasmids containing DNA ligation products and CRISPR / Cas9 plasmids, respectively.

[0094] III. Agrobacterium-mediated transformation

[0095] 1. After removing the Agrobacterium competent cells stored at -80℃, place them on ice for freeze-thaw cycles;

[0096] 2. After adding the plasmid obtained in step 2, gently stir to mix, and let stand on ice for 5 minutes;

[0097] 3. Then place in liquid nitrogen for 5 minutes and in a 37°C water bath for 5 minutes in sequence;

[0098] 4. Add 600 μl of antibiotic-free YEB liquid medium and incubate at 30°C and 200 rpm for 2 hours;

[0099] 5. Centrifuge at 4000 rpm for 1 min, remove excess supernatant, resuspend the bacterial cells by pipetting, and spread them onto YEB solid medium containing carrier resistance.

[0100] 6. Invert the petri dish into a 30℃ incubator and let it stand for 2-3 days to obtain recombinant Agrobacterium.

[0101] IV. Agrobacterium-mediated genetic transformation of mature japonica rice embryos

[0102] 1. Select rice grains after removing the husks, removing moldy, underdeveloped, and deformed inferior grains;

[0103] 2. Rinse three times with sterile water, soak in 75% alcohol for 1 minute, then add 40 ml of sterile water, 1 ml of sodium hypochlorite and 1-2 drops of Tween 20, mix well, shake at 200 rpm for 90 minutes in a shaker at 28℃, rinse three times with sterile water, blot dry with filter paper, and then sow in induction medium and culture for about 20 days.

[0104] 3. Remove adventitious roots and transfer the callus to a subculture medium. Allow the callus to grow to a suitable size for subsequent infection.

[0105] 4. Take 200 μl of the recombinant Agrobacterium obtained in step 3 (after shaking briefly) and add it to the solution containing Kan r In 25 ml of resistant Agrobacterium-activated culture medium, shake at 200 rpm for 3-4 hours at 28°C; take 15 ml of bacterial suspension, centrifuge at 5000 rpm for 10 min at room temperature, and collect the bacterial cells; resuspend the bacterial cells in 10 ml of AAM culture medium for later use;

[0106] 5. For each transgenic construct, select about 100 callus tissues of moderate size and strong viability, transfer them to a sterile culture dish, add an appropriate amount of AAM culture medium and 1 ml of AAM resuspension solution to completely submerge the callus tissues, and let stand for 15 min.

[0107] 6. Discard the bacterial culture and transfer it to a petri dish with two layers of filter paper on both the top and bottom. Each transgenic construction requires two petri dishes with two layers of filter paper. Change the filter paper a total of 4 times. During the third and fourth filter paper changes, let it stand for 30 minutes and 2 hours respectively to allow it to dry naturally.

[0108] 7. While drying the callus tissue, spread a layer of filter paper on each dish of the pre-prepared co-culture medium and add 1 ml of AAM culture medium. Let it air dry for 2 hours, avoiding making the filter paper too wet.

[0109] 8. Use tweezers to transfer the dried callus tissue to a co-culture medium and incubate at 25°C for 3 days;

[0110] 9. Transfer the callus tissue to a sterile Erlenmeyer flask, add 50ml of sterile water, wash 2-3 times, add another 50ml of sterile water, let stand for 30 minutes, and then discard the supernatant.

[0111] 10. Add 50ml of sterile water and 25mg of carbenicillin, mix well and let stand for 30 minutes, then discard the supernatant;

[0112] 11. Place the callus tissue in a culture dish with two layers of filter paper on both the top and bottom. Change the filter paper four times. During the third and fourth filter paper changes, let it stand for 30 minutes and 2 hours respectively to allow it to dry naturally.

[0113] 12. Transfer the callus tissue to selection medium S1, culture for 15-20 days, then transfer it to selection medium S2, continue culturing for 15-20 days, and then transfer it to differentiation medium.

[0114] 13. After emergence, transfer to rooting medium.

[0115] See results Figure 3 cag1 TN1 Cd accumulation in mutant grains was significantly lower than that in wild-type TN1 and cag1. TN1 The Cd content in the -1 kernels was 55.35% lower than that in the wild-type TN1; cag1 TN1 The Cd content in the -2 kernels was 59.61% lower than that in TN1 (Figure A). TN1 Cd accumulation in mutant brown rice was significantly lower than that in wild-type TN1. Figure 3 (B), where cag1 TN1 The Cd content in brown rice (-1) was 61.26% lower than that in TN1; cag1 TN1 The Cd content in brown rice (-2) was 62.58% lower than that in TN1. We tested the mutant cag1. TN1 The Cd content in the aboveground parts and roots of rice seedlings at the two-leaf-one-heart stage after treatment with 10 μM CdCl2 for 3 days ( Figure 3 (D and 3E). Compared with wild-type TN1, the mutant cag1 TN1 -1 and cag1 TN1 -2 The accumulation of Cd in the aboveground parts of seedlings was significantly reduced. Figure 3 D), while the mutant cag1 TN1-1 and cag1 TN1 The Cd content in the roots of the CAG1 mutant was significantly higher than that in the wild type, suggesting that the CTD phosphatase CAG1 may inhibit the translocation of Cd from the plant roots to the aboveground parts. We also examined the yield per plant; compared to the wild type TN1, the CAG1 mutant yield was significantly higher. TN1 -1 and cag1 TN1 The yield per plant under the -2 group did not change significantly (Figures F and G). This indicates that the gene mutation can effectively reduce the cadmium content and accumulation in rice grains without interfering with rice yield.

[0116] Example 4: Evolutionary Analysis of CAG1

[0117] We analyzed the CAG1 sequence of 574 rice varieties (see [link to relevant documentation]). Figure 4 The study found that three main haplotypes of CAG1 SNPs causing amino acid differences were identified in natural rice populations. In japonica rice, all CAG1 NPs were of the (haplotype) Hap1 type, while in indica rice, only 7% were of the Hap1 type, 43% were of the (haplotype) Hap2 type, and 50% were of the (haplotype) Hap3 type. Phylogenetic analysis showed that CAG1 differentiated among Indica and Japonica rice, as well as among the Or-I and Or-III subgroups of wild rice. Further analysis indicated that CAG1 in Indica rice originated from Or-I, which is mainly distributed in South and Southeast Asia, while CAG1 in Japonica rice originated from Or-III, which is mainly distributed in China. During domestication, the population differentiation level (Fst) of *O. rufipogon* was estimated to be 0.27, while that of *O. sativa* increased to 0.62. The Cd accumulation level in grains of the Hap1 variety was significantly lower than that of the Hap2 and Hap3 types. CAG1 can explain part of the difference in Cd levels between japonica and indica rice grains.

[0118] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0119] Acknowledgments: This research project was supported by the Ministry of Agriculture and Rural Affairs of the People's Republic of China and is a major project under the Ministry of Agriculture and Rural Affairs Science and Technology Innovation 2030 Program, project number: 2023ZD04072.

Claims

1. A method for reducing Cd accumulation in plant seeds by targeting the CAG1 gene, characterized in that, Includes the following steps: This method can downregulate, inactivate, weaken, or knock out the expression of CTD phosphatase CAG1 (NCBI ID Os02g0639000, amino acid sequence SEQ ID NO:1) in the chromosomes of wild-type plants.

2. The method as described in claim 1, characterized in that, Implemented in the following manner: (1) Knock out the gene CAG1 (NCBI number Os02g0639000) from the chromosome of wild-type plants; (2) Downregulate the expression level of gene CAG1 (NCBI code Os02g0639000) in the chromosomes of wild-type plants; (3) Replace the CAG1 gene in the chromosome of wild-type plants with a CAG1 mutant that has lost or downregulated coding function; and / or (4) Block, inhibit or interfere with the expression of gene CAG1 in the chromosomes of wild-type plants.

3. The method as described in claim 2, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the CAG1 gene lead to downregulation of the expression level of the CAG1 gene; (2-2) Mutation of upstream regulators of gene CAG1 leads to downregulation of gene CAG1 expression level; or (2-3) Introduce interacting proteins of CTD phosphatase CAG1 into wild-type plants to alter the function of the CAG1 gene.

4. The method as described in claim 3, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of CTD phosphatase CAG1.

5. The method as described in claim 4, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, selected from the following group of forms: (a) The coding region of gene CAG1 (NCBI number Os02g0639000), i.e., the CDS nucleotide sequence SEQ ID NO:3, has the base G deleted after position 213, forming the mutant cag1. TN1 -1; (b) An ACA or AAT base was inserted after position 214 in the coding region of gene CAG1 (NCBI number Os02g0639000), i.e., the CDS nucleotide sequence SEQ ID NO:3, to form the mutant cag1. TN1 -2. Accordingly, the gene CAG1 mutant described in method (3) as in claim 2 is the cag1 mutant as described in claim 5. TN1 -1 or the mutant cag1 TN1 -2.

6. The method as described in claim 1, characterized in that, The steps are implemented through gene editing technology, antisense nucleic acids, and transcriptional regulation.

7. The method as described in claim 1, characterized in that, The plants are grass crops, selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum.

8. A low-Cd-accumulating plant, characterized in that, It is constructed according to the method described in any one of claims 1-7.

9. A method for identifying rice varieties with low Cd accumulation in grains, characterized in that, Includes the following steps: Sequencing of the rice gene Os02g0639000, and / or The determination was made to determine whether the protein expressed by the rice cells contained a polypeptide with the amino acid sequence shown in SEQ ID NO:

1. When the detection results show that the nucleotide sequence of the corresponding gene Os02g0639000 in the rice genome is not SEQ ID NO:1, or the coding region, i.e., the CDS nucleotide sequence, is not SEQ ID NO:3, or the protein expressed by rice cells does not contain the amino acid sequence CTD phosphatase CAG1 as shown in SEQ ID NO:1, it indicates that the rice has a tendency for low Cd accumulation in the grains, and this rice variety is selected as a candidate for a variety with low Cd accumulation in the grains.

10. A kit for carrying out the method as described in claim 9, characterized in that, The following PCR primers are included for amplifying the CAG1 gene: Forward primer RT-CAG1-F: ACCATGCACCGTCAAGATAC (SEQ ID NO:4), Reverse primer RT-CAG1-R: CTCCACCTTAGAACCACACTTC (SEQ ID NO:5).

Citation Information

Patent Citations

  • A short peptide that reduces cadmium accumulation in the cytoplasm, its encoding gene and uses.

    CN108250280B

  • Gene for regulating and controlling heavy metal content of rice grains and application

    CN116716312A