Application of OsHTT7 protein in regulation and control of heat resistance and / or yield of rice

Abstract

The invention discloses application of OsHTT7 protein in regulation and control of heat resistance and / or yield of rice. According to the invention, a CRISPR / Cas9 gene editing system is utilized to perform mutation on a rice OsHTT7 gene, and an OsHTT7 mutant strain is constructed. The heat stress of the obtained mutant strain shows that the heat resistance of the rice can be remarkably improved by inhibiting the expression of the OsHTT7 gene. In addition, the invention also finds that inhibition of the expression of the OsHTT7 gene can significantly improve the single-plant yield of rice, thereby improving the rice yield. On the basis, the invention provides a method for improving heat resistance and / or yield of rice, which is beneficial to cultivation of heat-resistant and / or high-yield rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and rice seed and seedling cultivation or improvement technology. More specifically, it relates to the application of the OsHTT7 protein in regulating the heat tolerance and / or yield of rice. Background Technology

[0002] In recent years, global warming has become increasingly serious, and extreme weather events have become more frequent, posing a huge threat to agricultural production. Rice ( Oryza sativa Rice is one of the world's three major staple foods and is highly sensitive to heat; temperature is a major environmental factor limiting its yield and quality. To mitigate the adverse effects of global warming on rice growth, it is urgent to improve rice's heat tolerance and cultivate heat-resistant rice varieties so that they can grow normally even in extreme heat, ensuring yield and quality, and thus safeguarding food security.

[0003] Although many genes or proteins related to heat tolerance in rice have been reported, the breeding or improvement of rice varieties often involves multiple genes. Therefore, continuous discovery of genes that can regulate heat tolerance in rice is more conducive to the breeding or improvement of heat-tolerant rice seeds and seedlings. Summary of the Invention

[0004] This invention addresses the shortcomings of the prior art by providing the application of OsHTT7 protein in regulating heat tolerance and / or yield in rice.

[0005] The first objective of this invention is to provide the application of the OsHTT7 protein or the gene encoding the OsHTT7 protein in regulating the heat tolerance of rice.

[0006] A second objective of this invention is to provide the application of the OsHTT7 protein or the gene encoding the OsHTT7 protein in regulating rice yield.

[0007] A third objective of this invention is to provide a method for improving the heat resistance and / or yield of rice.

[0008] A fourth object of the present invention is to provide a reagent for inhibiting the expression of the gene encoding the OsHTT7 protein for use in improving the heat resistance of rice or in the preparation of products for improving the heat resistance of rice.

[0009] The fifth objective of this invention is to provide the application of a reagent for inhibiting the expression of the gene encoding the OsHTT7 protein in the cultivation of rice plants with improved heat resistance.

[0010] A sixth object of the present invention is to provide an agent for inhibiting the expression of the gene encoding the OsHTT7 protein for use in increasing rice yield or in the preparation of products for increasing rice yield.

[0011] The seventh objective of this invention is to provide the application of a reagent for inhibiting the expression of the gene encoding the OsHTT7 protein in the cultivation of rice plants with increased yield.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention utilizes the CRISPR / Cas9 gene editing system to edit rice. OsHTT7 Genes are mutated to construct OsHTT7 The mutant lines were found to inhibit OsHTT7 Gene expression can significantly improve the heat tolerance of rice. Furthermore, this invention also discovered that inhibiting gene expression can significantly improve the heat tolerance of rice. OsHTT7 Gene expression can significantly increase the yield per rice plant, thereby increasing rice yield. Therefore, this invention seeks to protect the use of the OsHTT7 protein or the gene encoding the OsHTT7 protein in regulating the heat tolerance of rice.

[0013] This invention also seeks protection for the use of the OsHTT7 protein or the gene encoding the OsHTT7 protein in regulating rice yield.

[0014] Specifically, the amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.3.

[0015] In a specific embodiment of the present invention, the nucleotide sequence of the gene encoding the OsHTT7 protein is shown in SEQ ID NO.2.

[0016] The present invention also provides a method for improving the heat resistance and / or yield of rice, the method being: inhibiting the expression of a gene encoding the OsHTT7 protein in rice, the amino acid sequence of which is shown in SEQ ID NO.3.

[0017] Specifically, the expression of OsHTT7 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT7 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT7 protein.

[0018] More specifically, the expression of the gene encoding the OsHTT7 protein can be interfered with by RNA interference technology; or the coding region or promoter of the gene encoding the OsHTT7 protein can be mutated by gene editing system; or the expression of the OsHTT7 protein in rice can be inhibited by knocking out the gene sequence encoding the OsHTT7 protein through homologous recombination.

[0019] Specifically, the mutation includes the insertion, deletion, or conversion of bases.

[0020] Optionally, the gene editing system is a CRISPR / Cas9-based gene editing system.

[0021] In a specific embodiment of the present invention, the expression of OsHTT7 protein in rice is suppressed by mutating the gene encoding OsHTT7 protein.

[0022] Specifically, the method for inhibiting the expression of OsHTT7 protein in rice is as follows: a CRISPR / Cas9-based sgRNA sequence is designed targeting the gene (or target sequence) encoding the OsHTT7 protein; a DNA fragment containing the sgRNA sequence is ligated into a pCRISPR / Cas9 vector carrying a Cas9 expression cassette and transformed into rice callus tissue to achieve site-directed mutation of the gene encoding the OsHTT7 protein, thereby causing the OsHTT7 protein to lose its function.

[0023] As one alternative implementation, the nucleotide sequence of the target site recognized by the sgRNA is shown in SEQ ID NO. 4.

[0024] Specifically, the present invention obtains the corresponding mutant lines by mutating the gene encoding the OsHTT7 protein in rice, including the following steps: S1. Design sgRNA target sequences and adapter primers; S2. Constructing an sgRNA vector containing the target sequence fragment: synthesize adapter primers, denature the adapter primers, and then cool them to room temperature to complete the annealing; ligate the annealed primer pairs into the enzyme-digested sgRNA vector, and verify the positive plasmid by PCR amplification and sequencing; S3. Constructing a pCRISPR / Cas9 vector containing the target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA and then ligate it into a pCRISPR / Cas9 vector containing the Cas9 expression cassette; S4. Transformation: The pCRISPR / Cas9 vector containing the target was transformed into rice callus tissue, and after screening, differentiation and rooting, positive transgenic plants were identified. S5. Identification of mutation sites: DNA was extracted from positive plants, primers were designed to amplify the extracted DNA, which was then purified and sequenced to analyze the mutation status.

[0025] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.4, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0026] Specifically, the nucleotide sequences of the primer pairs used to identify the mutation sites are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0027] Specifically, the rice mentioned is japonica rice.

[0028] More specifically, the rice is the japonica rice variety Zhonghua 11.

[0029] The present invention also claims protection for the use of a reagent that inhibits the expression of the gene encoding the OsHTT7 protein in improving the heat resistance of rice or in the preparation of products for improving the heat resistance of rice.

[0030] The present invention also seeks protection for the use of a reagent for inhibiting the expression of a gene encoding the OsHTT7 protein in the cultivation of rice plants with improved heat resistance.

[0031] The present invention also claims protection for the use of reagents that inhibit the expression of genes encoding the OsHTT7 protein in increasing rice yield or in the preparation of products for increasing rice yield.

[0032] The present invention also seeks protection for the use of a reagent for inhibiting the expression of a gene encoding the OsHTT7 protein in the cultivation of rice plants with increased yield.

[0033] Specifically, the reagents include reagents that interfere with the expression of genes encoding the OsHTT7 protein or vectors used to mutate or knock out genes encoding the OsHTT7 protein.

[0034] The present invention has the following beneficial effects: This invention utilizes the CRISPR / Cas9 gene editing system to edit rice. OsHTT7 Gene mutations were performed to construct... OsHTT7 Mutant lines. Heat stress tests on the obtained mutant lines revealed that they inhibited... OsHTT7 Gene expression can significantly improve the heat tolerance of rice. Furthermore, this invention also discovered that inhibiting gene expression can significantly improve the heat tolerance of rice. OsHTT7 Gene expression can significantly increase the yield per rice plant, thereby increasing overall rice yield. Based on this, the present invention provides a method for improving the heat tolerance and / or yield of rice. This invention is beneficial for the breeding of heat-resistant and / or high-yielding rice varieties. Attached Figure Description

[0035] Figure 1 In rice OsHTT7 Gene expression response under heat stress conditions.

[0036] Figure 2 for OsHTT7 Mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 OsHTT7 Gene expression status.

[0037] Figure 3 for OsHTT7 Phenotypic and survival rate statistics of mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 before and after heat stress treatment; A in the figure represents OsHTT7Phenotypic and chlorophyll fluorescence images of mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 before and after heat stress treatment; B in the image represents... OsHTT7 Survival statistics of mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 after heat stress treatment; Figure p <0.01; no significant difference in ns.

[0038] Figure 4 for OsHTT7 Chlorophyll content and ion leakage rate of mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 before and after heat stress treatment; Figure A shows the chlorophyll content detection results; Figure B shows the ion leakage rate detection results; p <0.05; p <0.01; no significant difference in ns.

[0039] Figure 5 for OsHTT7 Results of yield traits detection for mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11; A to D in the figure represent the results of single-plant yield weight, effective tiller number, average seed setting rate, and plant height, respectively; p <0.05; p <0.01; no significant difference in ns. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0041] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0042] Example 1: Thermal stress treatment OsHTT7 Gene expression status This invention uses seedlings of the japonica rice variety Zhonghua 11, which have germinated for 15 days, as experimental material. qPCR was used to detect the effects of heat stress (45℃) on rice. OsHTT7 Gene expression response, internal reference is Os Actin. The aforementioned OsHTT7The nucleotide sequence of the gene (gDNA) is shown in SEQ ID NO.1, the nucleotide sequence of its coding region is shown in SEQ ID NO.2, and the amino acid sequence of the OsHTT7 protein it encodes is shown in SEQ ID NO.3.

[0043] The sequences of the qPCR primers and internal control primers used for qPCR detection are shown below: qPCR primer F: CCGTTCCTGACGAAGACGAA; qPCR primer R: TTGCAGTGCTTGAAGTGGAG.

[0044] Internal reference primer F: CACATTCCAGCAGATGTGGA; Internal reference primer R: GCGATAACAGCTCCTCTTGG.

[0045] The qPCR reaction system and reaction conditions are shown in Tables 1 and 2 below: Table 1 qPCR reaction system

[0046] Table 2 qPCR reaction conditions

[0047] In rice OsHTT7 Gene expression response under heat stress conditions, as follows: Figure 1 As shown. By Figure 1 It can be seen that, OsHTT7 The gene responded after 14 hours of heat stress treatment, indicating that its expression was induced by high temperature.

[0048] Example 2: Utilizing CRISPR / Cas9 systemic mutation OsHTT7 Gene-acquired mutant rice lines This invention utilizes the CRISPR / Cas9 system to... OsHTT7 Gene mutation resulted in OsHTT7 The mutant strain, the process is as follows: 1. Design of sgRNA target sequence and adapter primers Using the CRISPR / Cas9 system to OsHTT7 Gene mutation, targeting OsHTT7 In this invention, the target design sequence is designed using the targetDesign applet (http: / / skl.scau.edu.cn / targetdesign / ) (method reference: DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).

[0049] The sgRNA target sequence (5'→3') designed in this embodiment is as follows: Target-HTT7-U3: GGTCGCGGGCGAACTCCAC (shown as SEQ ID NO.4) The adapter primer (5'→3') with sticky ends designed based on the sgRNA target sequence is as follows: Target-HTT7-U3F: ggcaGGTCGCGGGCGAACTCCAC (shown in SEQ ID NO.5) Target-HTT7-U3R: aaacGTGGAGTTCGCCCGCGACC (shown in SEQ ID NO.6) 2. Construction of pU3-gRNA vector containing Target-HTT7 fragment First, adapter primers Target-HTT7-U3F / Target-HTT7-U3R with sticky ends were synthesized (commissioned by Beijing Qingke Biotechnology Co., Ltd.). The synthesized adapter primers were denatured by heating at 90℃ for 30 s and then cooled to room temperature to complete the annealing. The annealed primers were ligated into the enzyme-digested pU3-gRNA vector. The positive plasmid was verified by PCR amplification and sequencing, and the pU3-gRNA vector containing the Target-HTT7-U3 fragment was obtained.

[0050] The PCR primers used to verify the positive plasmid were Target-HTT7-U3F / Target-HTT7-U3R.

[0051] 3. Construction of pCRISPR / Cas9 vectors containing the Target-HTT7-U3 fragment The expression cassette of the Target-HTT7-U3 fragment was excised from the Pu3-gRNA vector containing the Target-HTT7-U3 fragment constructed above, and ligated into the pCRISPR / Cas9 vector containing the Cas9 expression cassette. The positive plasmid was verified by PCR amplification and sequencing to obtain the pCRISPR / Cas9 vector containing the Target-HTT7-U3 fragment.

[0052] 4. Screening of mutant lines The constructed pCRISPR / Cas9 vector containing the Target-HTT7-U3 fragment was transformed into the callus tissue of the japonica rice variety Zhonghua 11 using Agrobacterium tumefaciens-mediated genetic transformation. After two rounds of screening, differentiation, and rooting, the resulting plants were planted in a net house, and positive mutant lines were screened for sequencing identification.

[0053] 5. Sequencing identification of mutation sites in mutant strains Genomic DNA (gDNA) was extracted from the positive mutant line. Using gDNA as a template, PCR amplification was performed using primers (5'→3') HTT7TF (SEQ ID NO.7): CGGATTCTACGTCTGGGGCT and HTT7TR (SEQ ID NO.8): GCCACAGCGAAAGCTCG. The amplified products were purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target sequence of the wild-type Zhonghua 11 before mutation to analyze the mutation status.

[0054] The reaction system used for PCR amplification was as follows: 1 μL template gDNA, 1 μL each of primers HTT7TF / R, 10 μL 2 × Taq Mix, and ddH2O to make up to 20 μL. The reaction conditions used for PCR amplification were as follows: 94 ℃ for 2 min; 94 ℃ for 20 sec, 58 ℃ for 20 sec, 72 ℃ for 30 sec, for 30 cycles; 72 ℃ for 5 min.

[0055] Sequencing analysis revealed two different strains in this embodiment. OsHTT7 Gene mutant lines were named respectively. htt7-1 and htt7-2 The sequencing results (5'→3') of wild-type Zhonghua 11 and the mutant strain are shown below: WT: TTGAAGTGGAGCGGGAGGAGGTCGCGGGCGAACTCCACCGGCTTCCACACCACGAAC htt7-1 : TTGAAGTGGAGCGGGAGGAGGTCGCGGGCGAACTC A CACCGGCTTCCACACCACGAAC htt7-2 : TTGAAGTGGAGCGGGAGGAGGTCGCGGGCGAACTC-ACCGGCTTCCACACCACGAAC Wherein, WT represents wild type; htt7-1 and htt7-2 Indicates different mutant strains; htt7-1 The corresponding sequence in " A " represents the inserted base; htt7-2 The "-" in the corresponding sequence indicates a base deletion. Comparison of the sequences reveals that the obtained mutant lines... htt7-1 and htt7-2Compared to the wild type, the target sequence exhibits base insertion mutations or deletions, indicating that the present invention has successfully mutated the wild type. OsHTT7 Genes were used to obtain corresponding mutant strains.

[0056] Using the same mutation method as described above, this invention designed another sgRNA target sequence (TCCTCCAAATCCTGCGGCAG (SEQ ID NO. 9)) and constructed a mutant line. htt7-3 and htt7-4 The sequencing results are shown below: WT: AGGCGACGACGCCTCAGTCCTCCAAATCCTGCGGCAGCGGCGTCAACGTCGCGTTCCT htt7-3 : AGGCGACGACGCCTCAGTCCTCCAAATCCTGCGG A CAGCGGCGTCAACGTCGCGTTCCCT htt7-4 : AGGCGACGACGCCTCAGTCCTCCAAATCCTGCGG T CAGCGGCGTCAACGTCGCGTTCCCT Wherein, WT represents wild type; htt7-3 and htt7-4 Indicates different mutant strains; htt7-3 The corresponding sequence in " A " represents the inserted base; htt7-4 The corresponding sequence in " T " represents the inserted base. Comparison of the sequences reveals that the resulting mutant strain..." htt7-3 and htt7-4 Compared to the wild type, the target sequence exhibits a base insertion mutation, indicating that this invention has successfully mutated the wild type. OsHTT7 Genes were used to obtain corresponding mutant strains.

[0057] Example 3 OsHTT7 Obtaining transgenic rice lines with gene overexpression 1. Obtaining overexpression transgenic rice lines This embodiment utilizes the Agrobacterium EHA105-mediated genetic transformation method to... OsHTT7The overexpression recombinant vector was transferred into the callus tissue of the wild-type japonica rice variety Zhonghua 11, thereby constructing an overexpression transgenic rice line. The specific method was carried out according to the literature (Zhou Lingyan, Jiang Dagang, Wu Hao, et al. Establishment of rice transformation system based on TAC vector [J]. Acta Genetica Sinica, 2005, 32(005):514-518.).

[0058] After screening, pre-differentiation, and differentiation, T0 generation transformed plants were obtained and subjected to PCR and quantitative real-time PCR to determine whether they were positive transformants. The positive transformants were self-pollinated to obtain transgenic 1 (T1) generation lines. Ten plants from each line that tested positive for PCR were selected for self-pollination to obtain T2 generation lines. The T2 generation lines were then subjected to PCR testing to obtain two homozygous T2 generation lines derived from different T0 generation plants, which were named […]. OEHTT7-1 and OEHTT7-2 .

[0059] 2. OsHTT7 Gene expression level detection Wild-type medium-flowered 11 were extracted separately. OsHTT7 mutant lines htt7-1 and htt7-2 Overexpression transgenic lines OEHTT7-1 and OEHTT7-2 Total RNA was extracted from flag leaves during the flowering stage and reverse transcribed into cDNA. The resulting cDNA was used as a template for qPCR to detect the target gene. OsHTT7 The expression level changes were compared with the detection results of wild-type plants, and the detection method was the same as in Example 1.

[0060] OsHTT7 Mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 OsHTT7 Gene expression status, such as Figure 2 As shown. By Figure 2 It can be seen that, OsHTT7 Genes in overexpressed transgenic lines OEHTT7-1 and OEHTT7-2 Moderate to high expression in mutant lines htt7-1 and htt7-2 Low to moderate expression (significance analysis showed a significant difference from wild type, due to overexpression in transgenic lines) OsHTT7 (The gene expression level is too high, so it is not obvious in the figure), indicating that the present invention has successfully constructed the desired gene. OsHTT7 mutant lines and OsHTT7 Overexpression transgenic lines.

[0061] Example 4: Detection of the heat resistance of mutant lines and overexpression transgenic lines This embodiment uses the mutant strain identified in Example 2.htt7-1 and the overexpression transgenic lines identified in Example 3 OEHTT7-1 For example, heat stress was applied to both the plant and the wild-type Zhonghua 11. Phenotypic changes before and after heat stress treatment were compared, and chlorophyll content, survival rate, and ion leakage rate were measured after heat stress treatment to observe... OsHTT7 The influence of genes on the heat tolerance of rice.

[0062] The heat stress treatment process is as follows: Wild-type Zhonghua 11 (WT) and mutant lines were selected. htt7-1 and overexpression transgenic lines OEHTT7-1 Several plump seeds were soaked in water and, once they began to germinate, were placed on a 96-well plate for hydroponics. After 14 days of growth, seedlings with uniform growth were selected and subjected to heat stress treatment. The heat stress treatment conditions were: 45 ℃, 12 h light / 12 h dark, and the heat stress treatment time was 5 days. After heat stress treatment, the seedlings were placed at 28 ℃ to recover, and the recovery time was 5 days.

[0063] Determination of ion leakage rate (R1 / R2): Add 10 mL of sterile ddH2O to a 15 mL sterile centrifuge tube. Cut 0.05 g of rice seedling leaves of similar size into small pieces and place them in the 15 mL centrifuge tube, ensuring the leaves are completely immersed. Shake at 100 rpm overnight at room temperature. After overnight incubation, invert the 15 mL centrifuge tube to mix thoroughly, and then measure the value R1 using a conductivity meter. After obtaining the value R1, boil the 15 mL centrifuge tube in boiling water for 15 min. After naturally cooling to room temperature, perform a second measurement using a conductivity meter to obtain the value R2. The ratio of R1 to R2 is the ion leakage rate.

[0064] OsHTT7 The phenotypic and survival rate statistics of mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 before and after heat stress treatment are as follows: Figure 3 As shown; Figure 3 A in the text is OsHTT7 Phenotypic and chlorophyll fluorescence images of mutant lines, overexpression transgenic lines and wild-type Zhonghua 11 before and after heat stress treatment; Figure 3 B in the text is OsHTT7 Survival statistics of mutant lines, overexpression transgenic lines and wild-type Zhonghua 11 after heat stress treatment. OsHTT7 Chlorophyll content and ion leakage rate of mutant lines, overexpression transgenic lines, and wild-type Zhonghua 11 before and after heat stress treatment are as follows: Figure 4 As shown; Figure 4 In the figure, A represents the chlorophyll content test result; Figure 4 In the figure, B represents the ion leakage rate (ionleakage) detection result. (From...)Figure 3 and Figure 4 It can be seen that, OsHTT7 mutant lines htt7-1 Leaves treated with heat stress did not wither or die, while both the wild-type control and the overexpression transgenic lines showed signs of heat intolerance. Compared to the wild-type control, OsHTT7 mutant lines htt7-1 After heat stress treatment, the survival rate increased by 25.9%, the ion leakage rate decreased by 10.0%, and the chlorophyll content increased by 24.5%. OsHTT7 The overexpression transgenic lines showed a significantly increased ion leakage rate and decreased chlorophyll content, indicating potentially impaired photosynthetic capacity, exhibiting significant differences. These results demonstrate that inhibiting ion leakage through mutation... OsHTT7 Gene expression can significantly improve the stress resistance and heat tolerance of rice.

[0065] Example 5: Detection of yield traits in mutant lines and overexpression transgenic lines Wild-type Zhonghua 11 (WT) and mutant lines were selected. htt7-1 and overexpression transgenic lines OEHTT7-1 A number of plump seeds were subjected to heat stress treatment and then cultivated to maturity using conventional planting and management methods. Yield traits were analyzed (single plant yield weight, effective tiller number, average seed setting rate, and plant height were measured respectively).

[0066] OsHTT7 The yield trait test results of mutant lines, overexpression transgenic lines and wild-type Zhonghua 11 are as follows: Figure 5 As shown; Figure 5 In the table, A through D represent the test results for single-plant yield weight, effective tiller number, average seed setting rate, and plant height, respectively. Figure 5 It can be seen that, HTT7-1 The mutant line had a 6.5 g increase in yield weight per plant relative to the wild type, which was significantly different from the wild-type control, indicating that mutation inhibited the yield of the mutant line. OsHTT7 Gene expression can not only improve its heat resistance, but also help increase its yield.

[0067] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. The application of the OsHTT7 protein or the gene encoding the OsHTT7 protein in regulating the heat tolerance of rice, characterized in that, The amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.

3.

2. The application of OsHTT7 protein or the gene encoding OsHTT7 protein in regulating rice yield, characterized in that, The amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.

3.

3. The application according to claim 1 or 2, characterized in that, The nucleotide sequence of the gene encoding the OsHTT7 protein is shown in SEQ ID NO.

2.

4. A method for improving the heat resistance and / or yield of rice, characterized in that, The expression of the gene encoding the OsHTT7 protein in rice was inhibited, and the amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.

3.

5. The method according to claim 4, characterized in that, The expression of OsHTT7 protein in rice can be inhibited by interfering with the expression of the gene encoding the OsHTT7 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT7 protein.

6. The method according to claim 5, characterized in that, The expression of the gene encoding the OsHTT7 protein can be inhibited by interfering with the expression of the gene encoding the OsHTT7 protein using RNA interference technology; or by mutating the coding region or promoter of the gene encoding the OsHTT7 protein using a gene editing system; or by knocking out the gene sequence encoding the OsHTT7 protein through homologous recombination to suppress the expression of the OsHTT7 protein in rice.

7. The application of a reagent for inhibiting the expression of the gene encoding the OsHTT7 protein in improving the heat tolerance of rice or in the preparation of products for improving the heat tolerance of rice, characterized in that, The amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.

3.

8. The application of a reagent for inhibiting the expression of the gene encoding OsHTT7 protein in cultivating rice plants with improved heat tolerance, characterized in that... The amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.

3.

9. The application of a reagent for inhibiting the expression of the gene encoding the OsHTT7 protein in increasing rice yield or in the preparation of products for increasing rice yield, characterized in that, The amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.

3.

10. The application of a reagent for inhibiting the expression of the gene encoding OsHTT7 protein in cultivating rice plants with increased yield, characterized in that... The amino acid sequence of the OsHTT7 protein is shown in SEQ ID NO.3.

Images