Double-gene knockout system, cell line and application of double-gene knockout system and cell line in production of recombinant protein

By constructing a double-gene knockout HEK293 cell line with OAZ1 and CASP8AP2 using CRISPR-Cas9 technology, the problem of insufficient recombinant protein expression in HEK293 cells was solved, protein folding efficiency and production stability were improved, and efficient production of recombinant proteins was achieved.

CN120843599APending Publication Date: 2025-10-28XINXIANG MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511065278.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-31
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

HEK293 cells suffer from insufficient recombinant protein expression, protein folding efficiency, and stability issues in recombinant protein production. Existing single-gene knockout optimization research is insufficient, making it difficult to improve production efficiency.

Method used

A specific double gene knockout system was designed using CRISPR-Cas9 technology to construct OAZ1 and CASP8AP2 gene knockout HEK293 cell lines. Through the OAZ1 gene knockout vector lenti-OAZ1-E1, OAZ1 gene knockout vector lenti-OAZ1-E5, and CASP8AP2 gene knockout vector lenti-CASP8AP2, synergistic double gene knockout was achieved, thereby improving the expression of recombinant proteins and cell proliferation ability.

Benefits of technology

It significantly improved the expression level and production stability of recombinant proteins, optimized the metabolic efficiency of cells, and provided a new cell platform for the efficient production of recombinant proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843599A_ABST
    Figure CN120843599A_ABST
Patent Text Reader

Abstract

The invention provides a double-gene knockout system, a cell line and application of the double-gene knockout system in recombinant protein production, and belongs to the technical field of recombinant protein expression, the double-gene knockout system comprises an OAZ1 gene knockout vector lenti-OAZ1-E1, an OAZ1 gene knockout vector lenti-OAZ1-E5 and a CASP8AP2 gene knockout vector lenti-CASP8AP2; according to the invention, by designing a specific knockout system, simultaneous knockout of OAZ1 and CASP8AP2 genes is realized, and the double-gene knockout HEK293 cell line is successfully constructed. According to the method, a step-by-step gene editing strategy is adopted, so that the off-target effect existing in a traditional double-gene co-transfection system is effectively overcome, the specificity and the stability of a double-gene knockout cell line are improved, and the expression quantity of recombinant protein can be remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of recombinant protein expression technology, and particularly relates to a dual gene knockout system, cell line and its application in the production of recombinant proteins. Background Technology

[0002] Recombinant protein production is a core component of the modern biopharmaceutical industry, widely supporting the preparation of biological agents such as vaccines and antibody drugs. In this field, the human embryonic kidney cell line HEK293 has become one of the mainstream host cells for recombinant protein production due to its excellent growth characteristics, high transfection efficiency, and ability to achieve humanized post-translational modifications (such as glycosylation).

[0003] However, HEK293 cells still face key bottlenecks in practical applications: the expression level of recombinant proteins needs to be improved, and the protein folding efficiency and stability are insufficient. These problems directly restrict the production efficiency and quality of recombinant proteins. Therefore, targeted optimization of HEK293 cells through genetic engineering has become an important research direction for overcoming these bottlenecks and improving the production efficiency of recombinant proteins.

[0004] CRISPR-Cas9 technology, as the third-generation gene editing technology following ZFN and TALENs, has become the mainstream tool in the field of gene editing due to its significant advantages such as high efficiency, ease of operation, and low cost. Its core principle is that guide RNA directs the Cas9 nuclease to precisely cleave the target DNA double strand, forming a DNA double-strand break (DSB). When the broken DNA is repaired through non-homologous end joining (NHEJ) mechanism, it is accompanied by base insertion or deletion, ultimately leading to the loss of function of the target gene, achieving gene knockout.

[0005] Currently, studies have been conducted to optimize HEK293 cells through single gene knockout, but research on the impact of dual gene synergistic knockout on recombinant protein production is still relatively scarce. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a dual-gene knockout system, a cell line, and its application in the production of recombinant proteins. This invention, through the design of a specific knockout system, achieves simultaneous knockout of the OAZ1 and CASP8AP2 genes, successfully constructing a dual-gene knockout HEK293 cell line. This cell line has achieved significant breakthroughs in increasing recombinant protein expression levels, enhancing cell proliferation capacity, optimizing metabolic efficiency, and improving production stability, providing a novel cellular platform for the efficient production of recombinant proteins.

[0007] This invention provides a dual gene knockout system, comprising the OAZ1 gene knockout vector lenti-OAZ1-E1, the OAZ1 gene knockout vector lenti-OAZ1-E5, and the CASP8AP2 gene knockout vector lenti-CASP8AP2.

[0008] The OAZ1 gene knockout vector lenti-OAZ1-E1 expresses sgRNA and Cas9 enzyme targeting the first exon of the OAZ1 gene; the sgRNAs targeting the first exon of the OAZ1 gene include sgRNAOAZ1-E1-gRNA-F and OAZ1-E1-gRNA-R.

[0009] The OAZ1 gene knockout vector lenti-OAZ1-E5 expresses sgRNA and Cas9 enzyme targeting the fifth exon of the OAZ1 gene; the sgRNAs targeting the fifth exon of the OAZ1 gene include OAZ1-E5-gRNA-F and OAZ1-E5-gRNA-R;

[0010] The sequence of OAZ1-E1-gRNA-F is shown in SEQ ID NO.3, the sequence of OAZ1-E1-gRNA-R is shown in SEQ ID NO.4; the sequence of OAZ1-E5-gRNA-F is shown in SEQ ID NO.5, and the sequence of OAZ1-E5-gRNA-R is shown in SEQ ID NO.6.

[0011] The CASP8AP2 gene knockout vector lenti-CASP8AP2 expresses sgRNA and Cas9 enzyme targeting the CASP8AP2 gene; the sgRNAs targeting the CASP8AP2 gene include CASP8AP2-E3-gRNA1-F and CASP8AP2-E3-gRNA1-R targeting the third exon; and CASP8AP2-E3-gRNA2-F and CASP8AP2-E3-gRNA2-R targeting the third exon;

[0012] The sequence of CASP8AP2-E3-gRNA1-F is shown in SEQ ID NO.8, the sequence of CASP8AP2-E3-gRNA1-R is shown in SEQ ID NO.9, the sequence of CASP8AP2-E3-gRNA2-F is shown in SEQ ID NO.10, and the sequence of CASP8AP2-E3-gRNA2-R is shown in SEQ ID NO.11.

[0013] Preferably, the OAZ1 gene knockout vector or CASP8AP2 gene knockout vector uses a CRISPR-Cas9 expression vector as the initial vector.

[0014] This invention provides a method for constructing a dual-gene knockout cell line using the aforementioned dual-gene knockout system, comprising the following steps:

[0015] 1) HEK293 cells were co-transfected with OAZ1 gene knockout vectors lenti-OAZ1-E1 and lenti-OAZ1-E5 to screen for OAZ1 gene knockout monoclonal cell lines.

[0016] 2) Transfect the OAZ1 gene knockout monoclonal cell line obtained in step 1) with the CASP8AP2 gene knockout vector lenti-CASP8AP2, and screen to obtain a double knockout cell line.

[0017] Preferably, the screening in step 1) or step 2) is performed using puromycin.

[0018] Preferably, after the screening in step 1) or step 2), a verification step is further included, which includes verification at the gene level and verification at the protein level.

[0019] This invention provides a method for preparing a dual-gene knockout cell line.

[0020] This invention provides the application of the aforementioned dual-gene knockout cell line in recombinant protein production.

[0021] Preferably, the plasmid expressing the target protein is transferred into the dual-gene knockout cell line.

[0022] This invention provides the application of the aforementioned dual-gene knockout cell line in increasing recombinant protein production.

[0023] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a dual gene knockout system, including the OAZ1 gene knockout vector lenti-OAZ1-E1, the OAZ1 gene knockout vector lenti-OAZ1-E5, and the CASP8AP2 gene knockout vector lenti-CASP8AP2; the present invention, by designing a specific knockout system, achieves simultaneous knockout of the OAZ1 and CASP8AP2 genes, and successfully constructs a dual gene knockout HEK293 cell line.

[0024] The dual gene knockout of this invention uses CRISPR / Cas9 technology. Compared with zinc finger nucleases (ZFN) and transcription activator-like effector molecules (TALEN), CRISPR / Cas9 has the advantages of being more efficient, faster, simpler, and cheaper. Using CRISPR / Cas9 technology, the knockout of OAZ1 and CASP8AP2 genes in HEK293 cells can be completed quickly, efficiently, and at low cost.

[0025] As verified by the embodiments of the present invention, HEK293 cells transfected with the dual gene knockout system provided by the present invention can be used to construct a stable HEK293 cell line with dual knockout of OAZ1 and CASP8AP2 genes, providing a cell model for the study of apoptosis and metabolism.

[0026] The present invention also provides a method for constructing a dual gene knockout cell line using the aforementioned dual gene knockout system. The present invention adopts a stepwise gene editing strategy to effectively overcome the off-target effects present in traditional dual gene co-transfection systems, improve the specificity and stability of dual gene editing, and significantly and effectively solve the technical problems that the prior art has not solved.

[0027] This invention investigates the biological characteristics and recombinant protein expression of the prepared dual-gene knockout cell lines. Using HEK293 wild-type cells as a control, the expression of recombinant proteins was increased to varying degrees in both OAZ1 single-knockout and dual-gene knockout cell lines. This demonstrates that the endogenous OAZ1 and CASP8AP2 genes in HEK293 are important targets for enhancing recombinant protein expression, and that knocking out the endogenous OAZ1 and CASP8AP2 genes in HEK293 can be an effective means of constructing a high-efficiency HEK293 expression system.

[0028] The dual gene knockout cell line prepared by this invention can not only increase the yield of recombinant proteins, but also improve the cell proliferation capacity and metabolic balance, and has broad application prospects, especially in the fields of biopharmaceuticals, vaccines and antibodies. Attached Figure Description

[0029] Figure 1 Figure A shows the agarose gel electrophoresis images of the vector backbone PX459 and the OAZ1 knockout vector in Example 1 of this invention; Figure A is the agarose gel electrophoresis image of PX459 after BbsI digestion, and Figure B is the agarose gel electrophoresis image of the OAZ1 gene knockout vector.

[0030] Figure 2 Figure A shows the verification diagram of the CASP8AP2 gene knockout vector in Example 1 of this invention; Figure B shows the CASP8AP2 sequencing verification and alignment diagram, and Figure B shows the agarose gel electrophoresis diagram of the CASP8AP2 gene knockout vector.

[0031] Figure 3 This is a sequencing result diagram of three OAZ1 gene knockout monoclonal cells in Example 2 of the present invention;

[0032] Figure 4 This is a diagram showing the qPCR results of three OAZ1 gene knockout monoclonal cells in Example 2 of this invention;

[0033] Figure 5This is a graph showing the protein expression levels of three OAZ1 gene knockout monoclonal cells in Example 2 of the present invention; A is a graph of Western blot detection results, and B is a graph of the quantitative results of Western blot.

[0034] Figure 6 The sequencing results of three CASP8AP2 gene knockout monoclonal cells and CASP8AP2 / OAZ1 double gene knockout cells in Example 2 of this invention are shown in the figure.

[0035] Figure 7 The image shows the qPCR results of three CASP8AP2 single-gene knockout and double-gene knockout monoclonal cells in Example 2 of this invention.

[0036] Figure 8 A is a graph showing the expression level of CASP8AP2 protein in three double-gene knockout monoclonal cells in Example 2 of this invention; A is a graph showing the results of Western blot detection; B is a graph showing the quantitative results of Western blot detection.

[0037] Figure 9 The graph shows the expression level of CASP8AP2 protein in three CASP8AP2 gene knockout monoclonal cells in Example 2 of this invention; A is the Western blot detection result; B is the quantitative graph of the Western blot result.

[0038] Figure 10 The results of cell suspension growth status detection in Example 3 of the present invention are shown; A is the result of live cell count detection in the suspension cells, and B is the result of cell viability detection in the suspension cells.

[0039] Figure 11 Figure A shows the SEAP protein detection results in Example 3 of this invention; Figure B shows the SEAP expression results after loading equal volumes of cells; Figure C shows the SEAP expression results after loading equal volumes of cells.

[0040] Figure 12 The figures show the VN protein detection results in Example 3 of this invention; the top figure shows the VN protein expression results after loading with equal volume; the bottom figure shows the VN protein expression results after loading with equal number of cells.

[0041] Figure 13 Figure 3 shows the cell metabolism detection results in Example 3 of this invention; A, B, C, and D represent the contents of glucose, lactic acid, glutamine, and ammonia in the supernatant of double knockout cells and wild-type cells at different time points, respectively; Figure E shows the specific consumption rate of major metabolites in double knockout cells and wild-type cells during suspension culture. Detailed Implementation

[0042] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1

[0044] Construction of OAZ1 and CASP8AP2 gene knockout vectors

[0045] The gene editing vector constructed in this embodiment uses CRISPR / Cas9 technology to build a single gRNA knockout target (targeting the OAZ1 gene) and a double gRNA knockout target recombinant plasmid (targeting the CASP8AP2 gene). The specific operation steps are as follows:

[0046] 1. Target primer design

[0047] Using human genome sequences as targets, the OAZ1 and CASP8AP2 gene sequences were queried in the NCBI database (http: / / www.ncbi.nlm.nih.gov). For the OAZ1 gene, a pair of sgRNAs were designed from the first exon sequence (SEQ ID NO.1) and the fifth exon sequence (SEQ ID NO.2) of the CDS region based on the common exon sequence of the transcript: OAZ1-E1-gRNA-F (SEQ ID NO.3), OAZ1-E1-gRNA-R (SEQ ID NO.4), OAZ1-E5-gRNA-F (SEQ ID NO.5), and OAZ1-E5-gRNA-R (SEQ ID NO.6).

[0048] First exon sequence (SEQ ID NO.1):

[0049] AGCATCTATAAAGGCGGGCGGCGGCAGAGGCGCCATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCGGACCCCAGCGGCCGGATGGTGAAATCCTCCC TGCAGCGGATCCTCAATAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGATAAAACCCAGCGCCACCATCCACGCCAGCCGCACCATGCCGCTCCTAAGCCTGCACAGCCGCGGCGGCAGCAGCAGTGAGAG

[0050] Fifth exon sequence (SEQ ID NO.2):

[0051] CCGCCTTGCTCCGAACCTTCAGCTTTTTGGGCTTTGAGATTGTGAGACCGGGGCATCCCCTTGTCCCCAAGAGACCCGACGCTTGCTTCATGGCCTACACGTTCGAGAGAGAGTCTTCGGGAGAGGAGGAGGAGTAGGGCCGCCTCGGGGCTGGGCATCCGGCCCCTGGGGCCACCCCTTGTCAGCCGGGTGGGTAGGAACCGTAGACTCGCTCATCTCGCCTGGGTTTGTCCGCATGTTGTAATCGTGCAAATAAACGCTCACTCCGAATTAGCGGTGTATTTCTTGAAGTTTAATATTGTGTTTGTGATACTGAAGTATTTGCTTTAATTCTAAATAAAAATTTATATTTTACTTTTTTATTGCTGGTTTAAGATGATTCAGATTATCCTTGTACTTTGAGGAGAAGTTTCTTATTTGGAGTCTTTTGGAAACAGTCTTAGTCTTTTAACTTGGAAAGATGAGGTATTAATCCCCTCCATTGCTCTCCAAAAGCCAATAAAGTGATTACACCCGA

[0052] SEQ ID NO.3:OAZ1-E1-gRNA-F5’-CACCggctattgaggatccgctgc-3’

[0053] SEQ ID NO.4:OAZ1-E1-gRNA-R5’-AAACgcagcggatcctcaatagcc-3’

[0054] SEQ ID NO.5:OAZ1-E5-gRNA-F5’-CACCGagactctctctcgaacgtgt-3’

[0055] SEQ ID NO.6:OAZ1-E5-gRNA-R5’-AAACacacgttcgagagagagtctC-3’

[0056] For the CASP8AP2 gene, two pairs of sgRNAs were designed by selecting the third exon sequence of the CDS region (SEQ ID NO.7) based on the common exon sequence of the transcript: CASP8AP2-E3-gRNA1-F (SEQ ID NO.8), CASP8AP2-E3-gRNA1-R (SEQ ID NO.9), CASP8AP2-E3-gRNA2-F (SEQ ID NO.10), and CASP8AP2-E3-gRNA2-R (SEQ ID NO.11).

[0057] Third exon sequence (SEQ ID NO.7):

[0058] CTTCTCCTCTTAAGAACAATGATGAAGGCTCACTGGACATATACGCTGGGTTGGACAGTGCTGTTTCTG

[0059] SEQ ID NO.8:

[0060] CASP8AP2-E3-gRNA1-F 5'-GCTCACTGGACATATACGCTGGG-3'

[0061] SEQ ID NO.9:

[0062] CASP8AP2-E3-gRNA1-R 5'-CCCAGCGTATATGTCCAGTGAGC-3'

[0063] SEQ ID NO.10:

[0064] CASP8AP2-E3-gRNA2-F 5'-ACTGGACATATACGCTGGGTTGG-3'

[0065] SEQ ID NO.11:

[0066] CASP8AP2-E3-gRNA2-R 5'-CCAACCCAGCGTATATGTCCAGT-3'

[0067] 2. Construction of OAZ1 and CASP8AP2 gene knockout vectors

[0068] 2.1. Construction of the OAZ1 gene knockout vector

[0069] 2.1.1. Linearization Vector Construction: The backbone vector for expressing the Cas9 enzyme was PX459, purchased from Addgene. This vector contains two restriction endonuclease sites (BbsI). PX459 was linearized using BbsI. The linearization digestion system is shown in Table 1. The digestion products were added to PCR tubes according to the following system, thoroughly mixed, and incubated at 37°C for at least 4 hours. The digestion products were then subjected to agarose gel electrophoresis. The results are shown below. Figure 1 As shown in A), the gel containing the linearized carrier was purified and recovered using a gel recovery kit for later use.

[0070] Table 1 Enzyme digestion system

[0071]

[0072] 2.1.2. sgRNA primer phosphorylation: Phosphorylate the two pairs of synthesized sgRNA primers. The primer sequences are shown in Table 1, and the phosphorylation reaction system is shown in Table 2. Add the primers to the PCR tube according to the following system, mix thoroughly, and then transfer the PCR tube to the PCR instrument to react according to the procedure in Table 3.

[0073] Table 2 Primer phosphorylation system

[0074]

[0075] Table 3 Annealing Temperature System

[0076]

[0077]

[0078] The final collected reaction solution is phosphorylated double-stranded gRNA, and the product can be stored at -20°C.

[0079] 2.1.3. Connecting linearized carriers

[0080] The two pairs of phosphorylated double-stranded gRNA fragments obtained in 2.2 were ligated with the linearized Cas9 expression vector obtained in 2.1. The reaction system is shown in Table 4. The following systems were added to centrifuge tubes in sequence, and then thoroughly mixed. The mixture was transferred to a PCR instrument and incubated overnight at 16°C. The incubation product was transformed into Escherichia coli DH5α the next day. LB solid medium and liquid medium were prepared in advance, and ampicillin was added at a ratio of 1:1000. Escherichia coli DH5α cells were plated on LA solid culture plates and placed in a 37°C incubator for 12-14 hours.

[0081] Table 4 Connection System

[0082]

[0083] After 14 hours, the culture was expanded. Using autoclaved pipette tips, single colonies on the culture plate were carefully selected and transferred to 50 mL centrifuge tubes containing 5 mL of LA liquid medium, clearly labeled. The centrifuge tubes were then placed in a shaker and incubated at 37°C and 220 rpm for 14 hours.

[0084] After 14 hours, the bacterial culture should be turbid. At this time, collect the bacterial culture and preserve the bacteria. The preservation steps are as follows: First, prepare 60% glycerol. Mix the collected bacterial culture with 60% glycerol in an equal proportion to form a glycerol bacterial culture. Take 1.8 mL of the glycerol bacterial culture into a 2 mL autoclaved centrifuge tube and send the glycerol bacteria to the company for sequencing. Transfer the remaining glycerol bacteria to other autoclaved 2 mL centrifuge tubes and store them at -20℃. After sequencing is complete, the correct plasmid is the expression vector containing sgRNA and Cas9. Take the glycerol bacteria corresponding to the correctly constructed vector from the -20℃ freezer, and take 1 mL of glycerol bacteria into a 50 mL centrifuge tube containing 5 mL of LA medium. Incubate at 37℃ and 220 rpm for 14 hours. After the bacterial culture becomes turbid, extract the plasmid according to the instructions of the Kangwei Century small-particle plasmid extraction kit to obtain two successfully constructed OAZ1 gene knockout vectors. Figure 1 B), named lenti-OAZ1-E1 and lenti-OAZ1-E5.

[0085] 2.2. Construction of CASP8AP2 gene knockout vector

[0086] The vector was ligated by Beijing Miga Technology Co., Ltd. Successful ligation was verified by sequencing. Successful sequencing results should contain both CASP8AP2-E3-gRNA1 and CASP8AP2-E3-gRNA2, as shown in the following figure. Figure 2 As shown in A), the CASP8AP2 gene knockout vector was successfully constructed and named lenti-CASP8AP2 (i.e., the two gRNAs mentioned above were ligated into the same vector), and the plasmid was extracted. Figure 2 B) in.

[0087] Example 2

[0088] Establishment of a stable HEK293 cell line with double gene knockout

[0089] 1. Construction and validation of OAZ1 gene knockout cell lines

[0090] 1.1. Selection of puromycin concentration: The vectors lenti-CASP8AP2, lenti-OAZ1-E1 and lenti-OAZ1-E5 have puromycin resistance and can be used for screening positive clone cell lines in the later stage.

[0091] It is necessary to determine the minimum lethal dose of puromycin for normal cells. Different mammalian cells have different sensitivities to and tolerance to puromycin concentrations. HEK293 cells were divided into groups of 2 × 10⁻⁶. 5 The cells were seeded at a density of 10 cells / mL into 24-well plates. After 24 hours, when the cell coverage reached 80%, different concentrations of puromycin (0, 6, 8, 10, 12, 14, 16 μg / mL) were added and cultured for 7 days. The optimal concentration that could induce normal cell death was observed, and the optimal concentration was 7 μg / mL.

[0092] After determining the optimal concentration, HEK293 cells were again incubated at 6 × 10⁻⁶. 5 Seed cells at a density of 10 cells / mL into 6-well plates. After 24 hours, when cell coverage reached 80%, the constructed gene-editing plasmids (lenti-OAZ1-E1 and lenti-OAZ1-E5) were co-transfected into HEK293 cells. The transfection procedure was performed according to the Bioharp Lipofecta Mine 2000 manual (0.4 μg lenti-OAZ1-E1 and 0.4 μg lenti-OAZ1-E5, 10 μl HEK293 cells). After 48 hours, the medium was replaced with DMEM / high-glucose complete medium at a puromycin concentration of 7 μg / mL, and the medium was changed every other day. After approximately 5 days, the untransfected normal cells died, and the medium was replaced with DMEM / high-glucose complete medium at a puromycin concentration of 3 μg / mL, and the medium was changed every other day. After 14 days of selection, cell pools were obtained, expanded into 6-well plates, and promptly frozen for subsequent experiments.

[0093] 1.2. Screening for Monoclonal Cells: The cell pools obtained from screening were replaced with puromycin-free medium for expansion culture. Monoclonal cells were then screened using the limiting dilution method, as follows:

[0094] Limiting dilution: After trypsin digestion, the selected cell pool was resuspended in culture medium and counted. The cell suspension was then serially diluted to 200 cells per 10 ml of culture medium and seeded into 96-well plates with 100 μl of cell suspension per well (approximately 1-3 cells per well on average). Cells in each well were observed daily for about a week, after which typical aggregated growth of individual cells was observed. Wells showing single-cell growth were labeled, and cells were observed regularly. Cells reaching passage density were transferred to 24-well or 12-well plates for continuous expansion of monoclonal cell culture. Finally, cells were transferred to 6-well plates and cryopreserved promptly to prevent contamination.

[0095] 2. Validation of OAZ1 gene knockout monoclonal cell lines

[0096] 2.1 Genome-level sequencing verification: Expanded monoclonal cells were collected, and genomic DNA was extracted using a genomic DNA extraction kit. PCR primers were designed at the knockout site, approximately 300 bp upstream of exon 1 and downstream of exon 5 in the OAZ1 genome. The sequences are shown in SEQ ID NO.12 and SEQ ID NO.13. PCR amplification was performed, and the reaction system is shown in Table 5.

[0097] Forward primer for SEQ ID NO.12: AGCATCTATAAAGGCGGGCG

[0098] SEQ ID NO.13 Reverse primer: GGAGAGCAATGGAGGGGATT

[0099] Table 5 Amplification System

[0100]

[0101] 4 μL of the amplified product was subjected to agarose gel electrophoresis, and the remaining 16 μL was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Three successfully knocked-out cell lines were obtained, namely K-1, K-2, and K-3. The sequencing results showed that K-1, K-2, and K-3 caused large fragment knockouts ( Figure 3 ).

[0102] 2.2 mRNA and protein level validation:

[0103] 2.2.1. qPCR verification of mRNA levels in K-1, K-2, and K-3 cell lines

[0104] RNA was extracted from HEK293 wild-type and knockout cell lines, and reverse transcription was performed to obtain cDNA. The specific reactions were carried out in two steps, as shown in Table 6 for the first step and Table 7 for the second step.

[0105] Table 6. First-step reaction system

[0106]

[0107]

[0108] React at 42℃ for 2 minutes;

[0109] Table 7. Second step reaction system

[0110]

[0111] The reaction was carried out at 50℃ for 15 minutes, and then terminated at 85℃ for 5 seconds.

[0112] The upstream and downstream primers for qPCR of the OAZ1 gene were designed as shown in SEQ ID NO.14 and SEQ ID NO.15. qPCR detection was performed on HEK293 wild-type and K-1, K-2, and K-3 cell lines. The upstream and downstream primers were diluted 10-fold and the cDNA was diluted 2-fold. The reaction system is shown in Table 8. The results are as follows: Figure 4 As shown, the mRNA expression level of the OAZ1 gene in K-1, K-2, and K-3 cell lines was significantly lower than that in HEK293-WT (wild-type HEK293 cells).

[0113] SEQ ID NO.14 Forward primer: CAGCAGTGAGAGGGTCTCC

[0114] SEQ ID NO.15 Reverse primer: CTCGAACGTGTAGGCCATGA

[0115] Table 8 qPCR reaction system

[0116]

[0117] 2.2.2. Western blot verification of protein expression levels in K-1, K-2, and K-3 cell lines

[0118] Total protein was extracted from HEK293-WT, K-1, K-2, and K-3 strains respectively, and Western blot analysis was performed. The specific steps are as follows:

[0119] Cells were lysed using protein lysis buffer (PMSF:RIPA = 1:100), collected, and centrifuged. The supernatant was collected, and protein concentration was determined using the BCA method. 40 μg of protein sample was added to each well, and electrophoresis was performed at 220 V. After sample dispersion, wet transfer was performed for approximately 35 min. The membrane was blocked with rapid blocking buffer for 15 min, washed with TBST for 10 min, and incubated with primary antibody overnight at 4°C. After primary antibody recovery, the membrane was washed three times with TBST for 10 min each time, incubated with secondary antibody at room temperature for 2 h, and washed three times with TBST for 10 min each time. Finally, ultrasensitive ECL chromogenic reagent was used for development. Results are as follows: Figure 5 As shown, the protein expression level of OAZ1 in the three cell lines K-1, K-2, and K-3 was significantly lower than that in HEK293-WT cells, indicating that the OAZ1 gene knockout was successful.

[0120] 3. Construction of CASP8AP2 gene knockout cell lines and OAZ1 / CASP8AP2 double gene knockout HEK293 cell lines

[0121] In section 2.2.2, it was verified that K-3 knockout had the best effect. K-3 cell line and wild-type HEK293 cell line were plated, and the constructed gene editing plasmid lenti-CASP8AP2 was transfected into K-3 and wild-type HEK293 cell lines. Single clones were screened, and the steps were the same as in section 1.2 of Example 2.

[0122] 4. Validation of CASP8AP2 gene knockout monoclonal cell lines

[0123] 4.1 Genome-level sequencing verification: Expanded monoclonal cells were collected, and genomic DNA was extracted using a genomic DNA extraction kit. PCR primers were designed at the knockout site, approximately 300 bp upstream and downstream of the third exon of the CASP8AP2 genome, with sequences shown in SEQ ID NO.16 and SEQ ID NO.17. PCR amplification was performed, and subsequent steps were the same as in 1.2 of Example 2.

[0124] Forward primer of SEQ ID NO.16: ATCAGTGTGCCAAAATCTTCCTG

[0125] SEQ ID NO.17 Reverse primer: AACCACAAAACAATGAACTGACC

[0126] Three CASP8AP2 gene single knockout cell lines were successfully obtained, namely C-1, C-2, and C-3; and three double knockout cell lines were successfully obtained, namely 2C-8, 5C-2, and 5C-8. Sequencing results are shown below. Figure 6 .

[0127] 4.2 mRNA and protein level validation:

[0128] 4.2.1 qPCR verification of mRNA levels in CASP8AP2 knockout cell lines

[0129] The upstream and downstream primers for qPCR of the CASP8AP2 gene were designed as shown in SEQ ID NO.18 and SEQ ID NO.19. Subsequent experimental steps were the same as in 2.2.1 and 2.2.2 of Example 2. The qPCR results are as follows: Figure 7 As shown, the expression levels of CASP8AP2 mRNA in single and double knockout cells were significantly lower than those in wild-type cells.

[0130] Forward primer of SEQ ID NO.18: GGGTAAGTTGTCGTAGGGGC

[0131] SEQ ID NO.19 Reverse primer: CATTGAGCTACCCTCGCCA

[0132] 4.2.2 Western blot verification of protein expression levels in CASP8AP2 knockout cell lines

[0133] Western blot results are as follows Figure 8 , Figure 9 The expression levels of CASP8AP2 protein in C-1, C-2, C-3 and 2C-8, 5C-2, 5C-8 cells were significantly lower than in wild-type cells. Verification showed that C-3 knockout was the most effective, and among the double knockout cell lines, 5C-2 knockout was the most effective. Subsequent experiments will be conducted based on the cell line with the best knockout effect. Overall, these results indicate the successful construction of a stable HEK293 cell line with OAZ1 and CASP8AP2 double gene knockout.

[0134] In this embodiment, the single gRNA knockout target gene editing vector provided by this invention was used to co-transfect HEK293 cells, achieving efficient knockout of the OAZ1 gene in HEK293 cells, thereby constructing an endogenous OAZ1 gene-deficient HEK293 cell line. Based on this, the dual gRNA knockout target gene editing vector provided by this invention was further used to successfully construct a stable HEK293 cell line with OAZ1 and CASP8AP2 dual gene knockout on the OAZ1 gene-deficient HEK293 cell line. Finally, a stable HEK293 cell model with OAZ1 and CASP8AP2 gene knockout was established. This stepwise gene editing strategy effectively overcomes the off-target effects present in traditional dual-gene co-transfection systems, improves the specificity and stability of dual-gene editing, and significantly and effectively solves the technical problems that existing technologies have not addressed.

[0135] Example 3

[0136] Application of double knockout HEK293 cell line in recombinant protein production

[0137] This embodiment demonstrates the application of the double-gene knockout HEK293 cell line in recombinant protein production. By transfecting plasmids expressing the relevant target protein and detecting transient and stable protein expression, it is shown that the double-gene knockout HEK293 cell line can increase the yield of recombinant proteins. The specific implementation is as follows:

[0138] 1. Transient expression of alkaline phosphatase protein (SEAP)

[0139] Transient expression plasmids for SEAP protein were selected for cell transfection. HEK293-WT, HEK293-OAZ1-KO (K-3), HEK293-CASP8AP2-KO (C-3), and HEK293-dKO (5C-2) cells were seeded at 500,000 / ml in 6-well plates. When cell coverage reached 80%, plasmid transfection was performed at a transfection dose of 2 μg / ml. After 6 hours of transfection, the medium was changed, and the cells were cultured for another 48 hours. Cell counts were then performed, and the cells were cultured in suspension at 600,000 / ml. After 7 days of suspension culture, samples were collected, centrifuged at 13,000 rpm for 10 minutes, and the supernatant was collected. SEAP expression was detected using a SEAP assay kit. Equal volumes and equal cell counts of the supernatant were loaded, and the volumes were adjusted with assay buffer. After loading, the samples were incubated at 37°C for 15 minutes, and the OD value at 450 nm was measured. SEAP expression levels were calculated based on a standard curve. Results are as follows: Figure 11 As shown, compared with HEK293-WT cells and single knockout cells, double gene knockout HEK293 (HEK293-dKO) cells can significantly increase the expression level of SEAP, regardless of whether the same volume or the same number of cells are loaded.

[0140] 2. Stable expression of vilinkin (VN)

[0141] VN protein expression plasmids were transfected into cells to detect the effect of OAZ1 and CASP8AP2 gene knockout on stable protein expression in HEK293 cells. HEK293-WT, HEK293-OAZ1-KO(K-3), HEK293-CASP8AP2-KO(C-3), and HEK293-dKO(5C-2) cells were seeded in 6-well plates at a density of 500,000 cells / ml. When the cell coverage reached 80%, plasmid transfection was performed at a transfection dose of 2 μg / ml. After 6 hours of transfection, the medium was changed and cultured for another 48 hours. The medium was then changed to blast fungicide at a concentration of 7 μg / ml, and the medium was changed every 2-3 days. After 3 weeks of selection, a cell pool was obtained and expanded. The cells were then cultured in suspension at a density of 600,000 cells / ml. After 7 days of suspension culture, the cells were collected, centrifuged at 13,000 rpm for 10 min, and the supernatant was collected. A portion of the supernatant sample was used for protein concentration. Equal volumes and equal numbers of cells were loaded into the supernatant sample for Western blotting. The corresponding protein samples were added to the wells. After loading, electrophoresis was started. The voltage was set to 60V for the first 30 minutes, and then increased to 120V. Wet transfer was performed for approximately 2 hours, followed by blocking with 5% skim milk for 2 hours. The membrane was then incubated overnight at 4°C with a His-tagged primary antibody at room temperature. After recovering the primary antibody, the membrane was washed three times with TBST for 10 minutes each time. The membrane was then incubated with mouse secondary antibody at room temperature for 2 hours. After recovering the secondary antibody, the membrane was washed three times with TBST for 10 minutes each time. ECL chromogenic solutions A and B were used for development. Results are as follows: Figure 12 As shown in the figure, compared with HEK293-WT and single knockout cells, whether loaded with the same volume or the same number of cells, double gene knockout HEK293 (HEK293-dKO) cells can significantly increase the expression level of VN.

[0142] 3. Cellular metabolic analysis

[0143] Based on the previously observed phenomenon of gene-edited cell lines enhancing protein expression, further quantitative metabolic analysis was used to reveal their metabolic homeostasis capacity, and the results are as follows: Figure 13 As shown, double-gene knockout HEK293 (HEK293-dKO) cells exhibited relatively increased glucose consumption and lactate metabolism compared to wild-type cells (HEK293-WT), indicating that the metabolic level of double-knockout cells was optimized.

[0144] In summary, the above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A dual-gene knockout system, characterized in that, Including the OAZ1 gene knockout vector lenti-OAZ1-E1, the OAZ1 gene knockout vector lenti-OAZ1-E5, and the CASP8AP2 gene knockout vector lenti-CASP8AP2; The OAZ1 gene knockout vector lenti-OAZ1-E1 expresses sgRNA and Cas9 enzyme targeting the first exon of the OAZ1 gene; the sgRNAs targeting the first exon of the OAZ1 gene include sgRNAOAZ1-E1-gRNA-F and OAZ1-E1-gRNA-R. The OAZ1 gene knockout vector lenti-OAZ1-E5 expresses sgRNA and Cas9 enzyme targeting the fifth exon of the OAZ1 gene; the sgRNAs targeting the fifth exon of the OAZ1 gene include OAZ1-E5-gRNA-F and OAZ1-E5-gRNA-R; The sequence of OAZ1-E1-gRNA-F is shown in SEQ ID NO.3, the sequence of OAZ1-E1-gRNA-R is shown in SEQ ID NO.4; the sequence of OAZ1-E5-gRNA-F is shown in SEQ ID NO.5, and the sequence of OAZ1-E5-gRNA-R is shown in SEQ ID NO.

6. The CASP8AP2 gene knockout vector lenti-CASP8AP2 expresses sgRNA and Cas9 enzyme targeting the CASP8AP2 gene; the sgRNAs targeting the CASP8AP2 gene include CASP8AP2-E3-gRNA1-F and CASP8AP2-E3-gRNA1-R targeting the third exon; and CASP8AP2-E3-gRNA2-F and CASP8AP2-E3-gRNA2-R targeting the third exon; The sequence of CASP8AP2-E3-gRNA1-F is shown in SEQ ID NO.8, the sequence of CASP8AP2-E3-gRNA1-R is shown in SEQ ID NO.9, the sequence of CASP8AP2-E3-gRNA2-F is shown in SEQ ID NO.10, and the sequence of CASP8AP2-E3-gRNA2-R is shown in SEQ ID NO.

11.

2. The dual-gene knockout system according to claim 1, characterized in that, The OAZ1 gene knockout vector or CASP8AP2 gene knockout vector uses a CRISPR-Cas9 expression vector as the initial vector.

3. A method for constructing a dual-gene knockout cell line using the dual-gene knockout system of claim 1, characterized in that, The following steps are involved: 1) HEK293 cells were co-transfected with OAZ1 gene knockout vectors lenti-OAZ1-E1 and lenti-OAZ1-E5 to screen for OAZ1 gene knockout monoclonal cell lines. 2) Transfect the OAZ1 gene knockout monoclonal cell line obtained in step 1) with the CASP8AP2 gene knockout vector lenti-CASP8AP2, and screen to obtain a double knockout cell line.

4. The method according to claim 3, characterized in that, The screening described in step 1) or step 2) is performed using puromycin.

5. The method according to claim 3, characterized in that, The screening process described in step 1) or step 2) further includes a verification step, which includes verification at the gene level and verification at the protein level.

6. The dual-gene knockout cell line prepared by the method according to any one of claims 3 to 5.

7. The application of the dual gene knockout cell line according to claim 6 in the production of recombinant proteins.

8. The application according to claim 7, characterized in that, The plasmid expressing the target protein was transferred into the dual-gene knockout cell line.

9. The application of the dual gene knockout cell line according to claim 6 in increasing the yield of recombinant proteins.