Application of SNP molecular marker related to pig live-born litter size character

By detecting the SNP molecular marker at position 32663785 on chromosome 9 of the pig genome, the problems of long breeding cycles and environmental interference in traditional breeding methods have been solved, enabling early screening of high-fertility sows and improving the number of live piglets produced.

CN120843687BActive Publication Date: 2026-03-20HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510902944.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2026-03-20
Estimated Expiration
2045-07-01

AI Technical Summary

Technical Problem

Existing technologies cannot quickly and accurately increase the number of live piglets produced. Traditional breeding cycles are long and easily affected by environmental factors, resulting in slow genetic progress. Traditional measures have limited benefits for sows with low genetic potential.

Method used

By detecting the SNP molecular marker at locus 32663785 on chromosome 9 of the pig genome Sscrofa11.1.109, genotyping was performed using PCR primers to screen individuals with favorable allele variations for early marker-assisted selection.

Benefits of technology

This enables early and accurate screening of high-fertility sows, shortens the breeding cycle, increases the number of live piglets produced, and enhances reproductive efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843687B_ABST
    Figure CN120843687B_ABST
Patent Text Reader

Abstract

The application belongs to the field of pig molecular marker assisted selection, and particularly relates to application of a SNP molecular marker related to pig live litter size. The SNP molecular marker is at the base of the 32663785th site of the 9th chromosome in pig genome Sscrofa11.1.109, the SNP site of the molecular marker has C / T polymorphism, and T is a favorable allelic variation of pig live litter size. The superior allele of the SNP can increase the frequency of the superior allele generation by generation, increase the live litter size of pigs, accelerate the genetic improvement progress of pigs, and thus effectively improve the pig breeding production efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of pig molecular marker assisted selection, and particularly relates to application of a SNP molecular marker related to pig live litter size. BACKGROUND

[0002] Improving pig live litter size is an important research direction in pig breeding field, which has a significant impact on the economic benefits of animal husbandry and the breeding efficiency of breeding pigs. As a core indicator of pig reproductive performance, live litter size is directly related to breeding costs, annual litter size of sows, and piglet survival rate. According to industry statistics, for each increase of 1 pig live litter size, the annual profit of each sow can be increased, and the economic benefits of large-scale breeding farms can be improved by 15%-20%. However, due to the influence of genetic complexity and environmental factors interaction, it still faces great challenges to improve live litter size.

[0003] The main measures to improve pig live litter size at present include traditional breeding techniques and feeding management optimization. Selecting breeding pigs through phenotypic selection (such as annual litter size of sows, average live litter size per litter, etc.) is a conventional means. However, this method relies on long-term production data accumulation and has significant defects: (1) phenotypic selection needs to be evaluated after sows reach sexual maturity and complete reproduction, usually taking 3-5 years, with a long breeding cycle; (2) reproductive traits are easily disturbed by environmental factors such as feeding management, disease prevention and control, resulting in slow and unstable genetic progress; (3) traditional breeding is difficult to directly link to gene sites related to molecular mechanisms such as embryo survival and sow lactation ability, with limited selection accuracy. By improving the nutrient supply of pregnant sows (such as adding amino acids and vitamins), optimizing the delivery environment and postpartum care measures, the live litter size can be partially improved. However, such measures have limited gains for sows with low genetic potential, and the overall improvement space is small.

[0004] In recent years, genomics technology has developed rapidly, making it possible to explore the core genes and molecular mechanisms regulating live litter size. Molecular marker assisted breeding is a method that uses the characteristics of close linkage between molecular markers and target trait genes. By detecting molecular markers, the presence of target genes can be detected, achieving the purpose of selecting target traits, with the advantages of being fast, accurate, and not affected by environmental conditions. Single nucleotide polymorphism (SNP) is a type of molecular marker, which refers to the change of DNA sequence caused by the variation of a single nucleotide at the same position in the genome of individuals, which can subsequently affect gene expression, transcription activity, and splicing modification. Screening of genes and SNP genetic markers related to pig live litter size traits, combined with marker assisted breeding methods, can provide efficient tools for early selection of pigs and rapid screening of high reproductive sows. SUMMARY

[0005] The application aims to provide a SNP molecular marker related to pig live birth number, and provide guidance for pig live birth number performance detection or molecular marker assisted breeding.

[0006] The technical scheme of the application is as follows.

[0007] The application provides a pig SNP molecular marker, which is at a base at a 32663785 site of a 9th chromosome in a pig genome Sscrofa11.1.109, and the SNP site of the molecular marker has C / T polymorphism, wherein T is a favorable allele variation of pig live birth number increase.

[0008] The pig SNP molecular marker and a substance for detecting the pig SNP molecular marker are applied in any of the following aspects:

[0009] For detecting or assisting in detecting pig live birth number traits;

[0010] For improving pig live birth number traits in genetic breeding;

[0011] Preferably, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1.

[0012] In the application, the substance for detecting the pig SNP molecular marker includes a PCR primer for amplifying a genomic DNA fragment of the SNP site of the molecular marker, or a kit containing the primer.

[0013] Preferably, the nucleotide sequence of the primer is shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0014] Preferably, the kit further includes a PCR amplification reagent.

[0015] The application further provides a method for detecting pig live birth number traits, including: detecting a base type at a 32663785 site of a 9th chromosome in a pig genome, and a TC genotype and a CC genotype population have less live birth number than a TT genotype population.

[0016] Preferably, the method for detecting the base type at the 32663785 site of the 9th chromosome in the pig genome includes: designing a primer for amplifying the nucleotide sequence shown in SEQ ID NO. 1, performing PCR amplification on pig genomic DNA by using the primer, and detecting a genotype at a 156th site in a gene sequence of an amplification product.

[0017] Further preferably, a genotype of a 9:32663785C>T site is obtained by using Sanger sequencing.

[0018] The application also provides a genetic breeding method for increasing the pig live litter size character, comprising: determining the base type of the pig core group of sow at the 32663785 site of chromosome 9, and making corresponding selection according to the base type:

[0019] The subculture selection of the sow selects the individual with the base type of TT and TC at the 32663785 site of chromosome 9 of the pig, and eliminates the individual with the base type of CC, so as to increase the frequency of the gene T at the site from generation to generation, thereby increasing the pig live litter size character.

[0020] Preferably, the base at the 32663785 site of chromosome 9 of the pig is shown in the 156th bp of the sequence shown in SEQ ID NO. 1.

[0021] The application has the following beneficial effects:

[0022] The application studies and determines the SNP molecular marker affecting the pig live litter size character, and early molecular marker assisted selection is carried out by using the molecular marker, so that the pig breed selection process can be accelerated.

[0023] The application predicts the pig live litter size character by detecting the base type of the molecular marker SNP site, and the live litter size of the population with the TC genotype and the TT genotype is more than that of the population with the CC genotype. The application applies the primer for amplifying the molecular marker affecting the pig live litter size character, and establishes an efficient and accurate pig molecular marker assisted breeding technology by using the molecular marker and the primer. The technology is applied to pig breeding, so that piglets with superior live litter size characters can be screened, and inferior piglets can be eliminated in time, thereby increasing the pig litter size and improving the breeding efficiency of the pig farm. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a Manhattan plot (left) and a QQ plot (right) for pig live litter size GWAS.

[0025] Figure 2 It is a result graph of correlation analysis of different genotypes of the SNP molecular marker and the live litter size.

[0026] Figure 3 It is a sanger sequencing result of the 9:32663785C>T site. DETAILED DESCRIPTION

[0027] This invention involves whole-genome resequencing of pig genomic DNA, comparing the resequencing data with the pig reference genome (Sscrofa11.1.109), obtaining all high-quality SNPs on the genome, and analyzing the correlation between each locus and the live piglet number trait to obtain a molecular marker associated with the live piglet number trait. The SNP molecular marker is located at the base position 32663785 on chromosome 9 in the pig genome Sscrofa11.1.109. The SNP site of this molecular marker has C / T polymorphism, where T is the favorable allele variation of the live piglet number trait.

[0028] The nucleotide sequence of the SNP molecular marker of this invention is shown in SEQ ID NO:1:

[0029] CCTTTGGCTGCTCGAAGAATTACTGGGACGTATAGAAAGGCTGGAGAAGCCTGCTCTCCACTCATGAGGAGTGTGCAGGTGTTAGCTTGCCACCAGGCAGAGCAAAGAAAGGTCTGCCCTAGTGGCTGTGAC CTTACTATTCTCCCCAGTTAGAGCAGAGTAAACATCAGTACCCCCTCACTCCAGACCACAGCTTAGCACTGGATCTAGGGTGGCAAGGTCCTGGGAAAAGATTCAGTCTAGGGATGCAAAGTCAACAA(SEQ ID NO.1).

[0030] The 9:32663785C>T site is located at position 156 from the 5' end of SEQ ID NO.1. The C / T polymorphism at this site is significantly associated with the number of live piglets born. The number of live piglets born to individuals with the CC genotype is significantly lower than that of individuals with the TC genotype (P<0.01), the number of live piglets born to individuals with the TC genotype is significantly lower than that of individuals with the TT genotype (P<0.01), and the number of live piglets born to individuals with the CC genotype is significantly lower than that of individuals with the TT genotype (P<0.001).

[0031] This invention provides substances for detecting the porcine SNP molecular marker, including PCR primers for amplifying genomic DNA fragments including the SNP sites, or a kit containing the primers. The primers for amplifying the SNP molecular marker of this invention include upstream primer F: 5'-CCTTTGGCTGCTCGAAGAATTAC-3' (SEQ ID NO. 2) and downstream primer R: 5'-TTGTTGACTTTGCATCCCTAGACTG-3' (SEQ ID NO. 3). The kit also includes PCR amplification reagents.

[0032] In the present application, the PCR amplification reagent is preferably 2x Taq Master Mix (Dye), which is prepared by optimizing the ratio of a mixture of 2-fold concentration of Taq DNA polymerase, dNTP mixture, MgCl2 and reaction buffer, has good amplification efficiency and high detection sensitivity.

[0033] The pig genomic DNA is subjected to PCR amplification using the primer set. As an embodiment, the PCR amplification procedure is 1 min of pre-denaturation at 94℃, 10 s of denaturation at 98℃, 15 s of annealing at 60℃, 45 s of extension at 72℃, 34 cycles, and finally 5 min of extension at 72℃. The obtained amplification product is sequenced to detect the genotype of the 9:32663785C>T site.

[0034] The standard for judging the pros and cons of the number of live piglets is:

[0035] If the genotype of the 9:32663785C>T site is TT, the pig has a large number of live piglets;

[0036] If the genotype of the 9:32663785C>T site is TC, the pig has a moderate number of live piglets;

[0037] If the genotype of the 9:32663785C>T site is CC, the pig has a small number of live piglets.

[0038] The sequencing method is not particularly limited in the present application, and a known sequencing method in the art can be used. In the embodiments of the present application, Sanger sequencing is used to determine the DNA sequence obtained by amplification. As an embodiment, the DNA sequence is sequenced in Oko (Wuhan) Biotechnology Co., Ltd., and the positive and negative reactions of the gene fragment are measured. According to the type of the base at the 156th position from the 5' end in the measured sequence, the pros and cons of the number of live piglets of the pig can be judged, so that the number of live piglets of the pig can be detected and the genetic breeding of the number of live piglets of the pig can be optimized.

[0039] The SNP molecular marker of the present application can be applied to the correlation analysis of the pig live piglet number related genotype or the pig live piglet number related trait, and provides a new molecular marker resource for the molecular marker assisted selection of pig reproductive performance.

[0040] The technical solutions of the present application will be described in more detail below in combination with the embodiments and drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0041] The reagent consumables used in the application are ordinary market products and can be obtained by market purchase.

[0042] The following takes Eqing black pigs as an example to illustrate the technical solutions of the application, but is not a limitation of the technical solutions of the application. Those skilled in the art can apply the technical solutions of the application to other pig breeds to detect and optimize breeding of pig live birth number traits, which also belongs to the protection scope of the application.

[0043] Example 1

[0044] Screening of molecular markers related to pig live birth number

[0045] (1) Collection of reproductive trait data of Eqing black pigs

[0046] 244 Eqing black pigs, all female, from Qingping Pig Farm in Dangyang City, Hubei Province, were selected, and their live birth number trait data were collected.

[0047] (2) Sample collection and genomic DNA extraction of Eqing black pigs

[0048] The ear tissue or tail tissue of the above Eqing black sow was collected using ear number pliers and placed in a 1.5 mL centrifuge tube containing 75% alcohol and stored at -20℃. The universal column type genomic extraction kit of Kangwei Century was used to extract the sample genomic DNA according to the manufacturer's instructions. After passing the quality inspection, it was stored in the -20℃ refrigerator.

[0049] (3) Whole genome resequencing and SNP detection quality control

[0050] The qualified samples were taken and YZSeq Tn5 Library Prep Kit was used for sequencing library construction. After library construction, library quality control was performed, and after passing the quality control, sequencing was performed on the DNBSEQ-T7B platform to obtain the original down-machine data RawReads, and the results were stored in the fastq file format.

[0051] The raw data was filtered using fastp software: removing adaptor sequences; removing reads with a proportion of N bases of more than 3%; removing reads with a length of less than 30 bases; removing reads with a proportion of low-quality (quality value less than 15) bases of more than 40%. Finally, the effective data (clean data) that met the requirements of data analysis was obtained.

[0052] The clean reads were aligned to the pig reference genome (Sscrofa11.1.109) using BWA software, and the alignment results were output in sam format. The sam file was compressed, sorted and duplicate reads were removed using Sambamba software. For the sorted and de-duplicated bam file, Sentieon software was used to detect SNP sites.

[0053] The SNP was filtered using BCFtools software, and the filtering parameters were QUAL < 30.0 || QD < 2.0 || FS > 60.0 || MQ < 40.0 || SOR > 4.0 || ReadPosRankSum < -8.0. Then VCFtools was used for quality control: remove variants with a deletion rate higher than 0.5; remove variants with a sequencing depth less than 3 and greater than 100; retain variants with an allele number of 2. Then Plink 2.0 was used to perform more stringent quality control on the results file output by VCFtools, and the quality control conditions were: retaining autosomal variants; filtering out variants with a minimum allele frequency less than 5%; filtering out variants with a deletion rate higher than 10%; filtering out variants that do not meet Hardy-Weinberg equilibrium. Finally, 13899481 high-quality SNPs were obtained for subsequent analysis.

[0054] (4) GWAS analysis

[0055] The MLM model of rMVP software was used to perform GWAS analysis on the number of live births (NBA) trait of Eqing Black pigs, and Manhattan plots and QQ plots were generated Figure 1 ). Taking P = 2.48e-06 as the threshold of significant SNP sites, the SNPs sites significantly related to the number of live births trait of Eqing Black pigs were obtained.

[0056] Example 2

[0057] Association analysis of different genotypes of significant SNPs with the number of live births

[0058] For the significant SNPs sites screened by GWAS, the genotype data of each Eqing Black pig at the C>T mutation site at position 32663785 on chromosome 9 was extracted using plink software, individuals with the same genotype were grouped into one group, and then the single factor ANOVA test method of SPSS 26.0 software was used to detect the influence of different genotypes on the phenotype. The statistical data are expressed as mean ± standard deviation, * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001. Finally, GraphPad Prism 8 software was used for plotting.

[0059] The results show that Figure 2The 9:32663785C>T site variation can cause the number of live births of E'qing black pigs to increase. The average number of live births corresponding to the wild type CC genotype, heterozygous mutant TC genotype and homozygous mutant TT genotype is 8.89, 9.83 and 11.61, respectively. The TC heterozygote is significantly higher than the CC wild type (P<0.01), and the TT homozygote is significantly higher than the CC wild type and the TC heterozygote (P<0.01). Therefore, the site variation is beneficial to the number of live births, and the TC and TT mutant types are both favorable allelic genotypes, and selection of the mutant individuals should be strengthened during breeding.

[0060] Table 19: Association analysis of different genotypes of 9:32663785C>T site and number of live births

[0061] genotype Number of individuals Number of live offspring (heads) Comparison group P-value CC 131 8.89±2.34 CCvsTC 0.003** TC 84 9.83±2.05 TCvsTT 0.004** TT 16 11.61±2.72 CCvsTT 0.0001***

[0062] Example 3

[0063] Verification of polymorphic sites

[0064] In order to verify the authenticity and reliability of the SNP sites obtained by high-throughput sequencing, and not caused by sequencing errors, 6 sows were selected as samples and labeled as 1-6. The number of live births per pregnancy in the entire reproductive cycle of the pigs was recorded, and the DNA sequence of the pig sample was extracted. The genotypes of the 9:32663785C>T site were subjected to Sanger sequencing.

[0065] 1. Primer design: Use the "subseq" parameter of the seqtk software to extract the sequence information of 500 bp upstream and downstream of the 9:32663785 site. According to the extracted 1000 bp DNA sequence, use the primer design software Primer Premier 5.0 to design primers.

[0066] F: CCTTTGGCTGCTCGAAGAATTAC;

[0067] R: TTGTTGACTTTGCATCCCTAGACTG;

[0068] The primer amplification sequence information is as follows, wherein the 9:32663785C>T site is located at the 156th position from the 5' end and is marked in bold, and the underlined part is the corresponding sequence of the primer.

[0069]

[0070] 2. PCR amplification: Add 1 μL of DNA template, 8 μL of double-distilled water, 10 μL of 2×Es Taq MasterMix (Dye), and 0.5 μL of primer to a 20 μL system.

[0071] PCR reaction conditions: 94℃ pre-denaturation 1 min, 98℃ denaturation 10 s, 60℃ annealing 15 s, 72℃ extension 45 s, 34 cycles, finally 72℃ extension 5 min.

[0072] 3. Sanger sequencing: The sequence of the DNA amplification product was sequenced in Okbio (Wuhan) Biotechnology Co., Ltd., and the forward and reverse reactions of the gene fragment were measured. The measured sequence was compared with the sequence of the pig reference genome (Sscrofa11.1.109) in Ensembl genome, and the mutation of the corresponding SNP site was obtained.

[0073] Table 2: The number of live piglets and the genotype of the 9:32663785C>T site of the sample pigs

[0074] Sample number Number of live offspring (feet) genotype 1 9 CC 2 9.6 CC 3 10.4 TC 4 11.86 TC 5 13 TT 6 12 TT

[0075] The sequencing results are shown in Table 2, wherein Figure 3 , A and B are CC genotype samples, C and D are TC genotype samples, and E and F are TT genotype samples, which are matched with the number of live piglets of the detected pigs. Figure 3

[0076] In summary, the SNP molecular marker related to the average number of live piglets of pigs provided by the present application can identify the number of live piglets of pigs according to the genotype, realize early selection, and accelerate the breeding process.

[0077] The above only describes the preferred embodiments of the present application, and it should be pointed out that for ordinary skilled persons in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application.​

Claims

1. The application of a substance for detecting porcine SNP molecular markers in any of the following aspects, characterized in that, Used for detecting or assisting in the detection of the live piglet count trait; Genetic breeding used to increase the number of live piglets produced; The SNP molecular marker is located at the base position 32663785 on chromosome 9 in the pig reference genome Sscrofa11.1.

109. The SNP site of this molecular marker has C / T polymorphism, where T is the favorable allele variation for the number of live piglets produced. The pigs mentioned are Eqing Black Pigs.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 156th bp of the sequence shown in SEQ ID NO.1 has a C / T polymorphism.

3. The application according to claim 1, characterized in that, The substance for detecting porcine SNP molecular markers includes PCR primers for amplifying genomic DNA fragments, including the SNP sites, or a kit containing the primers.

4. The application according to claim 3, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. The application according to claim 3, characterized in that, The kit also includes PCR amplification reagents.

6. A method for detecting the number of live piglets produced by Eqing Black Pigs, characterized in that, The base type at locus 32663785 on chromosome 9 in the pig genome Sscrofa11.1.109 was examined. The TC and CC genotype populations had fewer live piglets than the TT genotype population.

7. The method according to claim 6, characterized in that, A method for detecting the base type at position 32663785 on chromosome 9 in the pig genome Sscrofa11.1.109 includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification on pig genomic DNA, and detecting the genotype at position 156 in the gene sequence of the amplified product.

8. The method according to claim 7, characterized in that, The genotype of the 9:32663785C>T locus was obtained using Sanger sequencing.

9. A genetic breeding method for increasing the number of live piglets produced in Eqing Black pigs, characterized in that, Determine the base type at position 32663785 on chromosome 9 of the Sscrofa11.1.109 genome of the breeding pigs in the core pig herd, and make corresponding selections based on this base type: In the breeding of pigs, individuals with the TT and TC bases at the 32663785th locus on chromosome 9 in the pig genome Sscrofa11.1.109 are selected, while CC-type individuals are eliminated. This process aims to increase the frequency of the T gene at this locus in each generation, thereby increasing the number of live piglets produced in the offspring.

10. The method according to claim 9, characterized in that, The bases at position 32663785 on chromosome 9 in the pig genome Sscrofa11.1.109 are shown as the 156th bp of the sequence shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker related to litter size of sow and application thereof

    CN102080081A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to litter size character of sow and application of SNP molecular marker

    CN114736975A