PCR (Polymerase Chain Reaction) detection primer, detection kit and detection method for anti-PS II inhibitor herbicide quinoa
By designing molecular marker sites and PCR detection primers associated with resistance to quinoa PS II inhibitor herbicides, the problem of detecting quinoa resistance in existing technologies has been solved, enabling rapid and accurate resistance prediction and scientific guidance for herbicide use.
Patent Information
- Application Number
- CN202511357572.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-23
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-09-23
AI Technical Summary
Existing technologies are insufficient for the rapid, simple, and accurate detection of resistance to PS II inhibitor herbicides, and traditional methods cannot explain the resistance mechanism at the microscopic molecular level, thus failing to effectively guide scientific drug use.
Molecular marker sites associated with resistance to PS II inhibitor herbicides of quinoa were designed, and corresponding PCR detection primers and kits were developed. Resistance to quinoa was determined by detecting a specific mutation site in the psbA gene (the mutation from C to A at position 371).
It enables rapid and accurate prediction of quinoa's sensitivity or resistance to PS II inhibitor herbicides, simplifies the detection process, reduces costs, and provides scientific guidance for field application.
Smart Images

Figure CN120843731A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides of lambsquarters, and particularly to molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides of lambsquarters, and their application in detecting resistance to PS II inhibitor herbicides of lambsquarters. It belongs to the field of molecular marker sites and PCR detection primers associated with resistance to PS II inhibitor herbicides of lambsquarters and their applications. Background Technology
[0002] Photosystem II (PS II) is a crucial part of plant photosynthesis, containing a reaction center composed of D1 and D2 proteins, a light-harvesting antenna system, and an oxygen-evolving complex. Functionally, it absorbs and transfers light energy, achieves charge separation and stabilization, splits water to release oxygen, promotes electron transport, and stimulates the production of ATP and NADPH. PS II inhibitor herbicides, including bentazon, atrazine, cyclomethrin, and fenpropathrin, inhibit photosynthesis by interfering with the electron transport chain, ultimately leading to weed death. These herbicides are widely used for weed control in soybeans, cotton, and other crops.
[0003] However, in recent years, quinoa ( Chenopodium album L. The control efficacy of PS II inhibitor herbicides has significantly decreased, and some Chenopodium species have even developed cross-resistance to multiple PS II inhibitor herbicides. Therefore, it is urgent to develop a rapid, simple, and easy-to-use method for detecting herbicide-resistant weeds, and a rapid, simple, and accurate method for detecting herbicide-resistant Chenopodium is needed.
[0004] Traditional methods for detecting herbicide-resistant weeds typically involve collecting seeds of suspected resistant weeds from the field, germinating them, sowing them in culture pots, cultivating them to a certain leaf age, spraying them with a series of herbicides, continuing cultivation for a period of time, and finally calculating the medium concentration of herbicide and the resistance index by cutting the above-ground parts and weighing them fresh or drying them. This method has certain limitations, such as requiring a dedicated plant culture room, and having a long cultivation process and detection cycle; it cannot explain the resistance mechanism at the microscopic molecular level, nor can it provide guidance for scientific pesticide use, thus failing to effectively prevent the further development of herbicide-resistant populations.
[0005] With the advancement and application of molecular biology techniques, more and more herbicide-resistant weeds are being discovered, and their resistance mechanisms are gradually being revealed. Studies have shown that the resistance mechanism of lambsquarters to PS II inhibitor herbicides is mainly related to… psbA It is related to gene mutations. Therefore, by detecting... psbA Specific mutations in the gene sequence can determine whether quinoa has resistance to PS II inhibitor herbicides. Summary of the Invention
[0006] One of the objectives of this invention is to provide molecular marker sites associated with resistance to quinoa PS II inhibitor herbicides.
[0007] A second objective of this invention is to provide PCR detection primer pairs designed based on the aforementioned molecular marker sites.
[0008] A third objective of this invention is to provide a PCR kit for predicting the sensitivity or resistance of quinoa to PS II inhibitor herbicides.
[0009] The fourth objective of this invention is to apply the target gene, PCR detection primer pair, and PCR kit to predict the sensitivity or resistance of quinoa to PS II inhibitor herbicides.
[0010] In order to achieve the above objectives, the main technical solutions adopted by the present invention include: One aspect of this invention is the provision of molecular marker sites associated with resistance to quinoa PS II inhibitor herbicides.
[0011] In a preferred embodiment of the present invention, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2: catttcggct cggttgcagc ggctactgct gttttcttga tctacccaat tggtcaagga agcttttctg atggtatgcc tctaggaatc tctggtactt tcaactttat gattgtattc caggctgagc acaacatcct tatgcatcca tttcacatgt taggtgtagc tggtgtattc ggcggctccc tttttagtgc tatgcatggg tccttggtaa cttctagttt gatcagggaa actacagaaa atgaatctgc taatgagggt tacagattcg ggcaagagga agaaacttat aatattgtag ctgctcatgg ttatttcggc cgattgatct ttcaatatgc tagtttcaac aactctcgtt ctttacactt cttcttagct gcttggcctg tagtagt ttggtttact gctttaggta ttagtactat ggccttcaac ttaatgggt tcaatttcaa ccaatctgta gttgatagtc aaggtcgtgt aattaatact tgggctgata tcattaaccg tgctaacctt ggtatggaag ttatgcatga acgtaatgct cataacttcc ctctagacct agccgctatc gaagctccat cttaa(SEQ ID No.1)。
[0012] catttcggct cggttgcagc ggctactgct gttttcttga tctacccaat tggtcaagga agcttttctg atggtatgcc tctaggaatc tctggtactt tcaactttat gattgtattc caggctgagc acaacatcct tatgcatcca tttcacatgt taggtgtagc tggtgtattc ggcggctccc tttttagtgc tatgcatggg tccttggtaa cttctagttt gatcaggga actacagaaa atgaatctgc taatgagggt tacagattcg ggcaagagga agaaacttat aatattgtag ctgctcatgg ttatttcggc cgattgatct ttcaatatgc tagtttcaac aactctcgtt atttacactt cttcttagct gcttggcctg tagtagt ttggtttact gctttaggta ttagtactat ggccttcaac ttaatgggt tcaatttcaa ccaatctgta gttgatagtc aaggtcgtgt aattaatact tgggctgata tcattaaccg tgctaacctt ggtatggaag ttatgcatga acgtaatgct cataacttcc ctctagacct agccgctatc gaagctccat cttaa (SEQ ID No. 2).
[0013] The molecular marker site is located at the 371st base of the nucleotide sequence shown in SEQ ID No. 2, where the base is mutated from C to A, resulting in a phenotype of resistance to PS II inhibitor herbicides.
[0014] Another aspect of the present invention is to provide PCR detection primer pairs designed based on the said molecular marker sites.
[0015] In a preferred embodiment of the present invention, the PCR detection primer pair consists of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4; the nucleotide sequences amplified using SEQ ID No. 3 and SEQ ID No. 4 cover the gene fragment regions shown in SEQ ID No. 1 and SEQ ID No. 2; wherein, the 371st base of SEQ ID No. 1 is C, representing a sensitive type to PS II inhibitor herbicides; and the 371st base of SEQ ID No. 2 is A, representing a resistant type to PS II inhibitor herbicides.
[0016] The primer pairs described above can be used as primer pairs for amplifying molecular markers, and thus for predicting the sensitivity or resistance of lambsquarters to PS II inhibitor herbicides. Therefore, the application of these primer pairs in detecting the sensitivity or resistance of lambsquarters to PS II inhibitor herbicides is within the scope of protection of this invention. Furthermore, kits containing the aforementioned primer pairs for detecting the sensitivity or resistance of lambsquarters to PS II inhibitor herbicides are also within the scope of protection of this invention.
[0017] Another aspect of the present invention provides a PCR kit for predicting the sensitivity or resistance of quinoa to PS II inhibitor herbicides, comprising: Taq enzyme, dNTPs, and Mg 2+ ddH2O and PCR detection primer pairs; the PCR detection primer pairs are designed based on the target gene shown in SEQ ID No. 2.
[0018] In a preferred embodiment of the present invention, the PCR detection primer pair consists of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4.
[0019] Another aspect of the present invention is to apply the aforementioned molecular markers, PCR detection primer pairs, and PCR kits to predict the sensitivity or resistance of quinoa to PS II inhibitor herbicides.
[0020] For reference, the present invention also provides a PCR identification method for predicting the sensitivity or resistance of quinoa to PS II inhibitor herbicides, comprising: (1) using the genomic DNA of quinoa to be tested as a template and establishing a PCR amplification system using the PCR detection primers described above for PCR amplification; (2) sequencing the PCR amplification product; if the 371st base of the amplification product is C, then the quinoa to be tested is sensitive to PS II inhibitor herbicides; if the 371st base of the amplification product is A, then the quinoa to be tested is resistant to PS II inhibitor herbicides.
[0021] In a preferred embodiment of the present invention, the PCR amplification system comprises: 1 μL each of upstream and downstream primers, 1 U of Taq DNA polymerase, and 25 mM MgSO₄. 2+ 2 μL; DNA template 2 μL, 2.5 mM dNTPs 1 μL, double-distilled water to make up to 50 μL.
[0022] In a preferred embodiment of the present invention, the PCR amplification conditions are as follows: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 5 min, and storage at 4℃.
[0023] This invention screened and compared the DNA sequences of *Chenopodium album* exhibiting different resistances to PS II inhibitor herbicides to identify mutation sites inducing resistance to these herbicides. Based on these mutations, specific PCR detection primer pairs were designed to identify *Chenopodium album* resistant to PS II inhibitor herbicides. psbA Based on the mutation sites and amino acid mutation types, this invention establishes a PCR kit and prediction method for resistance to the PS II inhibitor herbicide *Chenopodium album*. The PCR kit or prediction method established by this invention can rapidly and accurately predict whether *Chenopodium album* is sensitive or resistant to PS II inhibitor herbicides; it can be used to determine whether PS II inhibitor herbicides can continue to be used to control resistant *Chenopodium album* in the field, and has the advantages of simple operation, fast speed, low cost, and high accuracy. Attached Figure Description
[0024] Figure 1The image shows the PCR amplification results of four primer pairs; where M is DNA Marker DL2000; 1 is the PCR amplification band of primer pair psbA-1f / 1r; 2 is the PCR amplification band of primer pair psbA-2f / 2r; 3 is the PCR amplification band of primer pair psbA-3f / 3r; and 4 is the PCR amplification band of primer pair psbA-4f / 4r.
[0025] Figure 2 The results show the sensitivity detection of the PCR primer pair (psbA-1f / 1r).
[0026] Figure 3 Electrophoresis diagram of PCR primer pair (psbA-1f / 1r) for PCR amplification products of psbA gene from different quinoa populations; M: DL2000 DNA Marker (100–2000 bp); lanes 1-18 represent amplification products from 18 quinoa samples collected from Heilongjiang, Inner Mongolia, and Xinjiang, respectively.
[0027] Figure 4 For quinoa populations that are sensitive to or resistant to PS II inhibitor herbicides psbA Image showing the base comparison results at position 371 of the gene; where S represents a quinoa population sensitive to PS II inhibitor herbicides. psbA The diagram shows the amino acid sequence of the protein encoded by the gene (the product encoded by TCT is serine); R represents the quinoa population resistant to PS II inhibitor herbicides. psbA The result of the 270th amino acid of the gene-encoded protein (TAT encodes tyrosine). Detailed Implementation
[0028] The present invention will be further described below with reference to specific embodiments or test examples, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments or test examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.
[0029] Example 1: Establishment of a method for detecting resistance of lambsquarters to PS II inhibitor herbicides 1. Extraction of genomic DNA from quinoa Take 100 mg of quinoa leaves, grind them thoroughly with liquid nitrogen, and extract quinoa genomic DNA using the CTAB method. The DNA concentration should be greater than 2 ng / µL.
[0030] 2 Primer Design and Synthesis Based on the records of the genus *Chenopodium* in GenBankpsbA The nucleotide sequence of the gene (accession number: YP_009380194.1) was used to design multiple pairs of specific primers using Oligo 9 software, which were then sent to the company for synthesis. The nucleotide sequences of the multiple pairs of specific primers are shown below: psbA-1f: AGCCTTCATTGCTGCTCCTC (SEQ ID No. 3); psbA-1r: GCCCGAATCTGTAACCCTCA (SEQ ID No. 4).
[0031] psbA-2f:GACGCATACCCAGACGGAAA (SEQ ID No. 5); psbA-2r: TGGTTATACAACGGTGGTCCT (SEQ ID No. 6).
[0032] psbA-3f:AACCGGAGCCGAATATGCAA (SEQ ID No. 7); psbA-3r:GTGGTTATACAACGGTGGTCCT (SEQ ID No. 8).
[0033] psbA-4f:TTTCCGTCTGGGTATGCGTC (SEQ ID No. 9); psbA-4r: AGATGGAGCTTCGATAGCGG (SEQ ID No. 10).
[0034] Figure 1 To present the results of the multi-pair specific primer screening experiment, lanes 1-4 show the PCR amplification results of primer pairs psbA-1f / 1r, psbA-2f / 2r, psbA-3f / 3r, and psbA-4f / 4r, respectively. Electrophoresis results showed that primer pair psbA-1f / 1r not only exhibited high amplification specificity but also significantly high amplification efficiency. Therefore, primer pair psbA-1f / 1r was selected as the optimal primer pair for this invention.
[0035] 3. Used for detecting quinoa psbA PCR reaction system for gene mutation sites The PCR reaction system consisted of: 5 µL of 10×PCR reaction buffer, 2 µL of dNTPs (2.5 mM), 1 µL each of forward and reverse primers, 1 U of Taq DNA polymerase, 2 µL of template DNA, and double-distilled water to a final volume of 50 µL.
[0036] 4. Used to amplify quinoa psbA Gene response program The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 5 min, and storage at 4℃.
[0037] 5. Identification and sequencing of PCR products PCR amplification products were analyzed using 1% agarose gel electrophoresis and then sent to the company for sequencing to determine their suitability for PS II inhibitor-resistant or susceptible lambsquarters populations. psbA After gene sequencing, sequence alignment analysis is performed to find... psbA Mutation site.
[0038] 6. PCR reaction sensitivity test The extracted quinoa DNA was diluted to 5 ng / µL, and 0µL, 0.5µL, 1µL, 1.5µL and 2µL of quinoa DNA were used as templates for PCR amplification. The sensitivity of the PCR reaction was then tested.
[0039] according to Figure 2 The sensitivity test results show that when the template volume is 2 µL, the PCR product bands are clear, indicating that... psbA Gene amplification was successful. Calculations showed that the amount of quinoa DNA used for detection should be no less than 10 ng.
[0040] Experimental Example 1: Chenopodium glutamate resistant to PS II inhibitor herbicides psbA Gene mutation site identification test Eighteen suspected resistant quinoa samples were collected from different soybean fields in Heilongjiang, Inner Mongolia, and Xinjiang. Approximately 200 mg of quinoa leaf extract from each sample was rapidly added to liquid nitrogen and ground. Genomic DNA was extracted using the CTAB method, with a DNA concentration greater than 5 ng / µL. The experimental method is described in Example 1. The DNA extraction concentration of each sample was uniformly diluted to 50 ng / µL, and the sample volume was 10 μL. Each sample successfully amplified a specific band of approximately 615 bp. Figure 3 This indicates that the designed primer pair has good versatility and amplification efficiency.
[0041] The PCR products were sequenced separately, and mutation sites were identified by comparison; the experimental results are shown in Table 1 and 2. Figure 4 As shown.
[0042] Table 1. PCR identification method for different Chenopodium species psbA Gene mutation sites
[0043] The results showed that 18 quinoa samples resistant to PS II inhibitor herbicides... psbA The gene mutates from C to A at position 371, resulting in a change from serine to tyrosine, which changes the sensitivity of quinoa to PSII inhibitor herbicides to resistance to PSII inhibitor herbicides.
[0044] Test Example 2 psbA Validation of the significant association between the C→A mutation at position 371 of the gene and the resistance phenotype of PS II inhibitor herbicides. 1 Test method 1.1 Material Collection and Genotyping A total of 110 samples of quinoa were collected from Northeast, North, and Northwest China. The target fragment was amplified using the psbA-1f / 1r primer pair from Example 1, and then Sanger sequencing was performed. Based on the difference in the 371st base, the samples were divided into: wild type ( [[ID= (Base C at position 371 of gene): 52 strains; mutant ( (Gene with base A at position 371): 58 strains; other mutant individuals were excluded to ensure the uniqueness of the mutation site.
[0045] 1.2 Herbicide Treatment All samples were cultured in uniform pots indoors until the 3-4 leaf stage; a single application of bentazon (a representative PS II inhibitor) was performed using the recommended dose; temperature and humidity were kept constant after application, and phenotypes were recorded 14 days later.
[0046] 1.3 Phenotypic Determination Criteria Resistance rating scale: 0 (complete death) to 9 (good growth); Survival statistics criteria: Resistant: survives and resumes growth; Sensitive: yellows or dies.
[0047] 2 Test results The statistical and significance analysis results of phenotype and genotype are shown in Table 2.
[0048] Table 2 Association analysis of gene mutation at position 371 with PS II inhibitor herbicide resistance phenotype.
[0049] Chi-square test (x 2 The survival rate difference was statistically significant (P<0.01) according to the test analysis. The resistance scores showed significant differences after t-test analysis (P<0.01). As can be seen from the test results in Table 2, A statistically significant association exists between the C→A mutation at position 371 of the gene and the herbicide resistance phenotype.
[0050] The above test results further prove A gene mutation (C→A at position 371) can be used as... Gene-mediated molecular markers of resistance to PSII inhibitor herbicides can aid in molecular detection and field resistance monitoring.
Claims
1. A molecular marker site associated with resistance to PS II inhibitor herbicides, characterized in that, The molecular marker site is located at the 371st base of the nucleotide sequence shown in SEQ ID No. 2, where the base is mutated from C to A, resulting in a phenotype of resistance to PS II inhibitor herbicides.
2. The application of the molecular marker site described in claim 1 in predicting susceptibility or resistance of quinoa to PS II inhibitor herbicides.
3. The application according to claim 2, characterized in that, include: (1) Extract DNA from the quinoa to be tested; (2) Design PCR detection primer pairs based on the nucleotide sequence of the molecular marker site according to claim 1; (3) Establish a PCR amplification system using the designed PCR detection primer pairs and perform PCR amplification; (4) Sequencing is performed after obtaining the PCR amplification product. If the 371st base of the amplification product is C, the quinoa sample to be tested is sensitive to PS II inhibitor herbicides; if the 371st base of the amplification product is A, the quinoa sample to be tested is resistant to PS II inhibitor herbicides.
4. The PCR detection primer pair designed with molecular marker sites according to claim 1, characterized in that, The PCR detection primer pair consists of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No.
4.
5. The use of the PCR detection primer pair according to claim 4 in detecting the resistance of quinoa to PS II inhibitor herbicides.
6. A method for predicting the sensitivity or resistance of lambsquarters to PS II inhibitor herbicides, characterized in that, include: (1) Using the genomic DNA of the quinoa to be tested as a template and the PCR detection primers described in claim 4 to establish a PCR amplification system for PCR amplification; (2) After obtaining the PCR amplification product, perform sequencing. If the 371st base of the amplification product is C, the quinoa sample to be tested is sensitive to PS II inhibitor herbicides; if the 371st base of the amplification product is A, the quinoa sample to be tested is resistant to PS II inhibitor herbicides.
7. The method according to claim 6, characterized in that, The PCR amplification system consisted of: 1 μL each of upstream and downstream primers, 1 U of Taq DNA polymerase, and 25 mM MgSO4. 2+ 2 μL; DNA template 2 μL, 2.5 mM dNTPs 1 μL, double-distilled water to make up to 50 μL; The PCR amplification conditions were as follows: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 5 min, and storage at 4℃.
8. A PCR kit for identifying sensitivity or resistance to PS II inhibitor herbicides, comprising: Taq enzyme, dNTPs, Mg 2+ The PCR detection primer pair is characterized in that the PCR detection primer pair is the PCR detection primer pair as described in claim 4.
9. The use of the PCR kit of claim 8 in predicting quinoa's sensitivity or resistance to PS II inhibitor herbicides.
Citation Information
Patent Citations
PCR detection method of photosystem II inhibitor herbicide resistant digitaria sanguinalis
CN106119369A
Chenopodium quinoa willd CqARF2 gene mutant as well as identification method and application thereof
CN120591297A