Anti-reactive oxygen super-stable super-resolution DNA framework fluorescent dot and preparation method and application thereof
By combining a hydrophilic tetrahedral DNA framework with a hydrophobic fluorescent molecule, the problem of photobleaching of fluorescent probes in reactive oxygen species environments is solved, resulting in a fluorescent probe with high brightness and photostability, suitable for super-resolution imaging.
Patent Information
- Application Number
- CN202510783125.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-06-12
AI Technical Summary
Existing fluorescent probes have shortcomings in terms of high brightness, photostability, and precise conjugation ability. They are particularly prone to photobleaching in oxygen-rich solutions, and traditional methods suffer from issues of biocompatibility and complex chemical modifications.
By combining a hydrophilic tetrahedral DNA framework (TDF) with a hydrophobic fluorescent molecule, and assembling four ssDNA strands modified with fluorescent molecules, the orientation of the fluorescent molecules can be regulated to be either inside or outside the tetrahedral framework. This, combined with the nano-constraint effect of the DNA framework, improves photostability.
It improves the photostability of fluorescent molecules, enhances fluorescence intensity, and solves the photobleaching problem of traditional fluorescent probes in reactive oxygen species environments, making it suitable for super-resolution imaging techniques such as STED and SIM.
Smart Images

Figure CN120865889A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bionanotechnology, and more specifically to a super-stable, super-resolution DNA framework fluorescent spot resistant to reactive oxygen species, its preparation method, and its application. Background Technology
[0002] Super-resolution fluorescence imaging is a powerful method for studying the spatiotemporal distribution of biomolecules within cells and tracking their dynamics. The selection of fluorophores is crucial for optimizing imaging performance. An ideal fluorophore should possess high photostability, brightness, and the ability to bind to biomolecules in a controllable manner. Improving the photostability of the probe not only extends the timescale of molecular dynamics tracking but also enhances imaging resolution. This is particularly important for high temporal resolution techniques such as structured illumination microscopy (SIM) and stimulated emission depletion microscopy (STED), which rely on fluorescence excitation and depletion saturation. For example, in SIM imaging, creating a super-resolution image requires multiple intermediate frames; excessive photobleaching can lead to signal loss between frames, thus affecting the final image quality. Organic fluorophores often suffer from severe photobleaching and low brightness, limiting their application in long-term super-resolution imaging. Alternative probes, such as quantum dots and fluorescent nanoparticles, offer advantages such as high brightness and photostability but are hampered by problems such as severe flicker and uncontrollable conjugation ratios. Therefore, there is an urgent need for novel fluorescent probes that combine photostability, high brightness, small size, and precise conjugation capabilities.
[0003] Organic fluorophores are prone to photobleaching in oxygen-rich solutions via photo-oxidation reactions. Traditional methods to improve their photostability include adding enzyme-catalyzed oxygen scavenging systems and three-state quenchers. However, these methods require a variety of exogenous solution additives, and the poor water solubility and high biotoxicity of three-state quenchers make them unsuitable for use in living cells. Covalent linking of three-state quenching groups to fluorophores can reduce the need for solution additives, but it brings challenges such as complex chemical modifications and reduced brightness. Nature provides inspiration from peptide and RNA scaffolds, which form biofluorophores by generating chromophores during protein folding. Barrel-shaped peptide frameworks suppress nonradiative conformational changes of chromophores while separating them from water molecules and reactive oxygen species (ROS). Inspired by this nano-confinement effect, various synthetic molecular cages have been developed to encapsulate fluorophores, including cucurbit[7]uril, supramolecular coordination complexes (SCCs), metal-organic frameworks (MOFs), and covalent organic frameworks (COFs). Despite these innovations, challenges remain in precisely regulating the number and arrangement of fluorophores within these frameworks and in achieving effective biofunctionalization. Therefore, there is an urgent need for a biocompatible framework structure that can precisely control the number and spatial arrangement of fluorophores while maintaining their functional adaptability for biological applications.
[0004] Structural DNA nanotechnology enables the construction of three-dimensional DNA frameworks with near-atomic precision. DNA frameworks are highly customizable in shape and size, offering addressability and ease of modification. Functional molecules can be precisely positioned on the DNA framework, allowing researchers to achieve specific spatial arrangements. For example, by controlling modification sites on the DNA framework, researchers have successfully encapsulated alkyl chains, liposomes, nucleic acid aptamers, and proteins within the nanopores of the DNA framework via covalent bonds. Previous studies have shown that fluorophores bound to the outer surface of DNA frameworks can generate high-brightness fluorescent dots, barcodes, or optical devices. Vale and colleagues demonstrated that labeling six fluorescent molecules on the outside of a cubic DNA nanostructure significantly improves photostability. However, while the spacing between peripheral fluorophores on the DNA framework has been well studied, the photostability of dyes confined within the DNA framework cavity, similar to the protective environment of green fluorescent protein, remains largely unexplored. Summary of the Invention
[0005] The purpose of this invention is to provide a super-stable, super-resolution DNA framework fluorescent spot resistant to reactive oxygen species, its preparation method, and its application, thereby solving the problem that the existing technology still lacks a novel fluorescent probe that combines photostability, high brightness, small size, and precise conjugation ability.
[0006] To solve the above problems, the present invention adopts the following technical solution:
[0007] According to a first aspect of the present invention, a super-stable, super-resolution DNA framework fluorescent spot resistant to reactive oxygen species is provided. The DNA framework fluorescent spot is composed of a hydrophilic tetrahedral DNA framework (TDF) and hydrophobic fluorescent molecules, assembled by four ssDNA molecules modified by fluorescent molecules. All fluorescent molecules of the DNA framework fluorescent spot face the interior of the tetrahedral DNA framework or all fluorescent molecules face the exterior of the tetrahedral DNA framework. The DNA framework fluorescent spot has improved photostability and can be used for super-resolution imaging.
[0008] It should be understood that the present invention uses conventional methods to assemble tetrahedral DNA structures, but the innovation of the present invention lies in the fact that by setting nick sites, fluorescent molecules can be oriented towards the inside or outside of the tetrahedral framework, thereby achieving orientation control of fluorescent molecules.
[0009] In a preferred embodiment, the TDF structure has a side length of 20 base pairs (approximately 6.8 nm).
[0010] In another preferred embodiment, conventional commercially available fluorescent molecules are used as the fluorescence signal source. The hydrophobic fluorescent molecules include Cy3, Cy5, ROX, FAM, Alexa488, or Alexa647.
[0011] In another preferred embodiment, the number of fluorescent molecules in the TDF structure varies from 1 to 4.
[0012] In another preferred embodiment, all fluorescent molecules in the TDF structure face the interior of the tetrahedron.
[0013] In another preferred embodiment, all fluorescent molecules in the TDF structure face outwards from the tetrahedron.
[0014] According to the research presented in this invention, the inward-facing structure of fluorescent molecules exhibits better photostability than the outward-facing structure of fluorescent molecules.
[0015] In another preferred embodiment, the TDF structure is formed by hybridization of four nucleic acid strands.
[0016] According to a second aspect of the present invention, a method for preparing ultra-stable, super-resolution DNA framework fluorescent dots resistant to reactive oxygen species is provided. The method includes the following steps: A1: providing four complementary ssDNA strands that can be assembled into a tetrahedral DNA framework through base pairing; A2: heating the four complementary ssDNA strands at 95°C for 10 min using a PCR instrument, followed by annealing at 4°C for 20 min to obtain photostable SDF fluorescent dots; A3: quantitatively controlling the number of fluorescent molecules on the tetrahedral DNA framework by changing the relative ratio of fluorescently modified ssDNA to unmodified ssDNA, and regulating the orientation of fluorescent molecules by changing the modification sites of fluorescent molecules on ssDNA; A4: purifying the obtained DNA framework fluorescent dots by HPLC.
[0017] In a preferred embodiment, the preparation method specifically includes the following steps: purchasing the required DNA sequence from Shanghai Sangon Biotech Co., Ltd., and dissolving and quantifying it; preparing TDF nanostructures from four complementary ssDNA strands using a PCR instrument, followed by heating and annealing to obtain photostable SDF fluorescent spots; quantitatively controlling the number of fluorescent molecules on the tetrahedral DNA framework by changing the relative ratio of fluorescently modified ssDNA to unmodified ssDNA; these assemblies containing one, two, three, and four Cy3 molecules facing inward are respectively named TDF-1Cy3-in The assemblies, consisting of one, two, three, and four Cy3 molecules facing outwards, were named TDF-1Cy3-outside, TDF-2Cy3-outside, TDF-3Cy3-outside, and TDF-4Cy3-outside, respectively. The synthesized molecular assemblies were purified by high-performance liquid chromatography, and the probes were characterized by polyacrylamide gel electrophoresis and atomic force microscopy.
[0018] In a preferred embodiment, various DNA framework fluorescent spots are customized by adjusting the orientation, valence state, and type of fluorophores within the tetrahedral DNA framework.
[0019] In another preferred embodiment, when the side length of the tetrahedral DNA frame is 20 bases, the ninth base along each side from 5' to 3' is selected as the nick site, so that all fluorescent molecules face the interior of the tetrahedral DNA frame; the four vertices of the tetrahedral DNA frame are selected as nick sites, so that all fluorescent molecules face the exterior of the tetrahedral DNA frame.
[0020] In another preferred embodiment, in order to enable the fluorescent molecules within the fluorescent spots of the DNA framework to have a certain degree of freedom and to form hydrophobic oligomers through mutual contact, several T bases are designed as linkers between the fluorescent molecules and the ssDNA strand of the tetrahedral DNA framework.
[0021] According to a third aspect of the present invention, a method for characterizing a DNA framework fluorescent spot with ultra-stable and super-resolution resistance to reactive oxygen species is provided. The characterization method includes: B1: providing a DNA framework fluorescent spot; B2: attaching the DNA framework fluorescent spot to a confocal dish after plasma treatment by electrostatic adsorption; B3: performing long-term fluorescence imaging of the sample using total internal reflection fluorescence microscopy (TIRF) under preset conditions; B4: processing the data using ImageJ and Python, and determining the photostability and fluorescence intensity of the probe based on the fluorescence imaging results; B5: measuring the fluorescence spectrum of the DNA framework fluorescent spot using an ELISA reader under preset conditions, and determining the FRET efficiency based on the fluorescence spectrum results; B6: modifying the structure of the DNA framework fluorescent spot with two cell membrane targeting cholesterol molecules to give it cell membrane targeting properties, then incubating it with cells at room temperature for 10-30 min, and imaging using both laser confocal imaging and STED super-resolution imaging modes.
[0022] In a preferred embodiment, HeLa cells were used as the research object. To enable TDF-Cy3-inside to target the cell membrane, two cell membrane-targeting cholesterol molecules (Chol) were structurally modified. 1 µM of the above probe was incubated with HeLa cells at room temperature for 20 min, and imaging was performed using both confocal laser imaging and STED super-resolution imaging modes.
[0023] In another preferred embodiment, cells were treated with a 1 µM inward-facing probe as the experimental group, while a 3 µM ssDNA-Cy3 probe and a 1 µM outward-facing probe were selected as the control group for comparative analysis to ensure that the total number of VIEs in the system remained consistent.
[0024] In another preferred embodiment, the detailed parameters of TIRF imaging (laser wavelength, laser power, exposure time, EM gain, number of frames) are shown in Table 8.
[0025] In another preferred embodiment, the spot intensity analysis plugin in ImageJ (https: / / imagej.net / Spot_Intensity_Analysis) is used to locate and track individual molecules with the following settings: 1.00 electrons per analog-to-digital unit (ADU) and a spot radius of 3. The first frame count and noise tolerance to be checked are shown in Table 9, as the variation for each sample depends on the rate at which they are bleached.
[0026] In another preferred embodiment, STED imaging was performed using a Leica TCS SP8 STED 3X system equipped with a white laser for excitation and a 660 nm pulsed laser for STED loss. The excitation beam had an average power of 7 mW at 561 nm, and the STED beam had an average power of 1.3 W at 660 nm, with a scan rate of 100 Hz. The acquisition spectral range was 570–590 nm. Deconvolution processing was performed using Huygens software embedded in the Leica TCS SP8 STED 3X system. The deconvolution process was automatically configured using Huygens software.
[0027] In another preferred embodiment, detailed parameters for STED and CLSM imaging (channel, excitation laser wavelength, excitation laser power, STED laser wavelength, STED laser power, detection wavelength, scanning speed, EM gain) are listed in Table 10.
[0028] In a preferred embodiment, the application includes washing the cell sample twice with cell culture medium. Subsequently, the photostable SDF fluorescent dots are incubated with the cell sample at room temperature for 20 min, allowing for detection using a fluorescence confocal microscope and a STED microscope. The cells are HeLa cells. An excitation laser (λ = 488 nm, laser power = 20 mW) and a 495-550 nm fluorescence emission filter are used to detect TDF-Alexa488-inside (B); an excitation laser (λ = 561 nm, laser power = 20 mW) and a 570-620 nm fluorescence emission filter are used to detect TDF-Cy3-inside (G); and an excitation laser (λ = 642 nm, laser power = 30 mW) and a 655-1000 nm fluorescence emission filter are used to detect TDF-Cy5-inside (R).
[0029] According to a fourth aspect of the present invention, a method for constructing a super-resolution fluorescent DNA barcode is provided, the method comprising: C1: providing a DNA framework fluorescent spot; C2: hybridizing the DNA framework fluorescent spot with a rod-shaped DNA origami structure to construct a super-resolution fluorescent DNA barcode; C3: purifying the fluorescent DNA barcode using magnetic bead separation technology and DNA strand displacement technology; C4: placing the super-resolution fluorescent DNA barcode on a confocal dish and incubating it at room temperature for 10-30 min; C5: performing fluorescence imaging of the super-resolution fluorescent DNA barcode using a SIM microscope under preset conditions, and determining the photostability and reconfigurability of the DNA barcode based on the fluorescence imaging results.
[0030] In a preferred embodiment, the rod-shaped DNA origami structure is a 10-helix bundle (10HB) structure. However, it should be understood that this application is not limited to 10HB; theoretically, 6-HB, 8-HB, and other rod-shaped DNA origami structures are also possible.
[0031] In another preferred embodiment, the rod-shaped DNA origami has a helix number of 10 and a length of 240 nm, exhibiting excellent rigidity.
[0032] In another preferred embodiment, during SIM imaging, an excitation laser (λ = 488 nm, laser power = 20 mW) and a 495-550 nm fluorescence emission filter are used to detect TDF-Alexa488-inside (B), an excitation laser (λ = 561 nm, laser power = 20 mW) and a 570-620 nm fluorescence emission filter are used to detect TDF-Cy3-inside (G), and an excitation laser (λ = 642 nm, laser power = 30 mW) and a 655-1000 nm fluorescence emission filter are used to detect TDF-Cy5-inside (R).
[0033] In another preferred embodiment, the detailed parameters of SIM imaging (channel, laser wavelength, laser power, detection wavelength, exposure time) are shown in Table 11.
[0034] A schematic diagram of photostable SDF fluorescent dots provided according to the present invention is shown below. Figure 1As shown in Figure a, the SDF fluorescent dots consist of a hydrophilic nucleic acid nanoshell and hydrophobic fluorescent molecules. The DNA framework structure possesses high programmability and addressability, making it ideal for precise molecular arrangement and studying multivalent intermolecular interactions within molecular assemblies. Using tetrahedral DNA frameworks, assemblies modified with fluorescent molecules of different valence states and orientations can be constructed. The mechanism by which DNA frameworks encapsulate fluorescent molecules to improve their photostability is that DNA frameworks have been reported to effectively scavenge reactive oxygen species, inhibiting redox reactions in fluorescent molecules and thus enhancing photostability.
[0035] According to the present invention, the following advantages are achieved compared to the prior art:
[0036] 1) A strategy for constructing photostable fluorescent probes based on DNA frameworks was proposed, resulting in the development of photobleach-resistant super-resolution DNA framework (SDF) fluorescent dots. These dots allow for programmable confinement of various fluorophores within a GFP-like lumen. The design and synthesis of SDF fluorescent dots for super-resolution imaging were achieved by integrating the DNA framework with commercially available fluorescent molecules. The study found that SDF dots exhibit low resistance to reactive oxygen species-induced photobleaching due to the shielding effect of the DNA framework. Compared to fluorophores labeled on double-stranded DNA, the photostable stability of SDF dots is improved by approximately 50 times. This addresses the problems of poor water solubility, weak fluorescence intensity, and poor photostable stability associated with traditional commercially available fluorescent molecules.
[0037] 2) SDF fluorescent dots consist of rigid tetrahedral DNA frameworks (TDFs) anchoring a predetermined number of fluorescent molecules. The orientation of the fluorescent molecules can be precisely controlled by setting the protrusion sites. This invention investigated the different emission behaviors of fluorescent molecules located on the outer surface versus those encapsulated within the DNA cavity. Specifically, we evaluated how the hydrophobic cavity enhances photostability by shielding the dye from ROS, mimicking the protective mechanism of GFP. Labeling the fluorophore inside the cavity improved photostability by approximately 1.8 times compared to labeling it on the outside. These ultrastable SDF fluorescent dots are readily applicable to super-resolution imaging, including stimulated emission loss (STED) and structured illumination microscopy (SIM) imaging.
[0038] 3) By attaching cholesterol to SDF fluorophores, long-term STED imaging of cell membranes can be achieved, realizing STED imaging of live cells. Furthermore, this invention constructs an ultra-stable super-resolution structured illumination microscope (SIM) barcode by arranging SDF fluorophores of different wavelengths on rod-shaped DNA origami, capable of distinguishing 18 different colored barcodes at a spatial resolution of approximately 70 nm.
[0039] 4) The SDF fluorescent dots prepared according to the present invention have good versatility and provide a new tool for bioimaging.
[0040] In summary, this invention provides an ultra-stable, super-resolution DNA framework fluorescent spot resistant to reactive oxygen species, its preparation method, and its application, enabling super-resolution imaging. The stable SDF fluorescent spot provided by this invention possesses advantages such as good water solubility, high fluorescence intensity, and excellent photostability, offering significant advantages in fluorescence imaging. It provides a multifunctional platform for designing ultra-stable fluorescent probes in biophysics and biomedical research to advance super-resolution imaging and single-particle tracking. Attached Figure Description
[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. The drawings are schematic diagrams, therefore the device and equipment of the present invention are not limited by the size or scale of the schematic diagrams.
[0042] Figure 1 This section describes the design and characterization of photostable SDF fluorescent dots; (a) a schematic diagram of the structure of SDF fluorescent dots; (b) an overview of the design of various SDF fluorescent dots by adjusting the orientation, valence state and type of fluorophores; (c) polyacrylamide gel electrophoresis characterization results of SDF fluorescent dots; (d) high performance liquid chromatography analysis results of SDF fluorescent dots; and (e) fluorescence resonance energy transfer characterization results of SDF fluorescent dots.
[0043] Figure 2 This is a schematic diagram showing the orientation of the protruding chain on the TDF;
[0044] Figure 3 This is an atomic force microscope (AFM) characterization image;
[0045] Figure 4 This is a graph showing the fluorescence resonance energy transfer data between dyes in SDF fluorescent spots;
[0046] Figure 5 These are the results of the photophysical property characterization of SDF fluorescent spots;
[0047] Figure 6 It is a TIRF imaging image;
[0048] Figure 7 It is STED imaging of live cell membranes;
[0049] Figure 8 This is a real-time confocal image of the HeLa cell membrane;
[0050] Figure 9 This is a general analysis of the photostability enhancement of DNA framework procedures;
[0051] Figure 10 These are the results of polyacrylamide gel electrophoresis characterization of SDF fluorescent spots;
[0052] Figure 11 This study investigates the mechanism of high photostability of SDF fluorescent dots.
[0053] Figure 12 This is a super-resolution diagram of DNA barcoding construction and characterization using multiple fluorescence.
[0054] Figure 13 It is an AFM image of a monochrome fluorescent DNA barcode;
[0055] Figure 14 It consists of SIM images of monochrome fluorescent DNA barcodes and manual counting statistics;
[0056] Figure 15 These are SIM images of DNA barcodes at different distances;
[0057] Figure 16 This is a photostability analysis of monochromatic fluorescent DNA barcodes under SIM imaging;
[0058] Figure 17 It is a SIM image of multiplex fluorescent DNA barcodes;
[0059] Figure 18 It is a SIM image of a mixture of five DNA barcodes;
[0060] Figure 19 These are schematic diagrams of DNA barcodes at different distances.
[0061] Figure 20 This is a schematic diagram of magnetic bead separation and DNA strand replacement technology. Detailed Implementation
[0062] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. The raw materials and instruments used in the following embodiments are all commercially available; unless otherwise specified, the equipment and preparation processes used are conventional equipment and conventional processes.
[0063] Through extensive and in-depth research and screening, the inventors have developed, for the first time, a method for preparing SDF fluorescent dots with superior photostability. This invention utilizes DNA nanotechnology to construct an atomically precise amphiphilic DNA framework template. Based on this DNA framework template, the valence state and spatial position of fluorescent molecules are controlled, thereby achieving the construction of SDF fluorescent dots with high hydrophilicity, high fluorescence brightness, and good photostability. This invention is based on this achievement.
[0064] Example 1
[0065] This invention provides a method for preparing photostable SDF fluorescent dots based on DNA nanotechnology. This embodiment synthesizes and characterizes photostable SDF fluorescent dots. The method includes the following steps:
[0066] Our design is inspired by the structure of green fluorescent protein (GFP) and its RNA mimic. In GFP, a barrel-shaped peptide scaffold forms a nano-constraint for the p-hydroxybenzylimidazolinone chromophore, isolating it from the host solvent via an extensive network of hydrogen bonds. Recently, DNA frameworks have been reported to effectively scavenge reactive oxygen species (ROS) in solutions, making them valuable in mitigating ROS in inflammatory diseases. We believe that a fluorophore enclosed within the cavity of a DNA framework can effectively shield against ROS for detection. We selected a tetrahedral DNA framework (TDF, ~6.8 nm) with a side length of 20 bases as the structural scaffold. Figure 1 (a) and selected commonly used hydrophobic Cy3 dyes as the model for the fluorophore. The choice of TDF nanostructures was based on their rigidity and the three-dimensional addressability of the modification sites. The orientation of fluorescent molecules can be controlled by utilizing the principle that 10 base pairs in a DNA double helix form a helix. Figure 1 a, Figure 2 (a) Previous research has extensively demonstrated the ability to control the helical orientation along the tetrahedral edges, allowing molecules or proteins to oriented inwards or outwards. To ensure the helical direction is inwards, we selected the ninth base (from 5' to 3') along each edge as the nick site. Figure 1 a, Figure 2 (a) To enable the fluorescent molecules within TDF to have a certain degree of freedom and to form hydrophobic oligomers (TDF-Cy3-inside), we designed four T bases as linkers between the fluorescent molecules and the TDF backbone chain. Figure 1 a, Figure 2 (a, b, Table 1). By changing the relative amounts of ssDNA modified with and unmodified fluorescent molecules, the valence state of fluorescent molecules in TDF can be precisely controlled. For comparison, we designed four nick sites facing the fluorophore at the four vertices of TDF to construct an SDF point isomer (TDF-Cy3-outside).Figure 1 c in the middle Figure 2 c in the middle Figure 3 (See Table 2, b). Based on this design principle, various SDF spots can be customized by adjusting the orientation, valence state, and type of fluorophores within the DNA framework. Figure 1 (b, c) The TDF framework is a rigid TDF structure formed by the self-assembly of four ssDNA strands (S1, S2, S3, S4) through thermal annealing. After probe synthesis, the probe was purified using high-performance liquid chromatography (HPLC), and the successful assembly of the probe was verified using polyacrylamide gel electrophoresis (PAGE) and atomic force microscopy (AFM).
[0067] Table 1. Sequence of inward-facing TDF nanostructures
[0068] Name Sequence (5′-3′) S1 TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC Cy3-S1 Cy3-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC Cy5-S1 Cy5-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC FAM-S1 FAM-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC ROX-S1 ROX-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC Alexa488-S1 Alex488-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC Alexa647-S1 Alexa647-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC <![CDATA[N3-S1]]> <![CDATA[N3-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCAC]]> S2 TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC Cy3-S2 Cy3-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC Cy5-S2 Cy5-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC FAM-S2 FAM-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC ROX-S2 ROX-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC Alexa488-S2 Alexa488-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC Alexa647-S2 Alexa647-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC <![CDATA[N3-S2]]> <![CDATA[N3-TTTTAGCTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGATTAC]]> S3 TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG Cy3-S3 Cy3-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG Cy5-S3 Cy5-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG FAM-S3 FAM-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG ROX-S3 ROX-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG Alexa488-S3 Alexa488-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG Alexa647-S3 Alexa647-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG <![CDATA[N3-S3]]> <![CDATA[N3-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATG]]> Cy3-S3-Chol Cy3-TTTTGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATGTTTTTTTT-Chol S4 TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT Cy3-S4 Cy3-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT Cy5-S4 Cy5- TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT FAM-S4 FAM-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT ROX-S4 ROX-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT Alexa488-S4 Alexa488-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT Alexa647-S4 Alexa647-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT <![CDATA[N3-S4]]> <![CDATA[N3-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATT]]> Cy3-S4-Chol Cy3-TTTTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATTTTTTTTTT-Chol Cy3-Chol-DNA Cy3-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT-Chol
[0069] Table 2. Design and sequence of TDF nanostructures with outward-facing molecules.
[0070] Name Sequence (5′-3′) Outside-S1 TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA Cy3-Outside-S1 Cy3-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA Cy5-Outside-S1 Cy5-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA FAM-Outside-S1 FAM-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA ROX-Outside-S1 ROX-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA Alexa488-Outside-S1 Alexa488-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA Alexa647-Outside-S1 Alexa647-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA <![CDATA[N3-Outside-S1]]> <![CDATA[N3-TTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA]]> Outside-S2 TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG Cy3-Outside-S2 Cy3-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG Cy5-Outside-S2 Cy5-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG FAM-Outside-S2 FAM-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG ROX-Outside-S2 ROX-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG Alexa488-Outside-S2 Alexa488-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG Alexa647- Outside-S2 Alexa647-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG <![CDATA[N3- Outside-S2]]> <![CDATA[N3-TTTTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG]]> Outside-S3 TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC Cy3-Outside-S3 Cy3-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC Cy5-Outside-S3 Cy5-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC FAM-Outside-S3 FAM-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC ROX-Outside-S3 ROX-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC Alexa488-Outside-S3 Alexa488-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC Alexa647-Outside-S3 Alexa647-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC <![CDATA[N3-Outside-S3]]> <![CDATA[N3-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC]]> Cy3-Outside-S3-Chol Cy3-TTTTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCCTTTTTTTT-Chol Outside-S4 TTTTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG Cy3-Outside-S4 Cy3-TTTTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG Cy5-Outside-S4 Cy5-TTTTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG FAM-Outside-S4 FAM-TTTTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG ROX-Outside-S4 ROX-TTTTACGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG Alexa488-Outside-S4 Alexa488-TTTTACGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG Alexa647-Outside-S4 Alexa647-TTTTACGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG <![CDATA[N3-Outside-S4]]> <![CDATA[N3-TTTTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG]]> Cy3-Outside-S4-Chol Cy3-TTTTACGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGTTTTTTT-Chol Cy3-DNA-Chol Cy3-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT-Chol
[0071] Results: AFM results showed that the structure was monodisperse and homogeneous. Figure 3 PAGE electrophoresis results showed that the TDF-Cy3-inside band migrated faster than the TDF-Cy3-outside band. Figure 1 (c) HPLC separation results showed that the retention time of TDF-Cy3-inside was longer than that of TDF-Cy3-outside. Figure 1 (d). The above results show that the two probes have been successfully assembled. The size of TDF-Cy3-inside is much smaller than that of TDF-Cy3-outside. This is because the fluorescent molecules in TDF-Cy3-inside extend into the interior of TDF, resulting in a reduction in volume, which proves the feasibility of precisely controlling the orientation of fluorescent molecules through TDF design. We further verified the orientation of fluorescent molecules inside TDF using fluorescence resonance energy transfer (FRET). By co-modifying TDF with two Cy3 and two Cy5 molecules (…),… Figure 1 (e), FRET results show that the fluorescence resonance energy transfer efficiency of the inward-facing structure of fluorescent molecules is much higher than that of the outward-facing structure of fluorescent molecules. Figure 1(e) demonstrates that the Cy3 and Cy5 molecules in the inward-facing structure are closer together. Single-molecule photobleaching experiments further reveal that the inward orientation of fluorescent molecules significantly increases the fluorescence resonance energy transfer efficiency (FREQ). Figure 4 ).
[0072] Example 2
[0073] The difference in fluorescence properties between Cy3 molecules facing inward and those facing outward includes the following steps:
[0074] The photostable properties of two structural isomers were investigated using total internal reflection fluorescence microscopy (TIRF). Cy3-modified double-stranded DNA (dsDNA-Cy3, Table 3) was selected as a control sample. Since the DNA sample was negatively charged, and the confocal microscopy dish after plasma treatment was also negatively charged, the DNA sample could be electrostatically adsorbed onto the plasma-treated confocal microscopy dish under the influence of magnesium ions acting as a bridge. Therefore, all subsequent fluorescence imaging samples were processed using the electrostatic adsorption principle. The samples were imaged using total internal reflection fluorescence microscopy (TIRF). Figure 5 To quantify the photostability of the probe, we determined the time (half-life) during which 50% of the probe was photobleached and the total number of photons emitted. To quantify the brightness, we measured the average number of photons per frame and the average number of photons per frame.
[0075] Results: TIRF images also showed that both SDF spots were brighter than dsDNA-Cy3 ( Figure 5 a, Figure 6 The photostability of TDF-Cy3-inside was significantly higher than that of dsDNA-Cy3 (half-life increased by approximately 50.04 times), while the photostability of TDF-Cy3-inside was also significantly higher than that of TDF-Cy3-outside (half-life increased by approximately 0.75 times). Figure 5 (b, e). For example, after 99% of dsDNA-Cy3 was photobleached, over 80% of the TDF-Cy3-inside fluorescent spots remained in the "fluorescence-on" state. The average photon counts of the TDF-Cy3-inside and TDF-Cy3-outside fluorescent spots were 2.6 times and 3.9 times that of dsDNA-Cy3, respectively, and the total photon counts of the TDF-Cy3-inside and TDF-Cy3-outside fluorescent spots were 13.0 times and 11.4 times that of dsDNA-Cy3, respectively. Figure 5(c, f). It's worth noting that compared to probes facing outwards, the brightness of the tetravalent SDF fluorescent spots decreases to some extent when the molecules are oriented inwards, possibly due to aggregation-induced quenching (ACQ) effects. This phenomenon further demonstrates the existence of intermolecular interactions within the TDF-Cy3-inside structure. Moreover, this phenomenon only occurs when the number of molecules is greater than three, indicating that a certain number of hydrophobic molecules are needed to induce stable intermolecular interactions. Nevertheless, the superior photostability allows the TDF-Cy3-inside structure to emit more photons before photobleaching. These results demonstrate the feasibility of a strategy to improve the photostability of Cy3 by regulating its spatial arrangement through the encoding of DNA double helix orientation.
[0076] Table 3. Oligonucleotides used for assembling fluorophore-labeled DNA double strands
[0077] name Sequence (5′-3′) ds-DNA AAGAGTGATGGTAGATGTATGAGGTGTGAGAGTG Cy3-dsDNA Cy3-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT Cy5-dsDNA Cy5-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT FAM-dsDNA FAM-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT ROX-dsDNA ROX-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT Alexa488-dsDNA Alexa488-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT Alexa647-dsDNA Alexa647-TTTTCACTCTCACACCTCATACATCTACCATCACTCTT
[0078] Example 3
[0079] This embodiment utilizes stimulated emission depletion (STED) microscopy to investigate whether photostable SDF fluorescent dots can be used for long-term super-resolution imaging of cell membranes. The steps include:
[0080] This embodiment uses HeLa cells as the research object. To enable TDF-Cy3-inside to target the cell membrane, two cell membrane-targeting cholesterol molecules (Chol, Figure 7 (a) 1 µM of the above probe was incubated with HeLa cells at room temperature for 20 min, and imaging was performed using both confocal laser imaging and STED super-resolution imaging modes. Additionally, a 3 µM ssDNA-Cy3 probe and a 1 µM molecularly outward probe were selected as control groups for comparative analysis. To eliminate the influence of dye concentration on imaging intensity, the concentration of Cy3 was kept consistent in all experiments. An excitation laser (λ=561 nm, laser power=20 mW) and a 570-620 nm fluorescence emission filter were used to detect the fluorescence signal of TDF-Cy3-inside. Next, we demonstrated through kinetic tests that the photostable TDF-Cy3-inside can be used to extend the study time range of STED super-resolution imaging. TDF-Cy3-outside containing 2 Chol and ssDNA-Cy3 containing 1 Chol were assembled as control probes. We incubated HeLa cells with the above probes and performed long-term STED super-resolution imaging.
[0081] Results: The probe showed good targeting ability to the cell membrane of HeLa cells. Figure 7 (b) By analyzing the fluorescence intensity distribution in the narrower regions of cell membrane imaging in the image, the resolvable half-width at half-maximum (FWHM) in the STED image is 120 nm, which is much lower than the 275 nm resolution of laser confocal microscopy. This indicates that the assembled probe does not affect the resolution of stimulated emission loss super-resolution imaging and is suitable for STED super-resolution imaging. Figure 7 (c). The results showed that all three probes had targeting properties to the cell membrane of HeLa cells. Figure 7 (d). Furthermore, the three probes were uniformly distributed throughout the cell membrane without any obvious bright spots, indicating good dispersibility in the cell culture medium. Figure 7 (d). Due to increased photostability, Chol-TDN-Cy3-inside can perform confocal and STED imaging on the cell membrane for at least 30 minutes. Figure 7 d, Figure 8 Statistical analysis of the long-term STED imaging results showed that the cell membrane fluorescence intensities of TDF-Cy3-inside, TDF-Cy3-outside, and ssDNA-Cy3-treated cells 30 min after STED imaging were 15.2%, 24.0%, and 77.4% of their initial fluorescence intensities, respectively. Figure 7 (e).
[0082] Example 4
[0083] This embodiment includes a universality analysis and an analysis of the mechanism for enhancing photostability. The steps include:
[0084] Since the labeled Cy3 molecules themselves possess a degree of hydrophobicity, we hypothesize that when the DNA helix is oriented inward, the hydrophobic interactions between Cy3 molecules will further induce molecular aggregation, thereby constructing a small hydrophobic environment within the DNA framework. To verify the universality of this strategy and further analyze the mechanism of enhanced photostability, we applied this system to fluorescent molecules emitting different colors of fluorescence (ROX with blue fluorescence, FAM and Alexa488 with green fluorescence, and Cy5 and Alexa647 with red fluorescence). Notably, Cy5, FAM, and ROX are hydrophobic, while Alexa488 and Alexa647 are hydrophilic due to the presence of sulfonic acid groups. Figure 9 (a)
[0085] Results: First, we optimized the Mg content of the assembly system. 2+ Concentration, Page electrophoresis was used to verify assembly yield, and the results showed that efficient assembly of various amphiphilic nucleic acid framework structures was achieved. Figure 10Optical property characterization results show that the photostability of the inward-facing probes of hydrophobic fluorescent molecules Cy5, FAM, and ROX is significantly higher than that of the outward-facing probes (1.11 times, 1.59 times, and 1.35 times, respectively, for outward-facing structures). Figure 9 The photostability of the inner-facing structure (b) was 4.85 times, 3.44 times, and 15.96 times that of the dsDNA structure, respectively. Figure 9 (b) The above data demonstrate that our proposed strategy is applicable to fluorescent molecules across all wavelengths in the visible light spectrum. However, there is no significant difference in photostability between the inward-facing and outward-facing probes of the hydrophilic Alea488 and Alexa647. Figure 9 (b) These results indicate that hydrophobic fluorescent molecules aggregate through hydrophobic interactions, which can further enhance the photostability of fluorescent molecules.
[0086] Example 5
[0087] This embodiment verifies the effect of forming a hydrophobic cavity on improving fluorescence stability. It includes the following steps:
[0088] To further verify the effect of forming hydrophobic cavities on improving fluorescence stability, this example investigated the effect of Cy3-modified valence states (TDF-1Cy3-inside, TDF-2Cy3-inside, TDF-3Cy3-inside, and TDF-4Cy3-inside) on photostability. Figure 11 (a) We further statistically analyzed the photobleaching ladder of single particles to compare the probe photobleaching process in detail.
[0089] Results: Compared with monovalent Cy3-dsDNA, the photostability results showed that the photostability of the probe significantly increased with increasing Cy3 valence. Figure 11 (bc). It is noteworthy that although TDF-1Cy3-inside and dsDNA-Cy3 have the same amount of Cy3, the former's photostability is significantly higher than the latter's. This indicates that a simple nucleic acid framework structure can improve the photostability of Cy3, consistent with previous literature reports. The same pattern applies to outward-facing molecular structures. Figure 11 (df), but the increase in photostability of inward-facing molecules is much higher than that of outward-facing molecules (df), Figure 11 c, f). Because both TDF-Cy3-inside and TDF-Cy3-outside contain four Cy3 molecules, the photobleaching curves of most particles contain four steps (c, f). Figure 11We statistically analyzed the time required for each step of the photobleaching curve for particles with four steps. The results showed that as the number of photobleaching steps increased, the required bleaching time also increased; for example, the time required for the last step was much longer than that required for the first step. Figure 11 (i). This trend can be explained from a probabilistic statistical perspective: in the first step of bleaching, four Cy3 molecules can be randomly bleached, resulting in a high bleaching probability; while in the final step, only one Cy3 molecule remains, leading to a low bleaching probability. Interestingly, although TDF-Cy3-inside and TDF-Cy3-outside contain Cy3 molecules with the same valence state, the bleaching time required for each step in TDF-Cy3-inside is significantly longer than that in TDF-Cy3-outside. This difference is particularly pronounced in the final step. We hypothesize that this is because the hydrophobic core formed in TDF-Cy3-inside protects the Cy3 molecules, remaining even after photobleaching. These results indicate that the hydrophobic cavity created by the aggregation of the DNA framework and hydrophobic molecules collectively protects the fluorescent molecules from photobleaching. This result may be due to the DNA framework and hydrophobic environment shielding the fluorescent molecules from damage caused by reactive oxygen species.
[0090] Example 6
[0091] The construction and characterization of 18 super-resolution fluorescent DNA barcodes were achieved based on photostable fluorescent dots. The steps included:
[0092] This embodiment utilizes SDF fluorescent dots of three different fluorescence emission bands to label 10-HB for assembling super-resolution multicolor fluorescent DNA barcodes. We define the pseudocolor of TDF-Alexa488-inside as "blue" (labeled B), TDF-Cy3-inside as "green" (labeled G), and TDF-Cy5-inside as "red" (labeled R). First, we constructed a 10-HB structure containing three binding sites, with a distance of approximately 115 nm between adjacent sites (10 nm was left at one end of the 10-HB to reduce steric hindrance and facilitate magnetic bead separation and purification and DNA strand displacement reactions). Each site extends an extension strand that can be used for hybridization with TDF probes. By using different hybridization strand sequences, TDF-Cy3-inside, TDF-Alexa488-inside, and TDF-Cy5-inside were precisely arranged at specific positions within a 10-HB with a total length of 240 nm, assembling a super-resolution multicolor fluorescent DNA barcode for SIM imaging. Figure 12(a) Theoretically, 18 super-resolution DNA barcodes (GGG, GGB, GGR, GRG, GRB, GRR, GBG, GBR, GBB, RGR, RGB, RRR, RRB, RBR, BRB, RBB, BBB, and BGB) can be constructed by controlling the order of the three probes.
[0093] Results: The application of super-photostable SDF fluorescent dots in SIM imaging was explored. Here, super-photostable geometrically encoded fluorescent DNA barcodes were constructed by combining SDF fluorescent dots with rod-shaped DNA origami. This was achieved through orthogonal hybridization of DNA sequences extending from the SDF fluorescent dots (inside TDF-4Cy3) and the rod-shaped DNA origami, respectively.
[0094] To evaluate the imaging resolution of fluorescent DNA barcodes, monochromatic fluorescent DNA barcodes with different spacings (70 nm, 85 nm, 100 nm, and 115 nm) were constructed (Table 5). Figure 19 A 240 nm long ten-helix bar-shaped DNA origami (10-HB, see ACS Nano 2019, 13, 8329−8336) was selected as a scaffold. Two regions on the nanorod were fluorescently labeled according to a pre-designed interregional spacing. Figure 12 (See Table 4). Each binding region consists of a single short strand, showing an orthogonal docking sequence to which a green luminescent SDF fluorescent spot (TDF-4Cy3-inside) can bind. For ease of purification, an additional short strand with a 5'-biotinylated extension at the end was designed to facilitate magnetic bead separation purification and DNA strand displacement reactions (Table 7). Figure 20 AFM data confirmed the successful synthesis of this structure, showing that the two SDF fluorescent spots were located on the same side of the 10-HB DNA origami. Figure 12 , Figure 13 SIM imaging showed that two SDF fluorescent spots were clearly distinguishable on the 10-HB DNA origami, with a yield of approximately 92.5%. Figure 14 When the spacing is 85 nm, 100 nm, and 115 nm, the two points can be clearly distinguished. Figure 12 c in the middle Figure 15 However, at a spacing of 70 nm, only a portion of the DNA barcodes could distinguish between the two fluorescent dots, indicating that 70 nm represents the resolution limit of current commercial SIM technology.
[0095] Table 4 shows the oligonucleotides used for assembling functionalized 10HB DNA origami.
[0096] name Sequence (5′-3′) 10HB-76-E1 GCCACCAAATAGAAGCGCCAAGATAGCAACAGATTTTTTTCTTGTGAGGTGAATGTGCAC 10HB-76-E2 GCCACCAAATAGAAGCGCCAAGATAGCAACAGATTTTTTTCATCAGCAGTTACCACGCAT 10HB-76-E3 GCCACCAAATAGAAGCGCCAAGATAGCAACAGATTTTTTTTTGGTACGACTCTCATCTGC 10HB-118-E1 TTGTTAAAATAGGGTAACGTCCAAAGTTCAGGAGTACCTTTTTTTTTTCTTGTGAGGTGAATGTGCAC 10HB-118-E2 TTGTTAAAATAGGGTAACGTCCAAAGTTCAGGAGTACCTTTTTTTTTTCATCAGCAGTTACCACGCAT 10HB-118-E3 TTGTTAAAATAGGGTAACGTCCAAAGTTCAGGAGTACCTTTTTTTTTTTTGGTACGACTCTCATCTGC 10HB-125-E1 AGGTTTAACGAGATATACGGCTGTCATGTTCAATCGCCATATTTTTTTCTTGTGAGGTGAATGTGCAC 10HB-125-E2 AGGTTTAACGAGATATACGGCTGTCATGTTCAATCGCCATATTTTTTTCATCAGCAGTTACCACGCAT 10HB-125-E3 AGGTTTAACGAGATATACGGCTGTCATGTTCAATCGCCATATTTTTTTTTGGTACGACTCTCATCTGC Cy3-S1- Imager1 Cy3-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTGTGCACATTCACCTCACAAG Cy3-S1- Imager2 Cy3-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTATGCGTGGTAACTGCTGATG Cy3-S1- Imager3 Cy3-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTGCAGATGAGAGTCGTACCAA Alexa488-S1- Imager1 Alexa488-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTGTGCACATTCACCTCACAAG Alexa488-S1-Imager2 Alexa488-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTATGCGTGGTAACTGCTGATG Alexa488-S1-Imager3 Alexa488-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTGCAGATGAGAGTCGTACCAA Cy5-S1-Imager1 Cy5-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTGTGCACATTCACCTCACAAG Cy5-S1-Imager2 Cy5-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTATGCGTGGTAACTGCTGATG Cy5-S1-Imager3 Cy5-TTTTCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCGCCATAGTAGACGTATCACTTTTTGCAGATGAGAGTCGTACCAA
[0097] Table 5. Oligonucleotides used for DNA barcodes at different distances.
[0098] Name Sequence (5′-3′) 10HB-118-E1 TTGTTAAAATAGGGTAACGTCCAAAGTTCAGGAGTACCTTTTTTTTTTCTTGTGAGGTGAATGTGCAC 10HB-119-E1 TTTAACCAATCATTAGATACGTGAACCGTCTCCAGTGAGACTTTTTTTCTTGTGAGGTGAATGTGCAC 10HB-120-E1 CTTCCTGTAGTAGCAGCGCCGTAACCACTATCCTGAGAGAGTTTTTTTCTTGTGAGGTGAATGTGCAC 10HB-121-E1 AACAACCCGTCCAAATATTAGAGCCCCGAGAGCAGGCGAAATTTTTTTCTTGTGAGGTGAATGTGCAC
[0099] Table 6. Oligonucleotide chains used for assembling single-stranded fluorescent DNA barcodes
[0100] name Sequence (5′-3′) Cy3-10HB-24-Cy3 Cy3-TTTTTTTTTTTTTTGTAGGAGCCACGATTGGCCTTTGATATTTTAACAGGGAGGAAGATTTTTTTTTTTTTT-Cy3 Cy3-10HB-39-Cy3 Cy3-TTTTTTTTTTTTTTTTTTACACCGGAACGCGAGAAAACTTAAGAGTCTATCATTATAGTTTTTTTTTTTTTTT-Cy3 Cy3-10HB-56-Cy3 Cy3-TTTTTTTTTTTTTCCTCCAGGAGTACGGAAAGCAACATATAAAAGCCGTAACGTGTTTTTTTTTTTTTTT-Cy3 Cy3-10HB-69-Cy3 Cy3-TTTTTTTTTTTTTTTTAAAGCTTAGTAAACCATAGGAATCATTACCGTACCTTCGGTTTTTTTTTTTTT-Cy3
[0101] Table 7. Oligonucleotides used in magnetic bead separation and DNA strand replacement techniques.
[0102] name Sequence (5′-3′) 10HB-126-E4 AACCAGATGGTCAGAACGAGTAGTATTCGACCTGCTCCATGTTTTTTTGTAGGACTGTCGATTGTG Biotin-Imager4 Biotin-CACAATCGACAGTCCTACCGCAC Invader GTGCGGTAGGACTGTCGATTGTG
[0103] Next, the photostability of SDF-modified fluorescent DNA barcodes under SIM imaging was investigated. Control fluorescent DNA barcodes were prepared by hybridizing four Cy3-modified complementary ssDNAs with two regions of 10-HB DNA origami, ensuring consistent dye quantity at each binding site (Table 6). Photobleaching curves under SIM imaging showed that the photostability of the SDF-modified fluorescent DNA barcodes was significantly higher than the control samples, with a half-life extended by 1.6 times. Figure 16 ).
[0104] This technology was extended to trichromatic imaging, using different DNA strands to orthogonally modify the SDF fluorescent spots of three fluorescence spectra (TDF-4Alexa488-inside, TDF-4Cy3-inside, and TDF-4Cy5-inside). A 10-HBDNA origami was designed, in which the three binding regions were symmetrically arranged, with adjacent regions spaced approximately 115 nm apart. Figure 12 (a) Each binding region has a single-stranded DNA (ssDNA) extension capable of hybridizing with one SDF fluorescent spot. Atomic force microscopy (AFM) confirmed the successful anchoring of three SDF fluorescent spots on the same side of the 10-HB structure. Figure 12 (d).
[0105] During the super-resolution SIM image reconstruction process, pseudocolor was applied to three fluorophores: Alexa488 was "blue" (represented as B, but for clarity, ...). Figure 12 (Represented in purple), Cy3 is "green" (represented as G), and Cy5 is "red" (represented as R). Using this scheme, 18 super-resolution fluorescent DNA barcodes were designed by changing the arrangement and relative number of different SDF fluorescent spots on the three spectra. The fluorescent DNA barcodes include combinations such as GGG, GGB, GGR, GRG, GRB, GRR, GBG, GBR, GBB, RGR, RGB, RRR, RRB, RBR, BRB, RBB, BBB, and BGB. SIM imaging successfully reconstructed all 18 fluorescent DNA barcodes ( Figure 12 (e). Statistical analysis shows that the assembly rates for each barcode type are 77% (GGG), 52% (GGB), 50% (GGR), 91% (GRG), 92% (GRB), 54% (GRR), 91% (GBG), 90% (GBR), 40% (GBB), 92% (RGR), 67% (RGB), 42% (RRR), 85% (RRB), 50% (RBR), 46% (BRB), 66% (RBB), 51% (BBB), and 83% (BGB). Figure 17 SIM images showed that the fluorescent DNA barcodes assembled as designed and clearly solved the problem. In practical applications, the ability to distinguish multiple fluorescent DNA barcodes simultaneously is often required. As a proof of concept, five different fluorescent DNA barcodes (GBG, RGR, BGB, GRG, and GRB) were randomly selected and mixed in equimolar ratios for SIM imaging. SIM results showed that all five mixed fluorescent DNA barcodes were successfully constructed. Figure 12 (f, 18) confirmed the ability of super-resolution fluorescence imaging to distinguish multiplex fluorescent DNA barcodes. Figure 12 (f). Statistical analysis of 380 fluorescent DNA barcodes from 20 images showed an overall successful assembly and reconstructibility rate of 84.4% (f). Figure 12 (g). The remaining 15.6% of particles were unidentifiable, possibly due to poor structural assembly.
[0106] Table 8. Single-molecule TIRF data acquisition parameters
[0107] Sample Name laser wavelength laser power Detection wavelength Exposure time Gain Frames dsDNA-Cy3 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-1Cy3-inside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-1Cy3-outside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-2Cy3-inside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-2Cy3-outside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-3Cy3-inside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-3Cy3-outside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-4Cy3-inside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 TDF-4Cy3-outside 561 nm <![CDATA[61.5 W cm -2 ]]> 577-633 nm 400 ms 500 7500 dsDNA-Cy5 638 nm <![CDATA[6.2 W cm -2 ]]> 662 - 738 nm 200 ms 500 2000 TDF-Cy5-inside 638 nm <![CDATA[6.2 W cm -2 ]]> 662 - 738 nm 200 ms 500 2000 TDF-Cy5-outside 638 nm <![CDATA[6.2 W cm -2 ]]> 662 - 738 nm 200 ms 500 2000 dsDNA-FAM 488 nm <![CDATA[80.0 W cm -2 ]]> 505 - 555 nm 200 ms 500 2000 TDF-FAM-inside 488 nm <![CDATA[80.0 W cm -2 ]]> 505 - 555 nm 200 ms 500 2000 TDF-FAM-outside 488 nm <![CDATA[80.0 W cm -2 ]]> 505 - 555 nm 200 ms 500 2000 dsDNA-ROX 561 nm <![CDATA[61.5 W cm -2 ]]> 577 - 633 nm 400 ms 500 5000 TDF-ROX-inside 561 nm <![CDATA[61.5 W cm -2 ]]> 577 - 633 nm 400 ms 500 5000 TDF-ROX-outside 4561 nm <![CDATA[61.5 W cm -2 ]]> 577 - 633 nm 400 ms 500 5000 dsDNA-Alexa488 488 nm <![CDATA[80.0 W cm -2 ]]> 505 - 555 nm 200 ms 500 2000 TDF-Alexa488-inside 488 nm <![CDATA[80.0 W cm -2 ]]> 505 - 555 nm 200 ms 500 2000 TDF-Alexa488-outside 488 nm <![CDATA[80.0 W cm -2 ]]> 505 - 555 nm 200 ms 500 2000 dsDNA-Alexa647 638 nm <![CDATA[6.2 W cm -2 ]]> 662 - 738 nm 200 ms 500 4000 TDF-Alexa647-inside 638 nm <![CDATA[6.2 W cm -2 ]]> 662 - 738 nm 200 ms 500 4000 TDF-Alexa647-outside 638 nm <![CDATA[6.2 W cm -2 ]]> 662 - 738 nm 200 ms 500 4000
[0108] Table 9. Parameters used in the ImageJ software spot intensity analysis plugin
[0109] Sample Name Number of Frames Detected Noise dsDNA-Cy3 20 50 TDF-1Cy3-inside 200 50 TDF-1Cy3-outside 200 50 TDF-2Cy3-inside 1000 100 TDF-2Cy3-outside 1000 100 TDF-3Cy3-inside 2000 100 TDF-3Cy3-outside 2000 100 TDF-4Cy3-inside 2000 100 TDF-4Cy3-outside 2000 100 dsDNA-Cy5 5 100 TDF-Cy5-inside 200 100 TDF-Cy5-outside 200 100 dsDNA-FAM 18 50 TDF-FAM-inside 50 50 TDF-FAM-outside 50 50 dsDNA-ROX 18 50 TDF-ROX-inside 50 100 TDF-ROX-outside 50 100 dsDNA-Alexa488 20 100 TDF-Alexa488-inside 200 100 TDF-Alexa488-outside 200 100 dsDNA-Alexa647 5 100 TDF-Alexa647-inside 500 100 TDF-Alexa647-outside 500 100
[0110] Table 10 Parameters used in STED data collection
[0111] Channel Laser Wavelength Laser Power STED Laser Wavelength STED Laser Power Detection Wavelength Scanning Speed Gain STED Channel 561 nm 7 mW 660 nm 1.3 W %570 - 590 nm 100 HZ 786.8 Confocal Channel 561 nm 1 mW 570-590 nm 100 Hz 786.8
[0112] Table 11 Parameters used in SIM data acquisition
[0113] Sample Name aisle laser wavelength laser power Detection wavelength Exposure time TDF-Alexa488-inside Channel 1 488 nm 20 mW 495-550 nm 50 ms TDF-Cy3-inside Channel 2 561 nm 20 mW 570-620 nm 50 ms TDF-Cy5-inside Channel 3 642 nm 30 mW 655-1000 nm 50 ms
[0114] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.
Claims
1. A super-stable, high-resolution DNA framework fluorescent spot resistant to reactive oxygen species, characterized in that, The DNA framework fluorescent dots are composed of a hydrophilic tetrahedral DNA framework and hydrophobic fluorescent molecules, assembled from four ssDNA molecules modified with fluorescent molecules. All fluorescent molecules of the DNA framework fluorescent dots face the interior of the tetrahedral DNA framework or all fluorescent molecules face the exterior of the tetrahedral DNA framework. The DNA framework fluorescent dots have improved photostability and can be used for super-resolution imaging.
2. The ultra-stable, super-resolution DNA framework fluorescent spot resistant to reactive oxygen species according to claim 1, characterized in that, The hydrophobic fluorescent molecules include Cy3, Cy5, ROX, FAM, Alexa488, or Alexa647.
3. The ultra-stable, super-resolution DNA framework fluorescent spot resistant to reactive oxygen species according to claim 1, characterized in that, The number of the hydrophobic fluorescent molecules is 1 to 4.
4. A method for preparing ultra-stable, super-resolution DNA framework fluorescent dots resistant to reactive oxygen species according to any one of claims 1 to 3, characterized in that, Includes the following steps: A1: Provides four complementary ssDNA strands that can be assembled into a tetrahedral DNA framework through base pairing; A2: Photostable SDF fluorescent spots can be obtained by heating four complementary ssDNA strands at 95°C for 10 min and then annealing them at 4°C for 20 min using a PCR instrument. A3: By changing the relative ratio of fluorescently modified ssDNA to unmodified ssDNA, the number of fluorescent molecules on the tetrahedral DNA framework can be quantitatively controlled, and the orientation of fluorescent molecules can be regulated by changing the modification sites of fluorescent molecules on ssDNA. A4: The obtained DNA framework fluorescent spots were purified by HPLC.
5. The preparation method according to claim 4, characterized in that, Various DNA framework fluorescent spots can be customized by adjusting the orientation, valence state, and type of fluorophores within the tetrahedral DNA framework.
6. The preparation method according to claim 4, characterized in that, When the side length of the tetrahedral DNA frame is 20 bases, the ninth base along each side from 5' to 3' is selected as the nick site, so that all fluorescent molecules face the inside of the tetrahedral DNA frame; the four vertices of the tetrahedral DNA frame are selected as nick sites, so that all fluorescent molecules face the outside of the tetrahedral DNA frame.
7. The preparation method according to claim 4, characterized in that, To enable the fluorescent molecules within the fluorescent spots of the DNA framework to have a certain degree of freedom and to form hydrophobic oligomers through mutual contact, several T bases are designed as linkers between the fluorescent molecules and the ssDNA strand of the tetrahedral DNA framework.
8. A method for characterizing ultra-stable, super-resolution DNA framework fluorescent spots resistant to reactive oxygen species, the characterization method comprising: B1: To provide a DNA framework fluorescent spot according to any one of claims 1 to 3; B2: The fluorescent dots of the DNA framework are attached to a confocal dish after plasma treatment by electrostatic adsorption; B3: Perform long-term fluorescence imaging of the sample using a total internal reflection fluorescence microscope under preset conditions; B4: Process the data using ImageJ and Python, and determine the photostability and fluorescence intensity of the probe based on the fluorescence imaging results; B5: Under preset conditions, use an ELISA reader to measure the fluorescence spectrum of the fluorescent spots in the DNA framework, and determine the FRET efficiency based on the fluorescence spectrum results; B6: Two cholesterol molecules with cell membrane targeting were modified on the fluorescent dot structure of the DNA framework to make it cell membrane targeting. Then, the mixture was incubated with cells at room temperature for 10-30 min and imaged using both laser confocal imaging and STED super-resolution imaging modes.
9. A method for constructing super-resolution fluorescent DNA barcodes, characterized in that, The construction method includes: C1: To provide a DNA framework fluorescent spot according to any one of claims 1 to 3; C2: Hybridize the fluorescent dots of the DNA framework with the rod-shaped DNA origami structure to construct a super-resolution fluorescent DNA barcode; C3: Purification of fluorescent DNA barcodes using magnetic bead separation technology and DNA strand displacement technology; C4: Place the super-resolution fluorescent DNA barcode on a confocal dish and incubate at room temperature for 10-30 min; C5: Under preset conditions, use a SIM microscope to perform fluorescence imaging on the super-resolution fluorescent DNA barcode, and determine the photostability and reconfigurability of the DNA barcode based on the fluorescence imaging results.
10. The construction method according to claim 9, characterized in that, The rod-shaped DNA origami structure is a six-helix bundle, an eight-helix bundle, or a ten-helix bundle.
Citation Information
Patent Citations
Frame nucleic acid nano luminous body with customizable shape and preparation method and application thereof
CN110257053A
Near-infrared fluorescent tetrahedral probe as well as preparation method and application thereof
CN117304920A
Mitochondrial DNA fluorescent probe, preparation method and bioimaging application thereof
CN118724882A
New protein kinase and gene encoding protein kinase splice mutant
JP2005046024A
Multiplex detection of molecular species in cells by super-resolution imaging and combinatorial labeling
US20140031243A1