Application and method of CsNBR1 gene in improvement of citrus liberobacter asiaticum resistance

Abstract

The invention discloses application and a method of a CsNBR1 gene in improvement of citrus liberobacter asiaticum resistance, belongs to the technical field of agricultural biological genetic engineering, and discloses the application of the CsNBR1 gene in improvement of citrus liberobacter asiaticum resistance, and the nucleotide sequence of the CsNBR1 gene is shown as SEQ ID NO.1. The invention further discloses a method for improving citrus liberobacter asiaticum resistance. The invention also discloses a method for improving the citrus huanglongbing resistance by using the CsNBR1 gene. The method comprises the following steps: S1, cloning the citrus CsNBR1 gene; s2, constructing a CsNBR1 overexpression vector; and S3, transforming citrus by using the CsNBR1 overexpression vector obtained in S2, and identifying to obtain a transgenic plant with improved Huanglongbing resistance. The invention provides a new choice for improving the resistance of the citrus to the citrus huanglongbing, effectively improves the resistance of the citrus to the citrus huanglongbing, and has an important application value for breeding of citrus huanglongbing resistance.

Description

Technical Field

[0001] This invention belongs to the field of agricultural bioengineering technology, specifically relating to the application and method of the CsNBR1 gene in improving resistance to Huanglongbing in citrus. Background Technology

[0002] Citrus is one of the world's most important fruit crops, and its industry plays a crucial role in agricultural economy, food supply, and international trade. However, citrus Huanglongbing (HLB), a devastating disease caused by bacteria of the genus *Candidatus Liberibacter* spp., has posed a serious threat to the global citrus industry. The pathogenic strains mainly include heat-resistant Asian species (*Ca.L.asiaticus*, *CLas*), American species (*Ca.L.americanus*, *CLam*), and African species (*Ca.L.africanus*, *CLaf*). Among them, *CLas*, spread by the Asian citrus psyllid (*Diaphorina citri*), has become the most significant threat to citrus production due to its wide distribution and high pathogenicity. It can cause yellowing of citrus trees, deformed fruit, sharp reduction in yield, and in severe cases, death of the entire tree. Once infected, it is difficult to eradicate.

[0003] Currently, the control of citrus Huanglongbing (HLB) still relies primarily on integrated management strategies, with core measures including chemical control of vector insects, removal of diseased plants, and strengthened seedling quarantine. However, chemical control methods not only easily cause environmental pollution and disrupt the ecological balance, but also require a continuous investment of significant human and material resources, resulting in high control costs and difficulty in completely blocking disease transmission. While biological control can reduce reliance on chemical agents to some extent, its effectiveness fluctuates greatly due to factors such as environmental conditions and the stability of natural enemy populations, failing to meet the control needs of large-scale citrus cultivation.

[0004] Traditional hybridization breeding is a classic method for cultivating disease-resistant crop varieties. However, citrus crops generally suffer from long juvenile stages, complex genetic backgrounds, and linkage burdens between superior traits and disease resistance traits, resulting in a lengthy and inefficient breeding cycle for Huanglongbing-resistant varieties, making it difficult to quickly respond to the industrial crisis caused by disease outbreaks. With the development of molecular biotechnology, the targeted improvement of Huanglongbing resistance in citrus using genetic engineering has become a research hotspot in the field of citrus disease resistance breeding in recent years. Existing studies have shown that overexpressing the Arabidopsis NPR1 gene in sweet orange varieties Hamlin and Valencia, overexpressing the CiNPR3 / CiNPR4 gene of grapefruit Jackson variety in late-ripening orange, or the citrus's own CsSAMT1 gene can enhance the resistance of transgenic citrus to Huanglongbing to some extent. However, the genes used in the above studies are mostly heterologous genes or limited to specific disease resistance pathways, and there are still problems such as gene compatibility, resistance stability, and potential impacts on plant growth and development. Moreover, there are currently no research reports on the application of the citrus's own CsNBR1 gene in the regulation of Huanglongbing resistance. Summary of the Invention

[0005] This invention aims to provide the application and method of the CsNBR1 gene in improving the resistance of citrus to Huanglongbing (HLB), offering a new option for enhancing citrus resistance to HLB. The application involves integrating the citrus CsNBR1 gene into citrus through an expression vector, effectively improving the resistance of citrus to HLB. This has significant application value for breeding citrus resistant to HLB.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0007] Application of the CsNBR1 gene in improving resistance to Huanglongbing in citrus, the nucleotide sequence of the CsNBR1 gene is shown in SEQ ID NO.1.

[0008] Preferably, the improvement of citrus resistance to Huanglongbing is achieved by regulating the expression level of the citrus CsNBR1 gene, thereby increasing the resistance of citrus to Huanglongbing.

[0009] The present invention also provides an overexpression vector to enhance resistance to Huanglongbing in citrus, wherein the overexpression vector includes the CsNBR1 gene.

[0010] The present invention also provides a strain that enhances resistance to Huanglongbing in citrus, the strain comprising the overexpression vector described above.

[0011] This invention also provides a method for improving citrus Huanglongbing resistance using the CsNBR1 gene, comprising the following steps:

[0012] S1, Cloning the CsNBR1 gene of citrus;

[0013] S2. Construct the CsNBR1 overexpression vector pLGNe-Flag-CsNBR1;

[0014] S3. The CsNBR1 overexpression vector pLGNe-Flag-CsNBR1 obtained in S2 was transformed into citrus, and transgenic plants with improved resistance to Huanglongbing were obtained after identification.

[0015] Preferably, in S1, the cloned citrus CsNBR1 gene specifically comprises:

[0016] Total RNA was extracted from citrus and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using primers OE-CsNBR1-F and OE-CsNBR1-R. The CsNBR1 gene was obtained by digestion with BamHI and EcoRI.

[0017] The nucleotide sequence of primer OE-CsNBR1-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsNBR1-R is shown in SEQ ID NO.3.

[0018] Preferably, in S2, the construction of the CsNBR1 overexpression vector pLGNe-Flag-CsNBR1 specifically involves: ligating the CsNBR1 gene obtained in S1 into the pLGNe vector recovered by BamHI and EcoRI enzyme digestion to construct the overexpression vector pLGNe-Flag-CsNBR1.

[0019] Preferably, in S3, the transformation of citrus with the CsNBR1 overexpression vector pLGNe-Flag-CsNBR1 obtained in S2 is specifically as follows: the overexpression vector pLGNe-Flag-CsNBR1 obtained in S2 is transformed into Agrobacterium tumefaciens EHA105 by heat shock method, and then the citrus explants are transformed with Agrobacterium-mediated transformation. After genetic transformation, the explant cells are identified by PCR, and the expression level of CsNBR1 is analyzed by qRT-PCR and Western blot to obtain transgenic plants.

[0020] Preferably, in the PCR identification, the PCR amplification primers are ID-CsNBR1-F and ID-CsNBR1-R;

[0021] The nucleotide sequence of primer ID-CsNBR1-F is shown in SEQ ID NO.4, and the nucleotide sequence of primer ID-CsNBR1-R is shown in SEQ ID NO.5.

[0022] Preferably, in the qRT-PCR analysis, the primers for qRT-PCR detection are RT-CsNBR1-F and RT-CsNBR1-R;

[0023] The nucleotide sequence of the primer RT-CsNBR1-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer RT-CsNBR1-R is shown in SEQ ID NO.7.

[0024] Compared with the prior art, the present invention has the following advantages and technical effects:

[0025] This invention provides a method for enhancing citrus Huanglongbing (HLB) resistance based on CsNBR1 gene overexpression. By cloning the CsNBR1 coding sequence of citrus, constructing an overexpression vector, and then transforming citrus, the method can delay HLB colonization in citrus and significantly reduce HLB titer. In summary, this invention represents a promising bioengineering technology for improving citrus HLB resistance and has significant value for molecular breeding of citrus resistant to (and tolerant of) HLB.

[0026] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0027] Figure 1 Bioinformatics characteristics of CsNBR1 in this invention: Figure 1 In this text, A represents the chromosomal location of the citrus CsNBR1 gene, and bp represents a base. Figure 1 In the figure, B represents the gene structure of citrus CsNBR1; Figure 1 In this context, C represents the functional domain of citrus CsNBR1, and aa represents an amino acid.

[0028] Figure 2 Here is an electrophoresis diagram of the PCR amplification of the CsNBR1 gene clone of this invention: CDS represents the CsNBR1 coding sequence; M represents the DNA molecular weight standard;

[0029] Figure 3 Here is a structural diagram of the CsNBR1 plant overexpression vector of this invention: Figure 3 In the text, A: GUS: NPTII: indicates the overexpression of marker genes used for citrus selection. Figure 3 In the diagram, B represents GFP, a marker gene used for RNAi screening of citrus; 35S represents a constitutive strong promoter; NOS represents a transcription termination sequence; LB represents the left arm of T-DNA; and RB represents the right arm of T-DNA.

[0030] Figure 4 Here is a GFP fluorescence detection diagram of CsNBR1-RNAi plants of this invention: WT: wild-type control, RNAi-#: RNA interference plant;

[0031] Figure 5 PCR identification diagram of CsNBR1 overexpressing plants in this invention: M: Marker; +: plasmid pLGNe-CsNBR1; OE-#: overexpressing plant;

[0032] Figure 6 The following is a graph showing the expression level analysis of the transgenic plants of this invention: * asterisk indicates a significant difference compared with the WT control (**p<0.01, ****p<0.0001, one-way ANOVA);

[0033] Figure 7 The following is a diagram illustrating the protein identification of the transgenic plants in this invention: α-NBR1 is an anti-NBR1 antibody; α-Actin is an anti-Actin antibody;

[0034] Figure 8 The figures show the phenotypic diagrams of CsNBR1-OE and RNAi plants of this invention, wherein... Figure 8 In the diagram, A represents the phenotypic pattern of CsNBR1-OE plants. Figure 8 B in the diagram represents the phenotypic representation of RNAi plants.

[0035] Figure 9 Graph showing the results of pathogen content detection in transgenic plants: mpi represents month post infection (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, two-way ANOVA). Detailed Implementation

[0036] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0037] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0038] Source of experimental materials:

[0039] In this embodiment, the late-ripening orange was used as the test subject.

[0040] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0041] Example 1

[0042] I. Bioinformatics Analysis of Citrus CsNBR1 Gene

[0043] The citrus CsNBR1 gene is located on citrus chromosome 5, between 3809625 bp and 3813502 bp. The full-length chromosome is 36146064 bp, and the full-length CDS sequence is 2439 bp, encoding 812 amino acids. Analysis of the protein sequence yielded the following results: Figure 1 As shown.

[0044] Figure 1 The results show the existence of PB1, ZZ, NBR1_like and UBA structural functional domains.

[0045] The CsNBR1 gene has the nucleotide sequence shown in SEQ ID NO.1.

[0046] SEQ ID NO.1: (CsNBR1 CDS sequence, ATG to stop codon)

[0047]

[0048] II. Cloning of the Citrus CsNBR1 coding sequence

[0049] 1. RNA extraction and cDNA synthesis

[0050] Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0051] 2. PCR amplification of the CsNBR1 coding sequence

[0052] The CsNBR1 coding sequence DNA fragment was amplified from citrus cDNA using primers OE-CsNBR1-F (SEQ ID No. 2), OE-CsNBR1-R (SEQ ID No. 3), and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045A). The fragment length was 2439 bp (e.g., ...). Figure 2 As shown in the image, the amplified DNA fragment was sequenced and identified as the coding sequence of the citrus CsNBR1 gene (SEQ ID No. 1). Under UV light, an agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (Tiangen, CAT: DP214).

[0053] PCR amplification program: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1 min, 35 cycles; extension at 72℃ for 10 min.

[0054] SEQ ID No. 2: (CDS pre-cloning primer OE-CsNBR1-F, containing restriction enzyme sites)

[0055] GGACAGGGTACCCGGGGATCCATGGAGTCTACTATGGTTAT C;

[0056] SEQ ID No. 3: (CDS clone primer OE-CsNBR1-R, containing restriction enzyme sites)

[0057] TCTCATTAAAGCAGGGAATTCCTAAGCTTTCTCCCCGGTAA G.

[0058] III. Construction of CsNBR1 expression vector and transformation of Agrobacterium

[0059] 1. Construction of overexpression vectors

[0060] The CsNBR1 coding sequence DNA fragment was overexpressed in the vector pLGNe with double restriction endonucleases BamHI and EcoRI (Thermo Fisher), then recovered by gel extraction and ligated at 37°C using a homologous recombination kit (Novizan, CAT: C112). The ligation product was transformed into E. coli DH5α, and plasmids from positive clones were extracted using a plasmid extraction kit (Tiangen, CAT: DP103) to obtain the CsNBR1 overexpression vector pLGNe-CsNBR1 (e.g., pLGNe). Figure 3 (As shown).

[0061] 2. Transformation of Agrobacterium with overexpression vector

[0062] The constructed overexpression vector pLGNe-CsNBR1 was introduced into Agrobacterium tumefaciens EHA105 cells using a heat shock method. The method is as follows: 50 μL of frozen Agrobacterium tumefaciens competent cells EHA105 were thawed on ice; 2 μL of the overexpression vector plasmid was added to the competent cells, mixed by pipetting, and placed on ice for 5 min; the cells were then flash-frozen in liquid nitrogen for 5 min; immediately transferred to a 37°C water bath for heat shock for 5 min; 1 mL of LB liquid medium was added, mixed by pipetting, and cultured at 220 rpm in a shaker at 28°C for 60 min; the bacterial culture was centrifuged at 10000 rpm for 1 min, the supernatant was discarded (approximately 100 μL of bacterial cells remained for resuspending), the resuspended cells were spread, and incubated upside down in the dark at 28°C for 2 days; after the colonies grew, single colonies were verified by PCR using primers OE-CsNBR1-F (SEQ ID No. 2) and OE-CsNBR1-R (SEQ ID No. 3).

[0063] PCR reaction conditions: 95℃ for 3 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 30 cycles; 72℃ for 10 min.

[0064] Construction and transformation of RNAi vectors into Agrobacterium

[0065] A 300bp sequence from the CsNBR1 gene, meeting the criteria and exhibiting the highest interference level, was selected as the interfering fragment. The nucleotide sequence of the interfering fragment is shown in SEQ ID No. 8. AscI / SwaI was selected as the insertion site for the interfering fragment, using primers CsNBR1-RNAi-F and CsNBR1-RNAi-R, whose nucleotide sequences are shown in SEQ ID No. 9 and SEQ ID No. 10, respectively. First, the interfering fragment was ligated forward to the corresponding site upstream of the intron in the pNmGFPer-RNAi vector using AscI / SwaI restriction endonuclease, and the resulting plasmid was transformed into competent E. coli cells. The verified plasmid was stored at -20℃ for later use. Then, the verified plasmid vector was reverse-ligated to the corresponding site downstream of the intron using XbaI restriction endonuclease, following the same procedure. Finally, validation was performed, and the bacterial culture was preserved, completing the construction of the pNmGFPer-RNAi-CsNBR1 vector (e.g., [example code missing]). Figure 3 (As shown). The steps for transforming Agrobacterium K599 are the same as the experimental method for transforming Agrobacterium with the overexpression vector described above.

[0066] SEQ ID No. 8 (RNAi interference fragment of CsNBR1)

[0067] ACCGGTTACCAACATCATCTGAAGAGATCCGTAGTGATAAAGATGCTGTTGAGCAGACCCTCCTCAGGGAACTCGAGGAGATGGGTTTTCAAGCAGGTTGATTTGAACAAGGAGATTTGAGGATGAATGAGTATGACTTGGAGCAGTCT GTGGATGATCTCTGTGGTGTGTCTGAGTGGGATCCAATCCTTGAGGAGTTGCAGGAGATGGGTTTCCATGACGAAGAAACTAACAAGAGGCTGCTGAAGAAGAACAATGGGAGTATCAAGGGTGTGGTGATGGATCTTCTTACCGGGGAG;

[0068] SEQ ID No. 9(CsNBR1-RNAi-F)

[0069] GATGATATCCCATGGGGCGCGCCACCGGTTTACCAACATCA TC;

[0070] SEQ ID No. 10(CsNBR1-RNAi-R)

[0071] AAGAAATTCTTACACATTTAAATCTCCCCGGTAAGAAGATC CATCA.

[0072] IV. Agrobacterium tumefaciens-mediated genetic transformation of citrus

[0073] 1. Obtaining the hypocotyl from citrus seedlings

[0074] Fresh citrus fruits were washed, surface-sterilized with 70% alcohol, and seeds were extracted under aseptic conditions. The seed coats were peeled off, and the seeds were germinated on seed germination medium. They were then cultured in the dark at 28°C for 2 weeks, followed by 1 week of culture under 16h light / 8h dark conditions. Under aseptic conditions, the epicotyls of the germinated seedlings were cut into 1cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0075] 2. Preparation of Agrobacterium tumefaciens bacterial suspension

[0076] Before transfection, Agrobacterium for transfection (containing the pLGNe-CsNBR1 vector) was streaked onto LB solid medium containing 50 mg / L kanamycin; single colonies were picked and inoculated into 25 mL of LB liquid medium containing the same antibiotic, and cultured overnight at 28°C with shaking; the bacterial culture was then diluted to OD. 600 After reaching 0.1, continue culturing until OD... 600 Centrifuge at 0.5, 5000 r / min for 10 min, discard the supernatant, and resuspend in MS liquid medium at pH 5.4 for transfection.

[0077] 3. Citrus epicotyl transformation

[0078] After soaking the citrus hypocotyl stem segments in Agrobacterium tumefaciens solution for 13 minutes and drying them, the stem segments were transferred to a co-culture medium and cultured in the dark at 28°C for 2 days. After co-culture, the hypocotyls were transferred to a selection medium and cultured in the dark at 28°C for 7 days. The hypocotyls were cultured at 28°C under 16h light / 8h dark conditions, and subcultured every two weeks. The buds that grew were identified by GUS staining.

[0079] 4. Seedling culture of transformants

[0080] When the seedlings grow to more than 1cm, they are cut off and grafted onto the late-maturing orange seedlings in sterile test tubes and cultured in the seedling culture medium; when the seedlings grow to about 5cm, they are grafted onto trifoliate orange seedlings and cultured in a greenhouse at 28℃.

[0081] The culture medium used in this embodiment is as follows:

[0082] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L gelrite, pH 5.8.

[0083] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0084] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IIA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0085] Seedling culture medium: MS + 30 g / L sucrose, pH 5.8.

[0086] V. CsNBR1 overexpression transgenic plants inhibit pathogen proliferation

[0087] 1.1. Detection of GFP fluorescence in RNAi plants

[0088] When plant leaves are illuminated with a handheld fluorescent lamp in the dark, positive plants will show GFP fluorescence (e.g., ...). Figure 4 (As shown).

[0089] 2. PCR identification of transgenic plants

[0090] 100 mg of leaves from overexpressing plants were used to extract genomic DNA using a DNA extraction kit (Bioflux, CAT: BSC13S1B). PCR was used to detect the integration of the CsNBR1 coding sequence into the citrus genome. The detection primers were ID-CsNBR1-F (SEQ ID No. 4) and ID-CsNBR1-R (SEQ ID No. 5). Positive plants yielded a 2855 bp amplified fragment, while WT plants showed no amplification (due to...). Figure 5 (As shown).

[0091] SEQ ID No. 4 (Primer ID-CsNBR1-F for identification of transgenic plants, designed within CaMV 35S): CGACACGCTTGTCTACTCCA;

[0092] SEQ ID No. 5 (Primer ID-CsNBR1-R designed in CDS after identification of transgenic plants): CTAAGCTTTCTCCCCGGTAAGA;

[0093] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0094] 3. qRT-PCR analysis of transgenic plants

[0095] Total RNA (Adelaide, CAT No: RN09) was extracted from leaves of transgenic plants and cDNA was synthesized using the PrimeScript RT MasterMix reverse transcription kit (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsNBR1-F (SEQ ID No. 6) and RT-CsNBR1-R (SEQ ID No. 7). Two... -△△Ct The relative expression level of the CsNBR1 gene in transgenic plants was calculated as follows: The water-treated sample was defined as the reference factor, with a CsNBR1 expression level of 1. The fold increase in gene expression relative to the reference factor in transgenic citrus was then calculated. -△△Ct The results showed that the CsNBR1 gene was expressed at a higher level in transgenic plants compared to wild-type plants (e.g., ). Figure 6 (As shown).

[0096] SEQ ID No. 6 (Primers RT-CsNBR1-F for RT-qPCR identification of transgenic plants, designed in CDS): AGTGTGAAGGAGCCAGCAAA;

[0097] SEQ ID No. 7 (Primers RT-CsNBR1-R, designed in CDS, after RT-qPCR identification of transgenic plants): GAAGTAGCCTCTGAACGGGG;

[0098] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0099] 4. Western blot analysis of transgenic plants

[0100] Total protein (Soleb, CAT No: BC3720) was extracted from the leaves of transgenic plants and immunoblotted using a 10% SDS-PAGE gel. The sample was blocked with 5% skim milk powder, and the endogenous NBR1 protein content was subsequently detected using an NBR1-specific antibody (e.g., ...). Figure 7 (As shown).

[0101] 5. Phenotypic observation of transgenic plants

[0102] Observation and analysis of the phenotypes of the two overexpressing and two RNAi plants revealed no obvious abnormalities in appearance or growth (e.g., Figure 8 As shown in the figure, this indicates that overexpression and interference with the CsNBR1 gene did not have a significant impact on the plant's phenotype and development.

[0103] 6. Evaluation of Huanglongbing resistance in transgenic plants

[0104] According to the method of Zou et al. (2016), qPCR was used to detect the pathogen content of transgenic plants. Starting from inoculating the transgenic plants with the virus, the pathogen content of CsNBR1 transgenic plants was detected at 2, 4, and 6 months. Three leaves were taken from each line to extract DNA, which was diluted to 10 ng / μL, and primers Las16S (SEQ ID No.11, SEQ ID No.12) and citrus 18S (SEQ ID No.13, SEQ ID No.14) were used for detection.

[0105] Using the following formula: Las copies μg -1 citrus DNA = [10^ (-0.2718×CtLas16S+10.624) / 10^(-0.2749×CtCs18S+4.0531) × 10 ^3 (12.7 < CtLas16S < 31.3 and 8.4 < CtCs18S < 26.5), the relative content (Log10) of CLas bacteria was calculated. The wild-type plants were used as controls to detect the resistance level of CsNBR1 transgenic plants. Three biological replicates and three technical replicates were set for each treatment. The results showed that overexpression of CsNBR1 inhibited the proliferation of CLas in transgenic plants (as Figure 9 shown).

[0106] SEQ ID No.11 (16S-F): TGAGTGCTAGCTGTTGGGTG.

[0107] SEQ ID No.12 (16S-R): CTGCGCGTTGCATCGAATTA.

[0108] SEQ ID No.13 (citrus 18S-F): AATTGTTGGTCTTCAACGAGGAA.

[0109] SEQ ID No.14 (citrus 18S-R): AAAGGGCAGGGACGTAGTCAA.

[0110] Thus, overexpression of CsNBR1 can greatly reduce the pathogen titer of huanglongbing. This gene can be independently used for disease-resistant molecular breeding or can be used together with other disease-resistant or disease-susceptible genes for citrus huanglongbing-resistant molecular breeding.

[0111] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions of the present invention or make equivalent replacements, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of the CsNBR1 gene in improving resistance to Huanglongbing (HLB) in citrus, characterized by: The nucleotide sequence of the CsNBR1 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The method of improving citrus resistance to Huanglongbing (HLB) involves regulating the expression level of the CsNBR1 gene in citrus, thereby enhancing the resistance of citrus to HLB.

3. An overexpression vector for enhancing resistance to Huanglongbing (HLB) in citrus, characterized in that, The overexpression vector includes the CsNBR1 gene as described in claim 1.

4. A strain that enhances resistance to Huanglongbing (HLB) in citrus, characterized in that, The strain includes the overexpression vector as described in claim 3.

5. A method for improving citrus Huanglongbing resistance using the CsNBR1 gene as described in claim 1, characterized in that, Includes the following steps: S1, Cloning the CsNBR1 gene of citrus; S2. Construct the CsNBR1 overexpression vector pLGNe-Flag-CsNBR1; S3. The CsNBR1 overexpression vector pLGNe-Flag-CsNBR1 obtained in S2 was transformed into citrus, and transgenic plants with improved resistance to Huanglongbing were obtained after identification.

6. The method according to claim 5, characterized in that, In S1, the cloned citrus CsNBR1 gene is specifically: Total RNA was extracted from citrus and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed using primers OE-CsNBR1-F and OE-CsNBR1-R. The CsNBR1 gene was obtained by digestion with BamHI and EcoRI. The nucleotide sequence of primer OE-CsNBR1-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsNBR1-R is shown in SEQ ID NO.

3.

7. The method according to claim 5, characterized in that, In S2, the construction of the CsNBR1 overexpression vector pLGNe-Flag-CsNBR1 specifically involves: ligating the CsNBR1 gene obtained in S1 into the pLGNe vector recovered by BamHI and EcoRI enzyme digestion to construct the overexpression vector pLGNe-Flag-CsNBR1.

8. The method according to claim 5, characterized in that, In S3, the transformation of citrus with the CsNBR1 overexpression vector pLGNe-Flag-CsNBR1 obtained in S2 is specifically as follows: the overexpression vector pLGNe-Flag-CsNBR1 obtained in S2 is transformed into Agrobacterium tumefaciens EHA105 by heat shock method, and then Agrobacterium-mediated transformation of citrus explants is carried out. After genetic transformation, the explant cells are identified by PCR, qRT-PCR, and western blot analysis of CsNBR1 expression level to obtain transgenic plants.

9. The method according to claim 8, characterized in that, In the PCR identification, the PCR amplification primers are ID-CsNBR1-F and ID-CsNBR1-R; The nucleotide sequence of primer ID-CsNBR1-F is shown in SEQ ID NO.4, and the nucleotide sequence of primer ID-CsNBR1-R is shown in SEQ ID NO.

5.

10. The method according to claim 8, characterized in that, In the qRT-PCR analysis, the primers for qRT-PCR detection were RT-CsNBR1-F and RT-CsNBR1-R; The nucleotide sequence of the primer RT-CsNBR1-F is shown in SEQ ID NO.6, and the nucleotide sequence of the primer RT-CsNBR1-R is shown in SEQ ID NO.7.

Images