Preparation method and application of photoelectric self-energized biosensor based on Zr-MOF (at) BiOI
By constructing a dual photoelectrode system with Zr-MOF@BiOI/PDA as the photoanode and Au@Cu-In2S3 as the photocathode, the sensitivity and false positive problems of ampicillin detection in traditional detection methods are solved, achieving efficient, low-cost, and ultrasensitive detection suitable for the analysis of pharmaceutical and human samples.
Patent Information
- Application Number
- CN202511046418.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-29
- Publication Date
- 2025-10-31
AI Technical Summary
Existing technologies are insufficient for the efficient detection of ampicillin. Traditional methods require cumbersome sample pretreatment and lengthy analysis time, and are prone to false positives, sensitivity issues, and cost problems.
A self-powered photoelectrochemical biosensor with a dual photoelectrode system was constructed using Zr-MOF@BiOI/PDA as the photoanode and Au@Cu-In2S3 as the photocathode. The heterostructure formed by the coupling of Zr-MOF and BiOI, combined with the dopamine polymer film and copper-doped In2S3, improves electron transfer capability and photoelectric conversion efficiency. Au NPs are used as a binding bridge to achieve highly selective quantitative analysis of target molecules.
It achieves ultrasensitive detection of ampicillin with a detection limit as low as 3.33×10-15 g·L-1, exhibiting good sensitivity, reproducibility, and stability. It is suitable for the analysis of pharmaceutical and human samples, avoiding false positive results.
Smart Images

Figure CN120870286A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of electrochemical sensor technology, and in particular to a method for preparing a self-powered photoelectric biosensor based on Zr-MOF@BiOI and its application. Background Technology
[0002] Ampicillin (AMP) is a common β-lactam antibiotic widely used in medicine and agriculture to treat various bacterial infections. With its increasing use in agriculture and aquaculture, AMP not only poses potential health problems but also indirectly exacerbates the threat of antibiotic resistance. Therefore, developing ultrasensitive detection methods for rapid and accurate AMP monitoring is of great significance for drug quality control and public health. Currently, common methods for AMP detection include high-performance liquid chromatography (HPLC), fluorescence detection, and microbial detection methods. However, these methods typically require cumbersome sample pretreatment, long analysis times, complex operating procedures, and expensive maintenance. Photoelectrochemical (PEC) biosensors, on the other hand, offer advantages such as high sensitivity, ease of operation, and low cost. Compared to traditional photoelectric sensors, self-powered PEC biosensors require no external potential, exhibit strong anti-interference capabilities in complex detection environments, and effectively avoid false positives. Furthermore, their high sensitivity and significantly reduced detection limits have made them increasingly popular in the field of biomedical monitoring.
[0003] Zirconium-based porphyrin-organic frameworks (Zr-MOFs) are modular semiconductor materials formed by the self-assembly co-crystallization of metal ions and the organic ligand porphyrin. The ligand photosensitizer porphyrin has attracted much attention due to its strong visible light absorption and luminescence properties, as well as its photoelectrochemical properties suitable for electron transfer reactions related to light capture. The nitrogen atom in the central porphyrin structure can react with Zr... 4+ Coordination formation of Zr-MOFs can improve their chemical stability and photoelectric conversion efficiency by introducing metal guest metals into the MOF structure; however, its electron transfer efficiency is not significant. Bismuth oxyiodide (BiOI) not only has good conductivity, low cost, high stability, and non-toxicity, but also possesses a unique layered structure (I-Bi-O-Bi-I) and significant visible light photocatalytic activity, making it a focus of attention in the field of photocatalysis. However, the electron-hole mobility of monomeric BiOI is low, and electrons and holes are localized, leading to electron-hole recombination.
[0004] Indium sulfide (In2S3) is a broad-spectrum semiconductor material. When it exhibits a rust-like structure, the sulfide anions are arranged in a close-packed layer, with each anion surrounded by six octahedral cations within the layer. 3+The tetrahedral coordination between layers bridges the gaps between anions. When In2S3 forms a spherical structure with surface defects, there are many vacancy sites in its lattice. Although In2S3 has advantages such as good stability, large specific surface area and visible light absorption, its high photogenerated charge recombination rate still limits its photocatalytic activity.
[0005] There are currently no reports on the use of sensors combining Zr-MOF, BiOI, and In2S3 for the detection of ampicillin. Summary of the Invention
[0006] To address the above shortcomings, this invention provides a method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI and its application. This method constructs a self-powered photoelectric chemical biosensor with a dual-photoelectrode system, using Zr-MOF@BiOI / PDA as the photoanode and Au@Cu-In2S3 as the photocathode. This sensor exhibits high sensitivity and a low detection limit for the detection of ampicillin. The specific technical solution is as follows: A method for fabricating a photoelectric self-powered biosensor based on Zr-MOF@BiOI, wherein the biosensor is constructed using Zr-MOF@BiOI / PDA composite material as the photoanode and Au@Cu-In2S3 composite material as the photocathode; The specific construction steps are as follows: (1) Preparation of Zr-MOF@BiOI and Cu-In2S3; (2) The Zr-MOF@BiOI and Cu-In2S3 were coated on the conductive surface of the ITO glass electrode respectively to obtain Zr-MOF@BiOI / ITO and Cu-In2S3 / ITO; (3) Preparation of photoanode: PDA film is polymerized on the Zr-MOF@BiOI / ITO surface by electropolymerization to obtain photoanode Zr-MOF@BiOI / PDA / ITO; (4) Preparation of photocathode: Au NPs were first synthesized on the surface of Cu-In2S3 / ITO by electrodeposition to obtain Au@Cu-In2S3 / ITO; then sDNA solution was dropped onto the surface of Au@Cu-In2S3 / ITO, and after incubation, washing and natural drying, Au@Cu-In2S3 / sDNA / ITO was obtained; then BSA was dropped onto the surface, and after incubation, washing and natural drying, Au@Cu-In2S3 / sDNA / BSA / ITO was obtained; finally, Apt solution was dropped onto the surface of Au@Cu-In2S3 / sDNA / BSA / ITO electrode, and after incubation and washing, Au@Cu-In2S3 / sDNA / BSA / Apt / ITO was obtained.
[0007] Further, in step (1), the preparation method of Zr-MOF@BiOI is as follows: under stirring conditions, Zr-MOF is ultrasonically dispersed in a Bi(NO3)3 ethylene glycol solution. After stirring for 15-20 min, a KI ethylene glycol solution is slowly added dropwise, and a dark green suspension product gradually appears. Stirring is continued for 1-2 h. The resulting mixture is transferred to a reaction vessel and reacted at a constant temperature of 100-120 ℃ for 10-12 h. After naturally cooling to room temperature, the product is centrifuged, washed with deionized water, and then freeze-dried for 20-24 h to obtain Zr-MOF@BiOI.
[0008] Further, in the ethylene glycol solution of KI, the mass-to-volume ratio of KI to ethylene glycol is 1 g:(70-75) mL; in the ethylene glycol solution of Bi(NO3)3, the mass-to-volume ratio of Bi(NO3)3·5H2O to ethylene glycol is 1 g:(30-35) mL; and the mass ratio of Zr-MOF, Bi(NO3)3·5H2O, and KI is 1:(14-16):(6-8).
[0009] Further, in step (1), the preparation method of Cu-In2S3 is as follows: weigh C2H5NS, citric acid and InCl3·4H2O and dissolve them in deionized water, add 0.5 mmol·L -1 Cu(NO3)2 solution was reacted in an oil bath at 70-80 °C for 2-3 hours. During the reaction, the solution was observed to gradually change from white to gray, then to yellow, and finally to orange-yellow. After naturally cooling to room temperature, the product was centrifuged, washed, and then vacuum dried at 50-60 °C to obtain Cu-In2S3.
[0010] Furthermore, the molar ratio of C2H5NS, citric acid, and InCl3·4H2O is 7:7.5:1; the volume ratio of Cu(NO3)2 solution to deionized water is 1:(1500-1520).
[0011] Further, in step (2), the specific preparation method of the Zr-MOF@BiOI / ITO is as follows: dissolve the Zr-MOF@BiOI composite material in deionized water, disperse it ultrasonically, and obtain 1 mg·mL -1 Zr-MOF@BiOI suspension; the suspension is uniformly coated on the conductive surface of the ITO glass electrode and allowed to air dry naturally to obtain the product; the Cu-In2S3 / ITO is prepared by the same method.
[0012] Further, in step (3), the electropolymerization method is performed using an electrochemical workstation, with a Pt column electrode as the counter electrode, a saturated Ag / AgCl electrode as the reference electrode, and Zr-MOF@BiOI / ITO as the working electrode to construct a three-electrode system, using 10 mmol·L⁻¹. -1 Dopamine was dissolved in the electrolyte, and cyclic voltammetry was used with a potential range of -1 V to 0.4 V and a scan rate of 15-20 mV·s. -1 Sensitivity is 1×10 3 Electropolymerization for one cycle yields Zr-MOF@BiOI / PDA / ITO.
[0013] Further, in step (4), the electrodeposition method involves synthesizing Au NPs on the Cu-In2S3 / ITO surface using a 0.01 mol·L⁻¹ electrolyte. -1 Au@Cu-In2S3 / ITO was obtained by electrodeposition in NaSO4 solution for 200-300 s at a constant potential of -0.2V using the time-current method.
[0014] The present invention also provides a photoelectric self-powered biosensor prepared by the above preparation method.
[0015] The present invention also provides an application of the photoelectric self-powered biosensor prepared by the above-described preparation method, wherein the application is for the detection of ampicillin.
[0016] This invention couples Zr-MOF and BiOI to form a novel and efficient heterostructure (Zr-MOF@BiOI). At the same time, dopamine (DA) can serve as an electron donor for photoactive materials. A DA film is polymerized on the surface of Zr-MOF@BiOI (Zr-MOF@BiOI / PDA) to improve the electron transfer capability of the composite material. Based on Zr-MOF@BiOI / PDA, a photoanode with high photoelectric conversion efficiency is assembled to construct a photocurrent enhanced PEC sensor to achieve ultrasensitive detection of target objects.
[0017] This invention uses Cu 2+ Copper is used as a dopant to adjust the electronic and band structures of In₂S₃, forming defective copper-doped In₂S₃ (Cu-In₂S₃). This is achieved through the use of In… 3+ With Cu 2+The substitution of impurity energy levels generates impurity energy levels, which can serve as recombination centers, promoting electron-hole pair separation and enhancing visible light absorption and photocatalytic performance. Furthermore, highly conductive gold nanoparticles (Au NPs) are introduced onto the Cu-In2S3 electrode surface via electrodeposition to assemble a stable Au@Cu-In2S3 working (cathode) electrode, further improving photoelectric conversion efficiency. Au NPs can also act as a bridge between the Cu-In2S3 photosensitive material and sDNA, enabling highly selective quantitative analysis of target molecules through aptamer-specific recognition and capture.
[0018] Compared with the prior art, the beneficial effects of the present invention are: 1. This invention constructs a self-powered photoelectrochemical biosensor with a dual photoelectrode system, using Zr-MOF@BiOI / PDA as the photoanode and Au@Cu-In2S3 as the photocathode. This sensor exhibits good sensitivity, reproducibility, and reliable stability for ampicillin and demonstrates excellent performance in the analysis of pharmaceuticals, human serum, and urine.
[0019] 2. This invention utilizes the performance advantages of dual photoelectrodes to enhance the optical signal, effectively avoid false positive signals, improve result accuracy, and achieve ultrasensitive detection of AMP. It exhibits a good linear relationship with the photocurrent signal at ultra-low concentrations, and its linear regression equation is as follows: I (μA) = -0.054log C (g·L -1 The detection limit was -1.063 and the detection limit was 3.33 × 10⁻⁶. -15 g·L -1 .
[0020] 3. The sensor of this invention is sensitive, simple, and low-cost, with good selectivity and stability. It has been successfully used to detect AMP in veterinary drugs, human serum, and urine, with a spiked recovery rate ranging from 98.80% to 102.01%. It has good application prospects in the field of biopharmaceutical analysis. Attached Figure Description
[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below.
[0022] Figure 1 SEM images of Zr-MOF, BiOI, Zr-MOF@BiOI, Zr-MOF@BiOI / PDA, In2S3, and Cu-In2S3 in Example 1, and elemental distribution diagrams of Au@Cu-In2S3 and Zr-MOF@BiOI / PDA; Figure 2TEM images of Zr-MOF@BiOI and Cu-In2S3 in Example 1; Figure 3 XPS analysis images and high-resolution spectra of each substance in Example 1; Figure 4 The XRD spectra of each substance in Example 1 are shown below. Figure 5 The following are the UV-Vis diffuse reflectance (DRS) spectra of each substance in Example 1; Figure 6 The photocurrent response diagrams are shown for different modified electrodes of the photocathode in Example 1. Figure 7 The images show the photocurrent curves and standard curves for different concentrations of AMP in Example 1. Detailed Implementation
[0023] The specific embodiments of the present invention will be described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.
[0024] The following instruments and reagents are involved: Instruments: Scanning electron microscope (ZEISS, EVO-18, Germany); X-ray photoelectron spectroscopy (XRD, Thermo Scientific K-Alpha, USA); Transmission electron microscope (TEM, JEOL JEM-F200, Nippon Electron Ltd.); X-ray photoelectron spectroscopy (XPS, Thermo Scientific ESCALAB Xi, Thermo Fisher Scientific, USA); Electrochemical workstation (CHI760E, Shanghai Chenhua Instrument Co., Ltd.); Autolab electrochemical workstation (NOVa 2.1, Metrohm China Ltd.); Photoelectrochemical reactor (PEAC 200A, Tianjin Aida Hengsheng Technology Co., Ltd.); Fourier transform infrared spectrometer (FT-IR, PerkinElmer-65, PerkinElmer Instruments Ltd.).
[0025] Reagents: Zirconium chloride (ZrCl4), benzoic acid (C7H6O2), meso-tetra(4-carboxyphenyl)porphyrin (C 48 H 30 N4O8), Thioacetamide (C2H5NS), indium trichloride tetrahydrate (InCl3·4H2O), bismuth nitrate pentahydrate (Bi(NO3)3·5H2O), copper nitrate trihydrate (Cu(NO3)2·3H2O), (N,N-dimethylformamide) <dmf>HCON(CH3)2, Chengdu Kelong Chemical Co., Ltd.) Ethylene glycol (C2H6O2), bovine serum albumin (BSA), ampicillin (C 16 H 19 N3O4S was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. All nucleotides used in the experiments were purchased from Sangon Biotech (Shanghai) Co., Ltd. sDNA sequence: 5'-SH-C6CTCGTAGCCTGTGGGGGGAGTTAATCTATCATTTCTCCGCTATACAACCGCCCGCAAAA-3'; Apt sequence: 5'-NH2-C6TCTAACGTGAATGATAGATGAACTTATTCGACCATACACGTCTGCATTAACTTATTCGACCATTTTTGCGGGCGGTTGTATAGCGG-3'.
[0026] Example 1 A method for fabricating a photoelectric self-powered biosensor based on Zr-MOF@BiOI is as follows: (1) Preparation of Zr-MOF Zr-MOF was prepared by a solvothermal synthesis method. 75 mg ZrCl4, 30 mg TCPP, and 1750 mg benzoic acid were weighed and dissolved in 10 mL DMF, and stirred at room temperature for 30 min. The resulting mixture was transferred to a polytetrafluoroethylene reactor and kept at 130 °C for 18 h. After the reaction was complete, the resulting purple suspension was cooled to room temperature, and the product was washed three times with DMF and deionized water after centrifugation. Finally, the resulting purple crystals were dried overnight in a vacuum drying oven at 60 °C to obtain Zr-MOF.
[0027] (2) Preparation of BiOI and Zr-MOF@BiOI Zr-MOF@BiOI was prepared using a modified method based on references. 0.4 g KI and 0.97 g Bi(NO3)3·5H2O were dissolved in 30 mL ethylene glycol to obtain ethylene glycol solutions of KI and Bi(NO3)3, respectively. Under stirring, 60 mg Zr-MOF was ultrasonically dispersed in the ethylene glycol solution of Bi(NO3)3, and stirring was continued for 15 min. Then, the ethylene glycol solution of KI was slowly added dropwise to the above mixed solution, and a dark green suspension gradually appeared. Stirring was continued for another 1 h. The resulting mixture was transferred to a reaction vessel and reacted at 120 °C for 12 h. After the reaction was complete, the mixture was naturally cooled to room temperature, and the product obtained by centrifugation was washed three times with deionized water, followed by freeze-drying for 24 h to obtain Zr-MOF@BiOI. Under the same conditions, without the addition of Zr-MOF, the orange-red monomer BiOI was synthesized using the same method.
[0028] (3) Preparation of In2S3 and Cu-In2S3 Cu-In₂S₃ was prepared by a solvothermal synthesis method. 250 mg C₂H₅NS, 700 mg citric acid, and 142 mg InCl₃·4H₂O were weighed and dissolved in 50 mL of deionized water. 0.033 mL of 0.5 mmol·L⁻¹ water was then added. -1 A Cu(NO3)2 solution was reacted in an oil bath at 80 °C for 2.5 h. During the reaction, the solution gradually changed from white to gray, then to yellow, and finally to orange-yellow. After naturally cooling to room temperature, the product obtained by centrifugation was washed three times with anhydrous ethanol and deionized water, respectively. Finally, the resulting orange-yellow precipitate was dried overnight in a vacuum drying oven at 60 °C to obtain Cu-In2S3. Under the same conditions, without the addition of Cu(NO3)2 solution, the orange-red monomer In2S3 was synthesized by the same method.
[0029] (4) Preparation of modified electrodes The indium tin oxide (ITO, 50 × 10 mm, <6 Ω) conductive glass electrode was ultrasonically cleaned for 10 min each with acetone, anhydrous ethanol, and deionized water, and then dried with an infrared lamp for later use. Zr-MOF@BiOI composite material was weighed and dissolved in deionized water (1 mg·mL⁻¹). -1 In a solution, the sample was ultrasonically dispersed for 10 min to obtain 1 mg·mL⁻¹. -1 Zr-MOF@BiOI suspension. Accurately pipette 40 μL of the suspension and uniformly coat it onto the conductive surface of the ITO glass electrode (effective area 1 cm²). 2 After natural air drying, Zr-MOF@BiOI / ITO was obtained. Zr-MOF / ITO, BiOI / ITO, In2S3 / ITO and Cu-In2S3 / ITO were prepared by the same method.
[0030] (5) Preparation of Zr-MOF@BiOI / PDA / ITO and Au@Cu-In2S3 / ITO PDA films were polymerized on Zr-MOF@BiOI / ITO surfaces via electropolymerization. The electropolymerization process was performed using an electrochemical workstation, constructing a three-electrode system with a Pt column electrode as the counter electrode, a saturated Ag / AgCl electrode as the reference electrode, and Zr-MOF@BiOI / ITO as the working electrode. The polymerization temperature was 10 mmol·L⁻¹. -1 Dopamine was dissolved in the electrolyte. Cyclic voltammetry (CV) was used, with a potential range of -1 V to 0.4 V and a scan rate of 20 mV·s. -1 Sensitivity is 1×10 3 One electropolymerization cycle yielded Zr-MOF@BiOI / PDA / ITO. The electropolymerization process was conducted entirely in the dark. Au NPs were also synthesized on the Cu-In₂S₃ / ITO surface using electrodeposition. The electrolyte was 0.01 mol·L⁻¹. -1 NaSO4 solution (containing 2.5 mmol·L⁻¹) -1 Au@Cu-In2S3 / ITO was obtained by electrodeposition at a constant potential (-0.2 V) for 300 s using the time-current method (it).
[0031] (6) Construction process of PEC sensor First, centrifuge the sDNA and Apt separately at 10000 r / min for 3 min to allow the lyophilized powder to accumulate at the bottom of the centrifuge tube. Then, slowly open the centrifuge tube cap and add 180 μL of PBS (pH=7.4) solution to the sDNA centrifuge tube to obtain 10 μmol·L⁻¹ solution. -1 The sDNA solution was added to the Apt centrifuge tube. -1 PBS (pH=7.4) solution yields 10 μmol·L⁻¹ -1 The Apt solution was prepared. Both solutions were sonicated for 10 min, then activated by heating in a 95 °C water bath for 5 min, and cooled to room temperature. The sDNA and Apt solutions were then diluted to 1 μmol·L⁻¹. -1 sDNA and Apt solution should be stored in a refrigerator for later use.
[0032] Preparation of the photocathode: 10 μL of sDNA solution was drop-coated onto the Au@Cu-In2S3 / ITO surface and incubated at 4 °C for 12 h. After incubation, the electrode was washed with PBS buffer to remove unadsorbed sDNA and air-dried to obtain Au@Cu-In2S3 / sDNA / ITO. Subsequently, 10 μL of 1% bovine serum albumin (BSA) was drop-coated and incubated at 37 °C for 30 min to block non-specific binding sites. The electrode was then washed with PBS buffer and air-dried to obtain Au@Cu-In2S3 / sDNA / BSA / ITO. Finally, 20 μL of Apt solution was drop-coated onto the Au@Cu-In2S3 / sDNA / BSA / ITO electrode surface and incubated at 37 °C for 1 h. After incubation, the electrode was washed with PBS buffer to remove unbound material to obtain Au@Cu-In2S3 / sDNA / BSA / Apt / ITO. Photoanode: Zr-MOF@BiOI / PDA / ITO is used directly as the photoanode.
[0033] SEM and TEM characterization of composite materials The morphology of a series of optoelectronic materials was characterized using scanning electron microscopy (SEM) and TEM. For example... Figure 1 It can be observed that Zr-MOF is a rod-shaped material with uniform size. Figure 1 A), BiOI is a three-dimensional flower ball with a rough and porous surface ( Figure 1 B). Zr-MOF@BiOI also presents as flower-like spheres ( Figure 1 C), after surface modification with a PDA polymer film, a layered film can be clearly observed adhering to the surface of the Zr-MOF@BiOI composite material. Figure 1 D). For In2S3, it can be observed to have a rough surface, resembling a hydrangea (D). Figure 1 E), slightly smaller in size than BiOI flower heads. After Cu doping, the morphology of Cu-In2S3 hydrangea flowers remained essentially unchanged. Figure 1 F). The mapping diagram of Au@Cu-In2S3 / ITO shows that Au, Cu, In, and S are uniformly distributed on the electrode surface. Figure 1 G). The mapping diagram of Zr-MOF@BiOI / PDA / ITO shows that Zr, Bi, O, I, and C are uniformly distributed on the electrode surface. Figure 1 H).
[0034] TEM image of Zr-MOF@BiOI, showing flower-like microspheres of 2~3 μm ( Figure 2 A~C). TEM images of Cu-In2S3 show that Cu-In2S3 consists of solid 2~3 μm hydrangea-shaped microspheres (A~C). Figure 2 (D~F). This indicates that the Zr-MOF@BiOI / PDA / ITO and Au@Cu-In2S3 / ITO optoelectronic materials have been successfully combined.
[0035] XPS characterization of composite materials The elemental composition and chemical state of the Zr-MOF@BiOI / PDA and Cu-In2S3 composite materials were characterized using X-ray photoelectron spectroscopy (XPS), such as... Figure 3 As shown, Figure 3 A shows the elemental binding energy of the Zr-MOF@BiOI / PDA composite material. High-resolution magnified images of Zr, Bi, O, I, N, and C elements in Zr-MOF@BiOI / PDA are shown below. Figure 3 As shown in B~G. Figure 3 This demonstrates the successful composite material bonding of Zr-MOF@BiOI / PDA / ITO and Cu-In2S3.
[0036] XRD and FT-IR characterization of materials The crystal structure of the above-mentioned photosensitive material was analyzed by X-ray photoelectron spectroscopy (XRD), such as... Figure 4 As shown, Figure 4 As shown in Figure A, the seven diffraction peaks at 2θ = 28.8°, 33.4°, 48.0°, 56.1°, 59.6°, 70.2°, and 77.6° of the In₂S₃ material correspond to the (101), (102), (104), (201), (202), (204), and (107) crystal planes, respectively; while the lattice structure remains unchanged after Cu doping. Figure 4 As shown in Figures B to C, the Zr-MOF material exhibits four distinct characteristic peaks at 2θ = 2.4°, 4.8°, 7.1°, and 9.8°. Figure 4 As shown in D, at 3415 cm -1 The characteristic peaks appearing at this point are attributed to the NH symmetric and asymmetric tensile vibrations of primary amines. Figure 4 This indicates that Cu-In2S3 and Zr-MOF@BiOI / PDA were successfully composited.
[0037] Band structure of materials Band structure helps in understanding the photoelectric properties of materials; therefore, the ultraviolet-visible diffuse reflectance (DRS) spectra of the aforementioned photosensitive materials were investigated, as shown below. Figure 5 As shown, Figure 5 As shown in A and 5F, the bandgap of the semiconductor ( E g Calculate using the Tauc plot formula: (αhv) 1 / n =A(hv-E g ) ,in α Indicates the absorption coefficient. h Let be Planck's constant. v For frequency, A It is a constant. E g Indicates the bandgap width of a semiconductor. (Index) n Directly related to the type of semiconductor, direct bandgap semiconductor, n =1 / 2, indirect bandgap semiconductor n =2. Zr-MOF, BiOI, In2S3, and Cu-In2S3 are all direct bandgap semiconductors, therefore, n Both are 1 / 2. For example... Figure 5 From A to E, the Eg values of Zr-MOF and BiOI, calculated according to the Tauc equation, are 2.65 eV and 2.13 eV, respectively. The Zr-MOF@BiOI composite material... E g The value is 2.21 eV. Compared with Zr-MOF, the Zr-MOF@BiOI composite material, after being combined with BiOI, exhibits higher energy density. E g The value decreased by 0.44 eV. Similarly, as... Figure 5 F~I, the calculated Eg values for In₂S₃ and Cu-In₂S₃ are 2.12 eV and 2.10 eV, respectively. Cu-In₂S₃... E g Value compared to In2S3 E g The value decreased by 0.02 eV, which may be due to the impurity energy level generated by the anion defect, leading to enhanced visible light absorption. Mott-Schottky (MS) analysis showed that the flat band potentials of Zr-MOF, BiOI, In2S3, and Cu-In2S3 were -0.61 eV, -1.00 eV, -0.89 eV, and -0.65 eV, respectively. The calculated conduction band (CB) positions of Zr-MOF, BiOI, In2S3, and Cu-In2S3 were -0.41 eV, -0.80 eV, -0.69 eV, and -0.45 eV, respectively, and the step band (VB) positions were 2.24 eV, 1.33 eV, 1.43 eV, and 1.65 eV, respectively. The electron transfer mechanism of this PEC sensing is as follows: Figure 2-1 As shown in Figure B, the effective recombination of Zr-MOF and BiOI leads to photogenerated electrons (electrons). - It is easier to transfer from BiOI CB to Zr-MOF CB, while photovoltaic holes (h + The electrons transfer from the higher valence band (VB) of Zr-MOF to the lower valence band of BiOI. This band structure allows electrons to spontaneously transfer from higher to lower energy levels, thereby improving the photoelectric conversion efficiency and enhancing the photoelectric effect. The VB of Cu-In2S3 is higher than that of In2S3, indicating that the impurity energy levels introduced by Cu generate more photogenerated electron-hole pairs, leading to an increase in photocurrent.
[0038] Analytical properties of different materials The effects of different modified electrodes of the photocathode on 0.1 mol·L⁻¹ were investigated. -1 The photocurrent response in PBS buffer solution (pH 7.4) was as follows: Figure 6 As shown in Figure A, with the fixed counter electrode Zr-MOF@BiOI / PDA / ITO, under blue light irradiation, Bare / ITO shows almost no photocurrent, while Au@Cu-In2S3 / ITO, Au@Cu-In2S3 / sDNA / ITO, Au@Cu-In2S3 / sDNA / BSA / ITO, Au@Cu-In2S3 / sDNA / BSA / Apt / ITO, and Au@Cu-In2S3 / sDNA / BSA / Apt / 10 -10 g·L -1 The photocurrent values of AMP / ITO were 0.18 μA, 0.41 μA, 1.38 μA, 0.93 μA, 0.66 μA, 0.26 μA, and 0.48 μA, respectively. Au@Cu-In2S3 / ITO exhibited the highest photocurrent. After incubation with sDNA, a physical barrier formed on the electrode surface, hindering charge transfer and causing a decrease in photoelectric signal. With the addition of BSA, non-specific recognition sites were blocked, and the poor conductivity of BSA led to a continuous decrease in photoelectric signal. After incubation with Apt, complementary base pairing was formed with sDNA, the physical barrier thickened, and the photoelectric signal decreased further. When AMP was present, the aptamer specifically recognized AMP and detached from the electrode surface, resulting in amplification of the photoelectric signal. The influence of photocathode photocurrent was also investigated, and the results are as follows: Figure 6 As shown in B, Au@Cu-In2S3 / sDNA / BSA / Apt / 10 is immobilized. -10 g·L -1 Using AMP / ITO as the working electrode, Bare / ITO exhibited almost no photocurrent under blue light irradiation. The photocurrents of BiOI / ITO, Zr-MOF / ITO, Zr-MOF@BiOI / ITO, and Zr-MOF@BiOI / PDA / ITO were 0.12 μA, 0.13 μA, 0.27 μA, and 0.49 μA, respectively. The photocurrent of Zr-MOF@BiOI / ITO was significantly higher than that of the single electrode, indicating that Zr-MOF@BiOI / ITO has higher photoelectric conversion efficiency. Furthermore, the influence of the PDA film on the detection sensitivity was investigated. Figure 6 As shown in C~D, without the PDA film positive electrode, i.e., Zr-MOF@BiOI / ITO, the photocurrent difference for detecting 0 g·L -1 and 10 - 11 g·L -1 AMP is 0.04 μA, while under the same conditions, that of Zr-MOF@BiOI / PDA / ITO Δ I is 0.11 μA. This shows that as an electron donor, PDA can amplify the optoelectronic signal, making the current tend to be more stable and greatly improving the sensitivity. Δ I
[0039] To study the electron transfer ability of different working electrode surfaces, electrochemical impedance spectroscopy (EIS) measurements were carried out in a 5 mmol·L -1 [Fe(CN)6] 3- / 4- solution (containing 0.1 mol·L -1 KCl), as shown in Figure 6 E. The semicircle diameter: Bare / ITO < Au@Cu-In2S3 / ITO < In2S3 / ITO < Cu-In2S3 / ITO < Au@Cu-In2S3 / sDNA / ITO < Au@Cu-In2S3 / sDNA / BSA / ITO < Au@Cu-In2S3 / sDNA / BSA / Apt / 10 -10 g·L -1 AMP / ITO < Au@Cu-In2S3 / sDNA / BSA / Apt / ITO. It shows that the charge transfer resistance ( R et ) of Cu-In2S3 increases compared with In2S, which is caused by the sulfur vacancies induced by Cu 2+ substituting In 3+ . The resistance fitting circuit diagram is shown in the inset of Figure 6 E. After incubating sDNA, BSA, and Apt, the R et value continuously increases because the site resistance on the electrode surface continuously increases, inhibiting the transfer of electrons and holes. After incubating AMP, Apt specifically binds to AMP and detaches from the electrode surface, resulting in a decrease in the site resistance on the electrode surface and a decrease in the R et value. The electron transfer ability of different counter electrodes was studied under the same conditions, as shown in Figure 6 As shown in Figure F, the semicircle diameter: BiOI / ITO < Bare / ITO < Zr-MOF@BiOI / PDA / ITO < Zr-MOF@BiOI / ITO < Zr-MOF / ITO. BiOI has good conductivity and exhibits strong electron transfer ability. After being compounded with Zr-MOF, it synergistically accelerates the electron transfer rate of the composite material. The intervention of PDA increases the surface active sites and improves the conductivity of the composite material, making R et the value decrease. The resistance fitting circuit diagram is as shown in Figure 6 the inset of Figure F.
[0040] Detection of AMP Au@Cu-In2S3 / sDNA / BSA / Apt / ITO was used as the working electrode of the sensor, and Zr-MOF@BiOI / PDA / ITO was used as the counter electrode. Under the optimal experimental conditions, the i-t method was used to explore the relationship between the AMP concentration and photocurrent in the PEC sensor, as shown in Figure 7 Figure A. As the concentration of AMP increases, the photocurrent increases accordingly. A good linear relationship is presented within the concentration range of 10 -14 ~10 -8 g·L -1 (Figure B), and its linear regression equation is Figure 7 I(μA)= -0.054 log I C(g·L C ) - ¹.063, and the detection limit is 3.33×10 -1 g·L -15 . -1
[0041] Selectivity, reproducibility and stability To study the selectivity of the prepared sensor, cations (Ca 2+ , Mg 2+ , Na + , Cu 2+ , Fe 3+ and K + ) equivalent to 1000 times the concentration of AMP, uric acid, urea, glucose, maltose, soluble starch, D-alanine, DL-aspartic acid, L-cysteine, L-glutamic acid, L-leucine, glutathione, ascorbic acid, oxytetracycline, tetracycline and other substances that may exist in human serum and urine were used for anti-interference tests. Interference substances were added to the double-photoelectrode system, and the relative error of the photocurrent ( Er The values were all within ±5%, indicating that the proposed PEC sensor has good selectivity. Under the same experimental conditions, the detection results of AMP at the same concentration using five parallel electrodes were analyzed to evaluate the reproducibility of the PEC sensor. The detection results showed that the relative standard deviation of the obtained photocurrent values was within ±5%, indicating that the proposed PEC sensor has good selectivity. RSD The reproducibility rate was 3.64%, indicating that the sensor has good reproducibility. The Au@Cu-In2S3 / sDNA / BSA / Apt / 5×10 -9 g·L -1 After the AMP / ITO electrode was stored at 4 °C for 14 days, the photocurrent value measured under the same experimental conditions still reached 95.79% of the initial photocurrent value, indicating that the sensor has good long-term stability.
[0042] Testing of actual samples Under optimal experimental conditions, the accuracy of the PEC sensor in determining AMP content in veterinary drugs (ampicillin soluble powder), human blood samples, and urine samples was evaluated by spiked recovery rate. The results are shown in Table 1. The spiked recovery rate was 98.40%–102.01%, and the RSD was 0.17%–4.03%, indicating that the detection results of this method are reliable and can be applied to the detection of AMP content in actual samples.
[0043] Table 1. Detection results of AMP in actual samples In summary, this invention prepared novel Zr-MOF@BiOI / PDA and Au@Cu-In2S3 composite materials using solvothermal and electrochemical methods, which exhibited excellent photoelectric conversion efficiency and catalytic activity. Based on this, a self-powered PEC biosensor with a dual-photoelectrode system for ultrasensitive AMP detection was successfully designed and constructed. This sensor exhibits strong anti-interference capabilities, good stability and reproducibility, and a detection limit as low as 3.33 × 10⁻⁶. -15 g·L -1 The feasibility and practicality of this biosensor in practical applications were verified by detecting AMP in veterinary drugs, human serum, and urine. It is a universal, economical, and convenient PEC detection platform.
[0044] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.< / dmf>
Claims
1. A method for fabricating a photoelectric self-powered biosensor based on Zr-MOF@BiOI, characterized in that, The biosensor is constructed using Zr-MOF@BiOI / PDA composite material as the photoanode and Au@Cu-In2S3 composite material as the photocathode. The specific construction steps are as follows: (1) Preparation of Zr-MOF@BiOI and Cu-In2S3; (2) The Zr-MOF@BiOI and Cu-In2S3 were coated on the conductive surface of the ITO glass electrode respectively to obtain Zr-MOF@BiOI / ITO and Cu-In2S3 / ITO; (3) Preparation of photoanode: PDA film is polymerized on the Zr-MOF@BiOI / ITO surface by electropolymerization to obtain photoanode Zr-MOF@BiOI / PDA / ITO; (4) Preparation of photocathode: Au NPs were first synthesized on the surface of Cu-In2S3 / ITO by electrodeposition to obtain Au@Cu-In2S3 / ITO; then sDNA solution was dropped onto the surface of Au@Cu-In2S3 / ITO, and after incubation, washing and natural drying, Au@Cu-In2S3 / sDNA / ITO was obtained; then BSA was dropped onto the surface, and after incubation, washing and natural drying, Au@Cu-In2S3 / sDNA / BSA / ITO was obtained; finally, Apt solution was dropped onto the surface of Au@Cu-In2S3 / sDNA / BSA / ITO electrode, and after incubation and washing, Au@Cu-In2S3 / sDNA / BSA / Apt / ITO was obtained.
2. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 1, characterized in that, In step (1), the Zr-MOF@BiOI is prepared by: under stirring conditions, Zr-MOF is ultrasonically dispersed in a Bi(NO3)3 ethylene glycol solution, and after stirring for 15-20 min, a KI ethylene glycol solution is slowly added dropwise. A dark green suspension product gradually appears. Stirring is continued for 1-2 h. The resulting mixture is transferred to a reaction vessel and reacted at a constant temperature of 100-120 ℃ for 10-12 h. After naturally cooling to room temperature, the product is centrifuged and washed with deionized water. Then, it is freeze-dried for 20-24 h to obtain the Zr-MOF@BiOI.
3. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 2, characterized in that, In the ethylene glycol solution of KI, the mass-to-volume ratio of KI to ethylene glycol is 1 g:(70-75) mL; in the ethylene glycol solution of Bi(NO3)3, the mass-to-volume ratio of Bi(NO3)3·5H2O to ethylene glycol is 1 g:(30-35) mL; and the mass ratio of Zr-MOF, Bi(NO3)3·5H2O, and KI is 1:(14-16):(6-8).
4. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 1, characterized in that, In step (1), the preparation method of Cu-In2S3 is as follows: weigh C2H5NS, citric acid and InCl3·4H2O and dissolve them in deionized water, add 0.5 mmol·L -1 Cu(NO3)2 solution was reacted in an oil bath at 70-80 °C for 2-3 hours. During the reaction, the solution was observed to gradually change from white to gray, then to yellow, and finally to orange-yellow. After naturally cooling to room temperature, the product was centrifuged, washed, and then vacuum dried at 50-60 °C to obtain Cu-In2S3.
5. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 4, characterized in that, The molar ratio of C2H5NS, citric acid, and InCl3·4H2O is 7:7.5:1; the volume ratio of Cu(NO3)2 solution to deionized water is 1:(1500-1520).
6. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 1, characterized in that, In step (2), the specific preparation method of the Zr-MOF@BiOI / ITO is as follows: dissolve the Zr-MOF@BiOI composite material in deionized water, disperse it ultrasonically, and obtain 1 mg·mL -1 Zr-MOF@BiOI suspension; the suspension is uniformly coated on the conductive surface of the ITO glass electrode and allowed to air dry naturally to obtain the product; the Cu-In2S3 / ITO is prepared by the same method.
7. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 1, characterized in that, In step (3), the electropolymerization method is performed using an electrochemical workstation, with a Pt column electrode as the counter electrode, a saturated Ag / AgCl electrode as the reference electrode, and Zr-MOF@BiOI / ITO as the working electrode to construct a three-electrode system, 10 mmol·L -1 Dopamine was dissolved in the electrolyte, and cyclic voltammetry was used with a potential range of -1 V to 0.4 V and a scan rate of 15-20 mV·s. -1 Sensitivity is 1×10 3 Electropolymerization for one cycle yields Zr-MOF@BiOI / PDA / ITO.
8. The method for fabricating a self-powered photoelectric biosensor based on Zr-MOF@BiOI according to claim 1, characterized in that, In step (4), the electrodeposition method involves synthesizing Au NPs on the Cu-In2S3 / ITO surface using a 0.01 mol·L⁻¹ electrolyte. -1 Au@Cu-In2S3 / ITO was obtained by electrodeposition in NaSO4 solution for 200-300 s at a constant potential of -0.2V using the time-current method.
9. A photoelectric self-powered biosensor prepared by the preparation method according to any one of claims 1 to 8.
10. The application of the photoelectric self-powered biosensor prepared by the preparation method according to any one of claims 1 to 8, characterized in that, The application is for the detection of ampicillin.