Microcarrier for oral delivery of probiotic microcolonies as well as preparation method and application of microcarrier

Abstract

The invention provides a microcarrier for oral delivery of probiotic microcolonies as well as a preparation method and application of the microcarrier, and belongs to the technical field of probiotic delivery. According to the invention, an Express Microflora Service (EMS) system with adjustable matrix rigidity and viscoelasticity characteristics is designed to support culture and delivery of probiotic microcolonies based on a multicellular self-organization strategy, and the EMS system combines a free radical polymerization covalent cross-linked network with an ionic cross-linked network of classic calcium alginate, so as to support the culture and delivery of probiotic microcolonies based on the multicellular self-organization strategy. A series of double-crosslinked alginate hydrogel networks with stress relaxation characteristics are successfully developed, an optimized hydrogel formula for microcolony culture and oral administration is obtained, and a self-organizing mode of microcolonies formed by probiotics in a microcarrier is explored. The application of the EMS microcarrier in intestinal colonization shows that the probiotic microcolonies in the EMS microcarrier have excellent capability of resisting external severe environment and strong colonization potential, and the colitis of mice can be obviously relieved by orally taking EMS for one time.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of probiotic delivery, and particularly relates to a microcarrier for oral delivery of probiotic microcolonies, and a preparation method and application thereof. BACKGROUND

[0002] The changes in gut microbiota during the process from birth to death of human have a profound impact on human health and disease. At present, more and more diseases have been found to be associated with gut microbiota, and therefore probiotic intervention measures have gradually been considered as a potential treatment for cancer, autoimmune diseases and metabolic diseases. Although probiotic therapy has a history of hundreds of years in clinical application, the actual colonization of probiotic therapy is extremely individualized. Traditional probiotic supplements cannot be colonized continuously due to the harsh environment in the intestine, and therefore the beneficial effects thereof are often limited to the administration period.

[0003] Evolutionary biology attributes this fragile and transient colonization of probiotics to the poor adaptability of bacterial individuals. Specifically, bacterial colonization is a dynamic process, including reversible attachment, irreversible adhesion, microcolony formation and biofilm maturation. However, it has been found in practice that it is extremely difficult to form stable biofilms under the influence of continuous harsh environment. Recent studies have shown that the formation of biofilms is highly regulated in terms of genes, proteins and phenotypes at different stages of individual development, similar to the systematic development pattern of multicellular eukaryotic embryos. In addition, specific multicellular behaviors such as signal transduction, cell differentiation and division of labor between bacteria in biofilms have been found. There is evidence that multicellularity plays a key role in biofilm formation, but the practical application of this advanced view has never been explored. Although the multicellular microcolony strategy can conceptually meet the formation mode of biofilms, the microcolonies cultured by traditional gas / solid interface have the characteristics of uncontrollability, uncollectability and untransportability. Therefore, it is urgent to find a strategy that combines the controllable culture of microcolonies with the delivery of microcolonies.

[0004] This strategy involving multicellular microcolonies needs to have fine nutrient supply and extracellular matrix accumulation to support the culture of microcolonies, and also needs a firm 3D external structure to maintain the integrity of the colony. However, in the existing research on probiotic delivery, the individualized protective shell designed for bacterial protection or functionalization cannot adapt to the volume expansion of microcolonies, cannot flexibly control the growth of microcolonies, and also cannot maintain the structural integrity of microcolonies. Some studies have shown that hydrogels with three-dimensional networks can encapsulate organisms, allow nutrients to penetrate, and even affect bacterial metabolism, but the cross-linked network of hydrogels can also inhibit the growth and reproduction of bacteria through spatial restriction and mechanical interaction, hindering the development of microcolonies.

[0005] Under the action of continuous external force, the internal stress of stress-relaxing hydrogel will gradually decrease over time, thus deforming the hydrogel and providing space for cell growth. Based on this, viscoelastic hydrogel with ionic crosslinking and covalent crosslinking can adapt to the growth of microcolonies through stress relaxation characteristics. Recent studies have also shown that the adjustable viscoelasticity of three-dimensional hydrogel selectively affects the growth, metabolism and biological behavior of encapsulated microorganisms. However, the existing stress-relaxing hydrogel probiotic delivery system does not have precise spatial adjustability. It mainly involves culturing probiotics first and then loading them into hydrogel microcarriers. The main product of this method is single probiotic, which cannot form a stable and complete microcolony structure in the hydrogel, making it difficult to form a mature and stable biofilm in the intestine.

[0006] To overcome the limitations of traditional probiotic hydrogel delivery methods, current research focuses on designing a "protective armor" for probiotics to improve their survival rate and colonization efficiency, or modifying the surface of probiotics to promote their adhesion to human tissues. However, these physical and chemical strategies are passive and short-term, and cannot fundamentally solve the problem of efficient colonization and controlled growth of probiotics.

[0007] For example, patent document CN120131536A provides a double-network hydrogel loaded with probiotics and a preparation method thereof, but this method cannot form stable and sustained probiotic colonization, the colonization efficiency of probiotics is limited, and the microbial activity is difficult to maintain for a long time, so it cannot efficiently cultivate probiotic microcolonies, and it cannot be used for oral delivery of probiotics.

[0008] In addition, patent document CN118020941A provides a probiotic-hydrogel oral delivery system and a preparation method thereof, which first prepares calcium alginate microcapsules, then mixes with chitosan solution to prepare a probiotic-hydrogel oral delivery system. However, the probiotics cultured by this method also cannot form stable and efficiently colonized microcolonies, and the growth and culture effect of probiotics is limited, which cannot form a biofilm and is difficult to play a therapeutic role of microcolonies.

[0009] Therefore, how to provide an oral drug delivery system suitable for the growth and development of multi-cell microcolonies, so as to significantly improve the growth and metabolism activity and colonization potential of microcolonies on hydrogel microcarriers, better strengthen the intestinal colonization of orally delivered probiotics, and significantly improve the therapeutic effect of probiotic oral drugs, has become a technical problem to be solved. SUMMARY

[0010] The present application is to solve the above technical problems, thereby providing a microcarrier for oral delivery of probiotic microcolonies and a preparation method and application thereof. The technical purpose of the present application is to develop an oral administration system suitable for the culture and growth metabolism regulation of multi-cell microcolonies, significantly improve the growth metabolism activity and colonization potential of microcolonies on the hydrogel microcarrier, and better be used for oral administration to deliver probiotics, and significantly improve the curative effect of probiotic oral drugs.

[0011] In order to achieve the above technical purpose, the technical scheme adopted by the present application is as follows:

[0012] The present application first provides a preparation method of a microcarrier for oral delivery of probiotic microcolonies, comprising the following steps:

[0013] (1) mixing sodium alginate and methacrylic acid hydrochloride to obtain solution A, dissolving 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium hydrochloride in MES solution to obtain solution B; adding solution A and solution B into the sodium alginate solution in batches, stirring and reacting; dialyzing the reaction product to obtain a methacrylated sodium alginate hydrogel solution;

[0014] (2) mixing the hydrogel solution obtained in step (1) with a sodium alginate solution according to a weight ratio of 1:1, then collecting microdroplets in a calcium chloride solution under nitrogen atmosphere by airflow control method, and then crosslinking by light to obtain a double network hydrogel microcapsule;

[0015] (3) adding live probiotics into the double network hydrogel microcapsule obtained in step (2) and dispersing in LB culture medium for culture to obtain microcolonies, which are the microcarrier for oral delivery of probiotic microcolonies.

[0016] This invention presents a multicellular self-organizing "microcolony delivery service" (EMS) system for orally delivering probiotic microcolonies. It successfully constructs a hydrogel microcarrier with adjustable matrix stiffness and viscoelasticity by combining a free radical polymeric covalent cross-linked network with a classic calcium alginate ionic cross-linked dynamic network. This system is named the EMS system. The EMS system developed in this invention supports fine-tuning of nutrient supply during probiotic culture, facilitates microcolony self-organization and extracellular matrix accumulation, and ensures the structural integrity of probiotic microcolonies during oral delivery. Notably, the EMS system of this invention can achieve gene regulation under different spatial constraints, thereby harvesting probiotic microcolonies with greater vitality in growth, metabolism, quorum sensing, stress response, and tissue adhesion. The EMS system exhibits significant gastrointestinal tolerance; when exposed to gastric acid, bile salts, and antibiotics, the survival rate of probiotics within its microcolon is 34,461 times, 12 times, and 5 times higher, respectively, than that of conventional planktonic probiotics. The EMS system also significantly enhanced the colonization capacity of probiotics, showing 89-fold and 52-fold higher bacterial abundance in the cecum and colon, respectively, compared to traditional oral hydrogel-loaded probiotics. Overall, the probiotic microcolony microcarrier provided by this invention not only significantly enhances the ability of oral probiotic preparations to resist the harsh intestinal environment and their inherent colonization potential, but also significantly reduces colitis in mice with just a single oral administration.

[0017] Furthermore, as the exploration results in the embodiments of the present invention show, when different concentration ratios of hydrogel solution and sodium alginate solution are used to prepare microcarriers, they have a significant impact on the growth and colonization of microcolonies. Only under the concentration ratio of the present invention can the obtained microcarriers significantly exert the therapeutic effect of microcolonies and obtain probiotic microcolonies with the best growth and colonization effects.

[0018] Furthermore, the mass ratio of sodium alginate, methacrylate hydrochloride and 4-(4,6-dimethoxy-1,3,5-triazine-2-yl)-4-methylmorpholine hydrochloride in step (1) is 2:0.38:1.268.

[0019] Furthermore, the molecular weight cutoff for dialysis described in step (1) is 8000-14000 Da.

[0020] Furthermore, the concentrations of the hydrogel solution and sodium alginate solution in step (2) are both 0.9%-1.1wt%.

[0021] Furthermore, the flow rate of nitrogen gas in step (2) is 0.4 L / min.

[0022] Furthermore, the concentration of the calcium chloride solution in step (2) is 0.1 mol / L.

[0023] Further, the probiotic bacteria in step (3) is Escherichia coli Nissle 1917, and the concentration of the probiotic bacteria is 2x10 5 ~ 5x10 6 CFU / mL.

[0024] Further, the culture time in step (3) is 2-24h.

[0025] The second object of the present application is to provide a microcarrier of orally delivered probiotic microcolony prepared by the method as described above.

[0026] The third object of the present application is to provide an application of the microcarrier of orally delivered probiotic microcolony as described above in the preparation of a microbial preparation for treating intestinal diseases.

[0027] The beneficial effects of the present application are as follows:

[0028] Inspired by the express mail service (EMS) that can quickly, efficiently, safely and reliably deliver mail, the present application uses the abbreviation "EMS (Express Microcolony Service)" to successfully design a "microcolony express service" (EMS) system with adjustable matrix stiffness and viscoelastic properties to support the culture of microcolonies based on the multi-cell self-organization strategy. The system combines free radical polymerization covalent crosslinking network with classic calcium alginate ionic crosslinking network, and successfully develops a series of double-crosslinked alginate hydrogel networks with stress relaxation properties. The orally delivered probiotic microcolony of the EMS system constructed in the present application can efficiently colonize in the intestine, and the EMS microcarrier preparation has excellent ability to resist harsh external environment and strong colonization potential. Moreover, oral use of EMS can significantly alleviate colitis in mice, and as a probiotic oral preparation, its curative effect is extremely significant. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Fig. 1 is a prokaryotic transcriptional sequencing sequence of bacterial suspension and microcolony; a) schematic diagram of "microcolony express service" (EMS) microcarrier system, which supports oral microcolony to form probiotic biofilm; b) schematic diagram of prokaryotic transcriptional sequencing; c) principal coordinate analysis between microcolony group and single bacterial group; d) volcano plot of differentially expressed genes (DEGs); e) KEGG enrichment analysis of microcolony group and single bacterial group; f) expression heat map of biofilm formation related genes; g) representative fluorescence image of colon (6 hours after gavage); h) IVIS light radiation efficiency analysis shows bacterial adhesion in colon at 3 hours, 6 hours, 12 hours and 24 hours after gavage; i) representative confocal image of intestinal mucosa with bacterial adhesion, scale bar 400 microns.

[0030] Figure 2 Characterization of stress-relaxing hydrogels and preparation of EMS microcarriers; a) Schematic diagram of the design of double-network hydrogels; b) Initial storage modulus evaluation of hydrogels under different crosslinking conditions (ionic crosslinking, covalent crosslinking and double crosslinking); c) Stress relaxation curves of hydrogels with different alginate and alginate ratios; d) Relaxation half-life T1 / 2 of AlgMA hydrogels; e) Relative change of storage modulus (G’) of hydrogels when swelling in LB medium, expressed as G’ / G’0. f) Weight change of hydrogels after swelling in LB medium; g) Weight change of hydrogels after swelling in AGF and ASF; h) Weight change of hydrogels after swelling in ACF; i) Schematic diagram of the preparation of EMS; j) Optical images of hydrogel microcarriers; scale bar 800 microns; k) Size distribution of microcarriers; l) Representative images of microcolonies after 2 hours (I), 4 hours (II), 6 hours (III) and 8 hours (IV) of incubation in microcarriers, scale bar 200 microns; m) Representative scanning electron microscopy images of microcarrier system (MS, blank hydrogel microcapsules), primary microcarrier system (PMS, dispersed single bacteria encapsulated in hydrogel) and EMS microcarrier system (microcolonies encapsulated in hydrogel).

[0031] Figure 3 Gene expression and biological behavior of microcolonies in microcarriers; a) mRNA expression level of sdiA, a quorum sensing related gene, in different hydrogel microcolonies; b) mRNA expression level of csgA, a microcolony adhesion related gene, in different hydrogel microcolonies; c) mRNA expression level of adrA, a microcolony exopolysaccharide related gene, in different hydrogel microcolonies; d) mRNA expression level of iraM, a stress related gene, in different hydrogel microcolonies; e) Quantitative analysis of bacteria in different hydrogel microdroplets; f) Growth curve of bacteria after release from different hydrogel microcarriers; g) mRNA level of colonization related genes in different hydrogel microcolonies; h) Principal coordinate analysis of bacterial transcriptome of 50% EMS group and single bacteria group; i) Volcano plot of DEGs of the two groups; j) Heatmap of differential transcription genes of the two groups (important up-regulated genes of 50% EMS group are listed); k) Up-regulated pathways of 50% EMS group according to KEGG enrichment analysis; l) Down-regulated pathways of 50% EMS group according to KEGG enrichment analysis.

[0032] Figure 4 Formation and release of microcolonies in hydrogel microcarriers; a) Representative images show the formation of microcolonies in different initial bacterial concentrations (2 x 10 5 , 10 6 or 5 x 10 6a) Representative images of microcolonies in ACFs at different time points (0 hours, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, and 24 hours) and at different initial bacterial concentrations (CFU / mL) and culture time (0 hours, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, and 24 hours); b) Diameter size analysis of microcolonies; c) Maximum diameter of microcolonies in hydrogels at different initial bacterial concentrations; d) Changes in total bacterial number in microcarriers; e) Live / dead staining of microcolonies in hydrogel microcarriers; f) Representative images of the expansion and degradation process of hydrogel microcarriers in ACFs and the release of microcolonies; the significance between two groups was calculated using unpaired t-test.

[0033] Figure 5 To evaluate the ability of microcolonies to resist harsh external environments and colonization potential; a) Schematic of microcolonies resisting harsh external environments; b) Field test showing bacterial resistance to AGF, bile acids, and antibiotics; c) Quantitative analysis of surviving bacteria after AGF treatment; d) Quantitative analysis of surviving bacteria after bile acid treatment; e) Quantitative analysis of surviving bacteria after antibiotic treatment; f) Live / dead staining of cells in PMS after antibiotic treatment; g) Live / dead staining of cells in EMS after antibiotic treatment; h) Quantitative analysis of enterocytes adhering to bacteria; i) Quantitative analysis of EPS; j) Crystal violet staining of biofilm representative figure, analyzing biofilm formation potential of PMS group, EMS group, PMS-D (dispersed) group, and EMS-D group (‘dispersed’ means cells are dispersed and the extracellular matrix is washed away); k) Quantitative analysis of biofilm formation by measuring the absorbance of crystal violet at 590 nanometers; l) Time axis of mouse colonization model (n = 5); m) Quantitative analysis of fecal EcN abundance within three days after gavage; n) Quantitative analysis of small intestine, cecum, and colon fecal EcN abundance after 3 days of gavage, the significance between two groups was calculated using two-tailed Student's t-test or Mann Whitney u-test; ns means no significant difference.

[0034] Figure 6for in vivo colonization analysis of EMS; a) experimental design DSS-induced colitis, all mice were randomly divided into 7 groups (5 mice per group): healthy control group, DSS group, DSS+5-ASA group (positive control group), DSS+EMS group (oral administration of microcarriers containing EcN microcolonies), DSS+PMS group (oral administration of microcarriers containing EcN), DSS+EcN group (oral administration of EcN suspension), DSS+MS group (oral administration of blank microcarriers); b) changes in body weight of mice at the end of modeling (day 9); c) daily body weight changes of mice; d) analysis of disease activity index (DAI) scores in each group; e) analysis of colon length in each group; f) macroscopic appearance of the colon; g) representative images of hematoxylin and eosin (H&E) stained colon tissue sections; h) quantification of intestinal EcN abundance by qPCR; i) mRNA analysis of ZO-1 and Occludin in colon tissue; j) mRNA analysis of IFN-γ, IL-1β, IL-6, TNF-alpha and MCP-1 in colon tissue; k) LDA value histogram of intestinal flora differences between DSS group and EMS group; l) functional annotation cluster heatmap showing the difference in intestinal microbiota between DSS group and EMS group; m) schematic diagram of the colonization process and beneficial effects of EcN in EMS; the significance of differences between two groups was calculated by unpaired t test or Mann-Whitney U test; ns indicates no significant difference.

[0035] Figure 7 Heatmap of the differential expression pattern of stress-related genes.

[0036] Figure 8 For colon adhesion evaluation; a) IVIS images of mice colon at 3h, 6h, 12h and 24h after gavage; b) colon bacterial adhesion experiment; c) IVIS images of colon bacterial adhesion; d) colon radiation efficiency analysis; data are presented as mean ± standard deviation (n = 3 mice), the significance of differences between two groups was calculated by two-tailed Student's t test; source data are provided in the form of source data file.

[0037] Figure 9 Representative microscope images of microcarriers and microcolonies after 4h of incubation, scale bar (right) is 250 microns; this experiment was repeated three times.

[0038] Figure 10 mRNA expression levels of bacterial genes in single bacteria group and 50% EMS group; a) mRNA levels of quorum sensing related genes trpE and fadD; b) mRNA levels of biofilm formation related genes csrA and tssC; data are presented as mean ± standard deviation (n = 3); source data are provided in the form of source data file.

[0039] Figure 11For the inter-analysis between the 50% EMS group and the microcolony group; a) Principal coordinate analysis; b) Volcano plot of differentially expressed genes; c) Upregulated pathways in KEGG enrichment analysis; d) Downregulated pathways in KEGG enrichment analysis.

[0040] Figure 12 For representative images of microcolony changes under different initial bacterial concentrations (2 x 10 5 , 10 6 or 5 x 10 6 CFU / mL) and culture time (0 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h), scale bar 200 μm; this experiment was independently repeated three times.

[0041] Figure 13 For live / dead analysis of microcolonies; a) Live / dead staining of microcolonies in hydrogel microcarriers; b) The dead / live ratio of microcolonies is shown according to the staining results, scale bar 250 μm; data are presented as mean ± standard deviation (n = 5 samples); source data are provided in the form of a source data file.

[0042] Figure 14 For bacterial proliferation curves.

[0043] Figure 15 For autoaggregation analysis; a) Representative images of autoaggregation assays; b) Autoaggregation was analyzed by OD600 absorbance; data are presented as mean ± standard deviation (n = 3 samples); raw data are provided in the form of a "source data" file.

[0044] Figure 16 For spot test showing the adhesion ability of bacteria to intestinal epithelial cells.

[0045] Figure 17 For representative confocal images of biofilm thickness, scale bar 200 μm.

[0046] Figure 18 For in vivo bacterial colonization analysis; a) Site testing shows the amount of E. coli (EcN) in the small intestine (SI), caecum and colon (total of 5 samples); b) Representative fluorescence images of frozen colon sections showing E. coli colonization in the colon; scale bar 200 μm; this experiment was independently repeated three times.

[0047] Figure 19 For representative pictures showing the appearance of diarrhea and fecal blood in the anus of mice in a mouse model of colitis induced by selenium disulfide.

[0048] Figure 20 For H&E staining images of the main organs of mice treated differently; scale, 200 μm.

[0049] Figure 21 16S rRNA sequencing was performed on fecal samples from the DSS and EMS groups before DSS treatment; a) Alpha diversity analysis: Chao index showed differences in bacterial abundance, and Shannon index showed differences in bacterial diversity; data are presented as mean ± standard deviation (5 mice per group); the significance of differences between the two groups was calculated using a two-tailed Student's t-test, with ns indicating no significant difference; b) Cluster analysis; c) Simperer difference contribution plot showed differences between groups at the phylum level; d) Histogram of relative abundance of PICRUSt2 for each sample's functional annotation; the significance of differences between the two groups was calculated using an unpaired t-test, with ns indicating no significant difference.

[0050] Figure 22 16S rRNA sequencing was performed on fecal samples from the DSS and EMS groups after DSS treatment; a) Venn diagram based on ASV; b) Shannon and Simpson index analysis for α diversity; data are presented as mean ± standard deviation (5 mice per group); two-tailed Student's t-test was used to calculate the significance of differences between the two groups, ns indicates no significant difference; c) 3D principal coordinate analysis showed β diversity; unpaired t-test was used to calculate the significance of differences between the two groups, ns indicates no significant difference; raw data are provided in Source Data file format.

[0051] Figure 23 For bacterial abundance analysis; a) Bacterial abundance histogram displayed at the phylum level; b) Simper analysis showing the top 10 species that contributed the most to population differences.

[0052] Figure 24 This is a tree diagram based on ASV.

[0053] Figure 25 The results of microbial colony cultivation in Comparative Example 3 are shown below: A) Gelatin-based dual-network hydrogel microcarriers; B) Hyaluronic acid-based dual-network hydrogel microcarriers; C) Sodium alginate-based dual-network hydrogel microcarriers used in this study. Detailed Implementation

[0054] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is described in detail below with reference to embodiments. It should be noted that the following embodiments are for explanation and illustration only and are not intended to limit the invention. Non-essential improvements and adjustments made by those skilled in the art based on the above description are still within the scope of protection of this invention.

[0055] Example 1

[0056] I. Experimental Materials and Methods

[0057] 1. Bacterial culture

[0058] Bacterial strain Escherichia coli Nissle 1917 (EcN, BioSsential) was inoculated in LB medium for culture, and the EcN strain expressing red fluorescent protein (REcN, Shanghai Microorganism Culture Collection Center) was cultured in LB liquid medium containing 50 pg / mL kanamycin.

[0059] Bacterial recovery: bacteria were inoculated into 3 mL of LB liquid medium and then cultured overnight in a 37 °C incubator shaker. Then 500 pL of bacterial suspension was inoculated again into 5 mL of LB medium and cultured until the OD600 reached 0.50. The bacterial suspension was centrifuged at 3000 rpm for 5 minutes to collect the bacteria for subsequent experiments.

[0060] To induce the expression of red fluorescent protein in REcN, 1 mL of bacterial suspension was inoculated into 100 mL of liquid medium and cultured until the OD600 reached 0.50. Then 1 mL of 100 mM isopropyl β-D-thiogalactopyranoside solution was added and the culture was continued for 4 hours to induce the red fluorescent protein, and the bacteria were collected by centrifugation for subsequent experiments.

[0061] 2. Prokaryotic transcriptome analysis

[0062] (1) Sample preparation: bacterial suspension was inoculated into 5 mL of liquid medium until the OD600 reached 0.50, then centrifuged at 3000 rpm to collect the bacterial precipitate. To collect bacterial colonies from LB agar medium, the prepared bacterial suspension was evenly spread on the culture dish and placed in a 37 °C incubator overnight. The bacterial colonies were scraped off the surface of the LB agar medium with a sterile spatula.

[0063] (2) Prokaryotic transcriptome sequencing process:

[0064] 1) Total RNA was extracted from bacteria using Trizol reagent;

[0065] 2) Total bacterial RNA quality detection and rRNA removal;

[0066] 3) The RNA was fragmented into 200-300 base fragments;

[0067] 4) Synthesis of cDNA strand 1 by random primers and reverse transcriptase, and establishment of strand-specific library after synthesis of second strand;

[0068] 5) Purified double-stranded cDNA was then subjected to end repair, A tail addition and adapter ligation. AMPure XP magnetic beads were used for fragment size selection (300-400 bases);

[0069] 6) PCR amplification using a thermostable DNA polymerase, which involves cyclically denaturing, annealing and extending DNA strands to exponentially increase the number of target DNA fragments to obtain cDNA library;

[0070] 7) Use Agilent 2100 to detect the insert size of cDNA library, and accurately quantify the effective concentration of the library by using fluorescence to detect the amplification of specific sequences, ensuring that the concentration is more than 2nM for subsequent sequencing;

[0071] 8) Sequencing on the Illumina platform;

[0072] 9) Data analysis: first filter the raw data, then compare with the reference EcN genome, calculate gene expression, and finally perform differential expression analysis, enrichment analysis and clustering analysis.

[0073] 3. Colon adhesion evaluation

[0074] (1) In vitro experiment: fresh mouse colon was taken and the two ends of the colon were tied with surgical suture. Bacterial suspension and microcolony suspension containing the same number of bacteria were prepared and introduced using a syringe. After one hour of culture, the unattached bacteria were gently washed away with PBS, and then IVIS imaging was performed.

[0075] (2) In vivo experiment: 8-week-old C57BL / 6 male mice were purchased, 3 in each group, fasted for 24 hours, and the hair on the abdominal skin was completely removed using depilatory cream, then 200 microliters of bacterial suspension or microcolony suspension was given by oral gavage. Three hours, 6 hours, 12 hours and 24 hours after oral gavage, the bacterial adhesion in the colon was measured by fluorescence quantification.

[0076] 4. Preparation of methacrylated sodium alginate hydrogel (AlgMA)

[0077] Dissolve 2 g sodium alginate in 200 ml 10 mM / L 2-morpholinoethanesulfonic acid buffer (MES, Arlan, China); dissolve 380 mg 2-aminoethyl methacrylate hydrochloride (Arlan, China) in 6 ml MES solution to obtain solution A; dissolve 1.268 g 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium hydrochloride hydrate (Arlan, China) in 6 ml MES solution to obtain solution B. Solution A and solution B are each divided into three parts, which are added to the sodium alginate solution (Sigma Aldrich, USA) every 30 minutes, and all solutions are stirred overnight. The next day, 2 g sodium chloride (Arlan, China) is added to the solution and stirred until completely dissolved. Then, all solutions are placed in a dialysis bag (molecular weight cut-off 8000-14000 Da, Solbo Biological, China) for dialysis (3 days). Finally, all liquids are transferred and freeze-dried using a freeze dryer.

[0078] 5. Preparation of hydrogels for rheological analysis

[0079] Prepare 1% sodium alginate solution and 1% AlgMA solution, respectively. Then mix the two solutions at different volume ratios, including: 0% AlgMA group (containing 100% sodium alginate), 25% AlgMA group (containing 75% sodium alginate), 50% AlgMA group (containing 50% sodium alginate), 75% AlgMA group (containing 25% sodium alginate), 100% AlgMA group (containing 0% sodium alginate). Use a circular mold with a diameter of 20 mm to prepare the hydrogels. Add 600 μl of hydrogel solution to the mold, then add 300 μl of calcium chloride solution with a concentration of 100 mM / L to the hydrogel for ionic crosslinking. Use a 365 nm light source for irradiation to achieve covalent crosslinking. Three hydrogel groups are obtained by ionic crosslinking, covalent crosslinking or double crosslinking, respectively, for rheological testing.

[0080] 6. Rheological analysis

[0081] The rheological properties of the hydrogels were measured by a stainless steel parallel plate geometry (P20 TiL, 20 mm diameter) using an AR-G2 rheometer (TA Instruments). Samples with different ratios were prepared for storage modulus, loss modulus and stress relaxation tests. A constant shear strain of 15% was applied to the hydrogels, and then the change in stress relaxation was measured within 10000 seconds. The time scale required for stress relaxation to recover to half of the initial level was also analyzed to quantify the stress relaxation rate. In addition, dynamic measurements include: (1) analysis of the change in storage modulus under different crosslinking conditions (covalent crosslinking, ionic crosslinking and double crosslinking); (2) stress relaxation change under different AlgMA ratios, and calculation of the half-life (T1 / 2); (3) incubation of the gels in LB medium in a shaking bed, and detection of the time-modulus curve at consecutive time points.

[0082] 7. Swelling and degradation analysis

[0083] Swelling and degradation monitoring was performed in LB medium. AlgMA hydrogels of 0%, 25%, 50%, 75% and 100% were double crosslinked, and each gel was weighed before being immersed in LB medium. The gels were transferred from the liquid using a filter mesh, and then the liquid was quickly absorbed from both sides of the gel using blotting paper. Subsequently, the gels were weighed using a balance and the measured values were recorded. The weight of the hydrogels was measured at 30 minutes, 1 hour, 3 hours, 6 hours and 12 hours, respectively. Swelling and degradation monitoring was performed in artificial digestive fluids. AlgMA hydrogels of 0%, 25%, 50%, 75% and 100% were immersed in AGF (2 hours), ASF (4 hours) and ACF (continuous monitoring), respectively, and the hydrogels were weighed periodically. The swelling and degradation of the hydrogels were analyzed according to the weight changes.

[0084] 8. Preparation of probiotic microcarriers

[0085] Live bacteria in the logarithmic growth phase (OD600=0.5) were washed and resuspended. These bacteria were added to the pre-prepared hydrogel solution (final bacterial concentrations of 2x10 5 , 10 6 and 5x10 6 CFU / mL, respectively) and mixed uniformly by vortexing. A gas-shearing microfluidic method was used to prepare the probiotic microcarriers. Specifically, the bacterial-containing hydrogel solution was injected into the inner shaft (inner diameter 0.31 mm, outer diameter 0.82 mm) of a double-axial needle at a constant speed (2 mL / min) using a micro-pump. Nitrogen gas (0.4 L / min) from the outer shaft sheared the solution into uniform droplets by shear force. These droplets were collected in a 10 cm diameter dish containing a 0.1 M calcium chloride aqueous solution, and then subjected to a crosslinking treatment for about 1 minute under a 365 nm light source to obtain double crosslinked hydrogels. Finally, the hydrogel microcarriers were collected and quickly rinsed twice with deionized water for subsequent experiments.

[0086] 9. Morphological characterization of microcarriers

[0087] The bacterial-containing hydrogel microcarriers were uniformly dispersed in LB medium and incubated in an incubator at 37°C. The bacteria in the microcarriers were stained (live bacteria were stained with green fluorescence), and the change in microcolony size was observed under a confocal microscope (Zeiss, Germany). In addition, after freeze-drying and gold spraying (10 mA, 45 s), the microcarriers were photographed using a scanning electron microscope (Thermo Fisher Scientific, USA).

[0088] 10. mRNA expression analysis of bacteria

[0089] Bacterial suspension in exponential growth phase (microcolonies in microcarriers obtained by degradation of hydrogels) was centrifuged at 3000 rpm, and the bacterial pellet was washed and centrifuged again. Total RNA was extracted using Trizol reagent, and other qPCR procedures were the same as before. The primer sequences used in the experiment were as follows:

[0090] 16s forward: AGGCCTTCGGGTTGTAAAGT, reverse: GTTAGCCGGTGCTTCTTCTG; adrA forward: CTGGCGGAACATAAACGCAG, reverse: ATGCCGCCGACAGTTATCAA;

[0091] csgD forward: AACGTGTTGTCAATGGGTTGC, reverse: AGGGCTGATTCCGTGCTGT;

[0092] csgA forward: GCGGTAACTCTGCACTTGCTC, reverse: ATCTGAGCCCTGACCAACATC;

[0093] flhC forward: GCCCACAAGCAGAAGAAGG, reverse: GGGATGGCGGTTGACATAA;

[0094] csrA forward: GATTGGGGATGAGGTCACCG, reverse: CAGAAACTTCCTTCGGGGCA;

[0095] luxS forward: CAATCACCGTGTTCGATCTGC, reverse: CGCATAAAACCAGCAAACAGG;

[0096] iraM forward: TTTCTCCCTCCTGGCAGTAT, reverse: CCTTGTTGAATGGTGCGATGT;

[0097] rpoS forward: CGAAAAAGCGTTGCTGGACA, reverse: GCTCGAACAGCCATTTGACG; sdiA forward: GATGACTTATTCAGCGAAGCACA, reverse: GCAACGGGAAAAGGACAAAA.

[0098] 11、Bacterial proliferation activity

[0099] A fresh bacterial suspension in the exponential growth phase (microcolonies obtained within microcarriers via hydrogel degradation) was centrifuged at 3000 rpm. The bacterial precipitate was resuspended and diluted to an OD600 value of 0.2. Then, 100 μL of the diluted bacterial suspension was dispensed into each well, and the well opening was covered with a breathable sealing membrane. OD600 absorbance was measured every 30 minutes using a microplate reader to monitor microbial growth.

[0100] 12. Optimized culture of microcolonies

[0101] To obtain more vigorous microcolonies, we investigated the effects of initial bacterial concentration and culture time on the density, size, and survival rate of microcolonies within microcarriers. Initial bacterial concentrations of 2 × 10⁻⁶ were used. 5 10 6 and 5×10 6 Microcarriers were prepared using a CFU / mL hydrogel solution, and then microcolony cultured in LB medium. Microcolony was stained at 2, 4, 6, 8, 12, and 24 hours, and changes in colony size were observed. Bacteria in the microcarriers were quantitatively detected using OD600 absorbance after hydrogel degradation. LIVE / DEAD was used. TM BacLight TM Bacterial viability assay kits (Thermo Fisher Scientific) were used to stain the bacteria. Microcarriers were aspirated from the culture medium, washed three times rapidly with PBS to remove residual liquid, and then thoroughly mixed with LIVE / DEAD working solution. After incubation in the dark for 15 minutes, bacterial fluorescence was observed under a confocal microscope (Carl Zeiss, Germany). Live bacteria showed green fluorescence, while dead bacteria showed red fluorescence. Bacterial viability within the microcolonies was observed using fluorescence microscopy. The ratio of dead to live cells was calculated based on fluorescence intensity.

[0102] 13. Environmental resistance assessment

[0103] Pre-cultured microcarriers were treated with simulated gastric fluid (1 hour), bile salt solution (30 mg / mL, 4 hours), and antibiotics (1% penicillin-streptomycin solution, 4 hours), respectively. The microcarriers were washed three times to remove residual liquid, then degraded with 100 mmol sodium citrate aqueous solution, and finally collected by centrifugation. Bacterial suspensions were diluted 10-fold in bacterial culture media and dropped onto LB agar plates at 10 μL per group. After 24 hours of incubation, bacterial survival under environmental challenge was assessed. Bacterial suspensions containing the same number of bacteria and hydrogel microcarriers (encapsulating uncultured and dispersed bacteria) containing the same number of bacteria were used as controls.

[0104] 14. Bacterial adhesion assessment

[0105] Caco-2 cells were cultured in standard 24-well cell culture plates at 37°C in a 5% carbon dioxide incubator. After removal of non-attached cells, approximately 10 7 CFU / mL of EcN in log phase of growth were added to each well and incubated for 3 hours. The wells were then washed twice with sterile PBS to remove more loosely adhered bacteria and the Caco-2 cells were lysed using 0.1% Triton X-100. The lysate from each well was subjected to a series of gradient dilutions and spotted onto LB agar medium. Adhesion of individual bacteria and microcolonies was assessed by colony counting, respectively.

[0106] 15. Bacterial auto-aggregation assessment

[0107] Bacteria were collected from microcarriers suspension or microcolonies and resuspended. The OD600 absorbance of each group was normalized. Four milliliters of each group were placed in test tubes at 37°C for 18 hours. At 3, 6, 9, 12, and 18 hours, static culture medium from the test tubes and resuspended medium from the middle of the test tubes were removed to assess the OD600 absorbance.

[0108] 16. Bacterial biofilm formation

[0109] One hundred microliters of bacterial suspension (10 7 live bacteria per milliliter) were inoculated into each petri dish, respectively. After 24 hours of incubation, non-attached bacteria were removed by gentle washing 2 to 3 times. The petri dishes were then dried and fixed at 60°C for 30 minutes and 0.1% crystal violet was added. Next, each petri dish was gently washed and then observed under a microscope. The plates were dried and destained with 33% glacial acetic acid for quantitative analysis of biofilm. The OD595 absorbance was measured using a microplate reader to quantify the biofilm content. Biofilm thickness was assessed by confocal microscopy. FilmTracer TM SYPRO TM Ruby biofilm matrix dye (Thermo Fisher) was used for biofilm visualization. The staining solution was gently added to avoid damage to the biofilm. The samples were observed after incubation at room temperature in the dark.

[0110] 17. EPS content assessment

[0111] Sterile glass slides were placed in a 12-well plate and inoculated with bacteria (10 7CFU / mL), and incubated in an incubator for 24 hours. The slides were removed and washed thoroughly with 500 μL of 5% phenol solution. Concentrated sulfuric acid was then added and mixed by shaking. The OD value at 490 nm was measured to quantify the amount of biofilm in the EPS.

[0112] 18. In vivo colonization

[0113] 6-8 weeks old C57BL / 6 male mice were treated with kanamycin (50 μg / mL) dissolved in drinking water for one week. Two days later, the mice were orally administered with microcarriers loaded with EcN microcolonies, and oral EcN bacterial suspension was used as a control group. The feces of each mouse were collected daily for colonization counting. On the fourth day, all mice were sacrificed, and all intestinal tissues (including colon, small intestine, and cecum) were isolated for bacterial colonization assessment.

[0114] 19. Spot quantification of bacteria

[0115] Thirty milligrams of feces from each mouse were ground and mixed into 500 μL of LB medium, and the supernatant was obtained and diluted by 10-fold gradient. The gradient-diluted liquid was sequentially added to LB agar medium containing kanamycin, and then colony counting was performed after 24 hours of incubation. For bacterial colonization on tissues, 50 milligrams of intestinal tissue (small intestine, cecum, or colon) was ground with 400 microliters of LB medium in a tissue grinder (60 Hz, 120 seconds). The supernatant was obtained and diluted with LB medium, and then sequentially added to LB agar medium. Colony counting was performed after 24 hours of incubation.

[0116] 20. Acute colitis model

[0117] 6-8 weeks old C57BL / 6 male mice were selected, and all mice were randomly divided into 7 groups: 1) healthy control group; 2) DSS group; 3) DSS + 5-ASA group (positive control group); 4) DSS + EMS group (oral administration of microcarriers containing EcN microcolonies); 5) DSS + PMS group (oral administration of microcarriers containing EcN); 6) DSS + EcN group (oral administration of EcN bacterial suspension); 7) DSS + MS group (oral administration of blank microcarriers). On the third day of DSS treatment, the mice were orally administered with 20 milligrams of microcarriers. The mice were sacrificed after stopping drinking DSS for two to four days. Body weight and disease activity index were continuously measured, feces were collected for colony evaluation, colon length was measured after dissection, and mRNA detection and H&E staining were performed. The above experiment was approved by the Animal Care Committee of the School of Medicine, Shanghai Jiao Tong University (Approval No.: B-2021-009).

[0118] 21. 16S rRNA sequencing

[0119] All fecal samples underwent DNA extraction, PCR amplification, product purification, library preparation and examination, and finally NovaSeq sequencing. The raw data were processed to generate ASV data, and each ASV sequence was annotated with corresponding species information and species-based abundance distribution. Subsequently, sample diversity analysis, differences in microcolony structure between different groups, and significance tests were performed. Furthermore, the function of the microbiome was predicted based on a functional database.

[0120] 22. Statistical Analysis

[0121] Statistical analysis was primarily performed using GraphPadPrism 8.4. Quantitative data were presented as mean ± standard deviation (SD), and categorical data were presented as percentages. Unpaired t-tests or Mann-Whitney U tests were used for statistical analysis. p < 0.05 was considered statistically significant.

[0122] II. Experimental Results and Discussion

[0123] 1. Prokaryotic transcriptome sequencing of single bacteria and multicellular microcolonies

[0124] The transformation from a single bacterium to a bacterial microcolony involves a cascade of coordinated regulatory responses triggered by environmental, inter-bacterial, or intracellular signals, and various changes in gene expression are essential for the formation of complex biofilm structures and unique physiological characteristics. This invention uses the probiotic *Escherichia coli* Nissle 1917 (EcN) for experiments. First, differentially expressed genes (DEGs) in single bacteria and multicellular microcolonies on agar plates were studied using prokaryotic transcriptomics. For example... Figure 1 As shown in Figure b, we collected bacterial suspensions from Luria-Bertani (LB) medium and bacterial microcolonies on LB agar for prokaryotic transcriptome sequencing analysis. Principal component analysis (PCA) revealed differences in bacterial transcriptome structure under the two culture conditions. Figure 1 (c) The volcano plot shows the distribution of DEGs at different fold changes and p-values. Figure 1 (d). We found that gene expression changes were nearly half that of single bacteria and multicellular microcolonies cultured from agar plates. Compared to single bacteria, 991 genes were downregulated and 1129 genes were upregulated in multicellular microcolonies.

[0125] Next, enrichment analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) was performed. Figure 1In a study (e), gene expression was found to be upregulated in multicellular microbiota during two important pathways in cell biology: biofilm formation (tssC, tssB, tssK, etc.) and quorum sensing (ydcU, livH, secG, etc.), whereas this upregulation was not observed in individual bacterial groups. Furthermore, some amino acid and carbohydrate metabolism processes were also upregulated in multicellular microbiota. Figure 1 (e). We propose that this change is due to the upregulation of quorum sensing, a density-dependent form of intercellular communication that enables microorganisms to regulate gene expression related to material and energy metabolism. Activation of quorum sensing promotes metabolic pathways associated with biofilm formation, which may involve enhanced synthesis of extracellular polysaccharides (EPS) to protect microcolony, thereby altering bacterial energy and carbon source metabolic pathways.

[0126] mRNA expression of genes related to biofilm formation, as follows: Figure 1 As shown in f, gene clusters encoding bacterial cilia, fim-related genes (fimA, fimI, fimC, fimD, fimG) (which encode type I flagella and contribute to the formation of antibiotic-resistant capsules), and other genes contributing to biofilm formation and organelle adhesion (such as the csg operator) were significantly upregulated in multicellular microcolon groups compared to single bacteria. EcpC and ecpB, encoding common E. coli cilia, and ecpR, encoding a transcriptional regulator of ciliary synthesis, were also significantly upregulated. These findings suggest that EcN exhibits superior adhesion and colonization capabilities in the microcolon group compared to the single bacterial group.

[0127] Furthermore, bacterial resistance greatly promotes colonization and biofilm formation by enabling bacteria to resist external challenges such as high temperature, osmotic pressure, and acidic environments. Figure 7 The analysis presented revealed differential expression patterns of stress-related genes, all of which were significantly upregulated in multicellular populations, including bhsA, pspA, pspC, rpoE, rseA, rpoS, as well as heat shock proteins (htpG, hspQ, htpX, ibpAB) and cold shock proteins (cspA). Notably, the mRNA expression of acid resistance-related genes (involving glutamate decarboxylases (gadA, gadB, gadC), arginine decarboxylase (adiA), and acid resistance chaperone proteins (hdeBA, hdeD)) was higher in the multicellular colony group than in the single bacterial group. Acid resistance in probiotics is crucial for probiotic therapy because orally administered probiotics must be able to withstand the strong bactericidal effects of gastric juices before reaching the intestines. In conclusion, these findings suggest that bacteria in a colony growth pattern have a greater colonization potential than individuals in bacterial suspensions.

[0128] To further verify, the bacterial suspension and microcolony suspension were collected for oral gavage. The bacteria entered the colon cavity about 2-3 hours after administration, so the adhesion of the bacteria was measured by fluorescence quantification at 3 hours, 6 hours, 12 hours and 24 hours after oral gavage Figure 8 The images from the in vivo imaging system (IVIS) showed that the adhesion rate of the microcolony group was significantly higher than that of the single bacteria group within 12 hours, and the difference became insignificant after 24 hours Figure 1 This indicates that the microcolony has good adhesion to the mucosa in the short term, but this retention is short-lived due to intestinal peristalsis and fecal pressure, which may be due to the larger physical size of the bacterial colonies in the plate medium.

[0129] In addition, the bacterial suspension and microcolony were injected into the colon respectively to verify the direct adhesion ability Figure 8 The IVIS images showed that the adhesion rate of the microcolony group was significantly higher than that of the single bacteria group after 1 hour of culture Figure 8 Finally, confocal microscopy was applied to perform three-dimensional scanning of the mucosal surface. Figure 1 As shown in Fig. j, the adhesion mode of the single bacterial colony to the intestinal mucosa is dispersed, while the adhesion of the multi-cell microcolony from the LB agar plate is relatively concentrated and has a higher adhesion rate. However, there are many difficulties in the culture and oral administration of microcolony: (1) traditional two-dimensional plate culture is inefficient, not fine-tunable, and not suitable for oral administration; (2) the accumulation of extracellular matrix and the fine distribution of internal nutrients during colony development affect the overall colonization efficiency; (3) maintaining the integrity of the colony in the digestive tract requires a three-dimensional external scaffold. Therefore, the purpose of the present application is to develop a system suitable for the growth and development of multi-cell microcolony and oral administration.

[0130] 2. Optimization of stress relaxation hydrogel and preparation of EMS microcarrier system

[0131] The 3D network hydrogel can encapsulate microorganisms, and at the same time, the diffusion of nutrients can be realized, and the hydrogel with stress relaxation characteristics can be deformed under the action of the force generated by bacterial proliferation, thereby providing space for the growth of microbial community. However, it is still unclear how the transcriptome and biological behavior of bacteria change in the 3D hydrogel matrix.

[0132] In this application, a covalently cross-linked network (methylacrylated sodium alginate hydrogel, AlgMA) is introduced into the classic dynamic cross-linked network of calcium cross-linked sodium alginate hydrogel to obtain a 3D hydrogel culture system with adjustable matrix stiffness and stress relaxation characteristics Figure 2In the middle a). A series of hydrogels with different ratios of sodium alginate to AlgMA were designed and divided into five groups according to the volume percentage of AlgMA added: 0%, 25%, 50%, 75%, and 100%. Rheological studies of these hydrogels showed that their initial moduli were different under different crosslinking conditions Figure 2 In the middle b). When only optical crosslinking was used, the average storage modulus of the 0%, 25%, 50%, 75%, and 100% groups showed an upward trend, 0.8, 4.8, 86.5, 201.2, and 469.1 Pa, respectively. The average storage modulus of the calcium ion crosslinking alone showed a downward trend, 5063.9, 3974.9, 2974.8, 1912.2, and 1025.8 Pa, respectively. The average storage modulus of each group after double crosslinking was 4726.5, 4736.7, 3826.6, 2956.4, and 2040.3 Pa, respectively. These data show that dynamic crosslinking by calcium ions provides better mechanical properties for the hydrogel. In addition, the key property of the above series of double network hydrogels, stress relaxation, also shows a gradient change with the adjustment of the components, that is, the higher the proportion of covalent network, the worse the stress relaxation property Figure 2 In the middle c, d). In addition, the half-life (τ1 / 2), which represents the parameter required to reach half of the maximum relaxation stress, is 8.6 seconds, 39.1 seconds, 108.0 seconds, 290.9 seconds, and 388.1 seconds, respectively. These rheological parameters show that the lower the content of AlgMA in the double network hydrogel, the faster the stress relaxation rate of the hydrogel.

[0133] Considering that the synthetic hydrogel designed for probiotic cultivation and oral administration must maintain its stability during LB cultivation and gastrointestinal challenges until it reaches the colon, we conducted a series of swelling-degradation tests in LB medium and artificial digestive juice. First, we measured the change in storage modulus of the hydrogels (0%, 25%, 50%, 75%, and 100% AlgMA groups) in LB medium Figure 2 In the middle e), we found that the 100% AlgMA group maintained the highest storage modulus after 12 hours of swelling. At the same time, the weight change of the hydrogels after 3 hours of swelling reached 155.56%, 123.64%, 114.78%, 112.07%, and 107.66% of the initial mass, showing a gradually decreasing trend Figure 2 In the middle f), among them, the 0% AlgMA hydrogel significantly decreased in weight after reaching the peak, indicating that it was in a state of degradation thereafter, while the other groups did not show obvious degradation due to the presence of covalent crosslinking network. Although the storage modulus decreased significantly, all hydrogel groups maintained a relatively stable state during the swelling-degradation process except for the 0% AlgMA group.

[0134] Subsequently, we systematically evaluated the swelling and degradation of the hydrogel microcarriers in different artificial digestive solutions for each group. Figure 2 (g). AlgMA is relatively stable in acidic environments, therefore none of the five groups underwent degradation in simulated gastric fluid (AGF). However, the 0% AlgMA hydrogel microcarriers rapidly degraded in simulated intestinal fluid (ASF), indicating that 0% AlgMA is unsuitable for this oral system. The other groups swelled to varying degrees in ASF due to their stable covalent networks. Degradation in simulated colonic fluid (ACF) is shown below. Figure 2 As shown in Figure h, we found that the 50% AlgMA group degraded faster than the other groups. It can be inferred that most of the crosslinking sites in the 0% and 25% AlgMA groups were occupied by calcium ions, while ASF experienced less calcium ion loss, thus resulting in slower degradation in ACF compared to the 50% AlgMA group. The 75% and 100% AlgMA groups also degraded more slowly due to their covalent networks. Although the ionic crosslinking network provides beneficial stress relaxation for microcolony formation, a stable covalent network is also essential for effective oral administration. Therefore, the 50% AlgMA hydrogel was chosen for subsequent studies because, based on swelling degradation assessments, it remained stable in AGF and ASF but degraded most rapidly in ACF.

[0135] Subsequently, this study prepared microcarriers for oral administration using a gas shear microfluidic strategy. Probiotics were uniformly dispersed within the microcarriers and administered under appropriate conditions. Figure 2 i) Cultured in LB medium. Figure 2 As shown in J and K, the microcarriers are spherical and uniform in size, with an average particle size of 434 ± 12.75 μm. Studying the changes in bacterial biobehavior in stress-relaxed hydrogels is crucial. Here, microcarriers containing 2 × 10⁻⁶ micrometers are analyzed. 5 Microcarriers prepared in hydrogels containing CFU / mL bacteria were cultured in liquid medium at 37°C. During culture, microcarriers and growing microcolonies were observed. Figure 9 Self-organized microcolony formation was observed at time points of 2, 4, 6, and 8 hours. Figure 2 (l) and fluorescence showed that the volume of green fluorescently labeled microcolon increased over time. The microcolon grew into uniform microspheres without undergoing morphological instability and roughening. This phenomenon is mainly due to the elastic stress of the hydrogel, which physically restricts the rapid expansion of the microcolon, thus achieving spherical morphology. Subsequently, the stress relaxation properties of the hydrogel facilitate the gradual growth of the microcolon as the elastic stress gradually decreases over time. In addition, the surface structure of the hydrogel microcarrier was observed using scanning electron microscopy, revealing the structure of the cultured microcolon on the microcarrier surface ( Figure 2 (m).

[0136] 3. Gene expression patterns of self-organized microcolonies in microcarriers

[0137] Subsequently, the expression of colonization-related genes in microcolonies cultured in different dual-network hydrogels was investigated. The results showed that, under the same initial bacterial concentration and culture conditions, the changes in mRNA expression of quorum sensing genes (sdiA), adhesion genes (csgA), extracellular polysaccharide genes (adrA), and stress response genes (iraM) in microcolonies were not linearly related to the percentage of AlgMA (hydrogels containing 0%, 25%, 50%, 75%, and 100% AlgMA). Figure 3 (ad). Although the changes were not consistent between groups, we found that the expression levels of sdiA, csgA, adrA, and iraM were higher in the 50% AlgMA group than in other groups. Furthermore, we measured the total bacterial count in different hydrogels and the growth curves of bacteria after release from the hydrogels (ad). Figure 3 (e, f). After 6 hours of incubation, the OD600 absorbance of the bacteria in the five groups were 0.3452, 0.3942, 0.4722, 0.3872, and 0.2772, respectively. The total number of bacteria in the highly covalently cross-linked hydrogel network (100% AlgMA group) was lower than that in the other groups, presumably because the poor viscoelasticity of the highly covalent network limited the growth of microcolonies. Furthermore, the colony growth curves showed that the 50% AlgMA group had a faster proliferation rate (steeper growth slope) and a higher OD600 value (0.4722). Combined with the results of colonization-related gene expression and swelling degradation tests, the 50% AlgMA hydrogel is not only more suitable for culture-oral drug delivery systems, but also exhibits greater proliferation capacity and higher survival rate compared to other formulations. Therefore, the 50% AlgMA hydrogel was selected for subsequent research.

[0138] Further research analyzed the differences in colonization-related genes between single bacteria and 50% EMS (multicellular microcolonies containing 50% AlgMA microcarriers). Figure 3 (g). The mRNA expression of multicellular microcolonies (quorum sensing gene sdiA, global regulatory genes csrA and csgD, adhesion gene csgA, extracellular polysaccharide synthesis gene adrA, and stress response gene iraM) was significantly higher than that of single bacterial groups. In conclusion, the colonization potential of multicellular microcolonies derived from 50% AlgMA hydrogel microcarriers was significantly improved.

[0139] To explore how culture delivery systems influence the colonization potential of probiotics from a biological perspective, we investigated the transcriptional characteristics of 50% EMS and single bacteria using prokaryotic transcription techniques. Principal component analysis revealed significant differences in the transcriptional profiles of probiotics under these two culture conditions.Figure 3 In the middle h). In addition, Figure 3 In the middle i, j show that compared to single bacteria, 226 genes are up-regulated and 158 genes are down-regulated in the 50% EMS group (According to the volcano plot and heat map of differentially expressed genes, important up-regulated genes in the 50% EMS group (including genes related to biofilm formation, two-component system, phosphotransferase system (PTS) and amino acid metabolic pathways, marked on the right side of the heat map). According to KEGG abundance analysis ( Figure 3 In the middle k, l), in the 50% EMS group, the biofilm formation pathway was enriched in the up-regulated pathway abundance map. The two-component system, which can perceive various environmental signals (such as osmotic pressure, temperature, pH value, small molecules, etc.) to regulate bacterial activity, is also up-regulated in the 50% EMS. In addition, pathways related to metabolism, such as phenylalanine metabolism, amino sugar and nucleotide sugar metabolism, D-amino acid metabolism, nitrogen metabolism and sulfur metabolism, etc. are up-regulated, which helps to promote the survival ability of bacteria. In addition, the PTS pathway that promotes the transport of carbohydrates and their derivatives through the phosphotransferase cascade is also up-regulated in the 50% EMS group. This pathway is crucial for the regulation of carbon and nitrogen metabolism, intracellular metal ion homeostasis, and influences stress responses and other biological processes. Finally, compared to the single bacteria group, the mRNA expression of genes related to quorum sensing (trpE, fadD), biofilm formation (csrA, tssC) is significantly up-regulated in the 50% EMS group ( Figure 10 ). In summary, the transcriptional differences between the 50% EMS group and the single bacteria group indicate that probiotics from multicellular microcolonies perform better in colonization, and subsequent experiments will be conducted to further elucidate this phenomenon.

[0140] In addition, we also analyzed the transcriptional differences between the 50% EMS group and the colony group (see Figure 1 ) to determine whether the hydrogel solution has an impact on "colony growth". Principal component analysis shows that there is a significant difference between the colony group and the 50% EMS group ( Figure 11 In the middle a), and compared to the colony group, 1044 genes are up-regulated and 1057 genes are down-regulated in the 50% EMS group ( Figure 11 In the middle b). Further KEGG analysis ( Figure 11As shown in c and d), cell cycle was enriched in the 50% EMS group, indicating active bacterial proliferation. Furthermore, many metabolic pathways related to amino acids and glycolysis were upregulated, especially the energy metabolism pathway—oxidative phosphorylation—which was significantly upregulated. These data suggest that 50% EMS can promote bacterial energy metabolism and proliferation. The reasons for these changes may be: (1) the stress relaxation properties of 50% EMS, which provide appropriate spatial constraints, promoting the formation of highly proliferating and metabolically active small colonies; and (2) sodium alginate, a natural polysaccharide, can be used as a carbon source by bacteria, leading to altered glycolytic metabolism. However, in the KEGG analysis, we did not find significant enrichment of cluster sensing and biofilm formation pathways, suggesting that the enhanced colonization effect stems from colony structure, and this hydrogel may, to some extent, promote bacterial metabolism and proliferation.

[0141] 4. Self-organization and release of microcolonies

[0142] Biofilm formation involves five consecutive processes: reversible adhesion, irreversible adhesion, microcolony formation, maturation, and detachment / diffusion. Although the water channels in hydrogels can transport water and nutrients, nutrient transport is insufficient for all bacteria during microcolon self-organization, which affects the colony's colonization potential. Here, we aim to investigate the characteristics of microcolon self-organization in dual-network hydrogels.

[0143] The effects of initial bacterial concentration and incubation time on microcolony density and size in 50% EMS were investigated. Given that high bacterial density in hydrogel microcarriers intensifies competition for nutrients and space, while low density leads to microcolony overgrowth, we selected three bacterial concentrations (2 × 10⁻⁶)... 5 10 6 and 5×10 6 Microcarriers were prepared by serially diluting colony-forming units (CFU / mL) threefold. Figure 4 a and Figure 12 As shown, three types of hydrogel microcarriers (with initial bacterial concentrations of 2×10⁻⁶) 5 10 6 and 5×10 6 The maximum average diameters of microcolonies at CFU / mL were 23.94 μm, 14.96 μm, and 9.86 μm, respectively. This indicates that the higher the initial bacterial density, the slower the self-organization kinetics of the microcolonies (observed by the slope of the proliferation curve), and the smaller the microcolon size after reaching the stationary phase. Figure 4 (b, c). Furthermore, three initial bacterial concentrations were found to be 2 × 10⁻⁶. 5 10 6 and 5×10 6In CFU / mL hydrogel microcarriers, bacterial proliferation reached a stationary phase at different time points. Figure 4 (d) indicates that the higher the initial bacterial concentration in the microcarriers, the faster the bacterial proliferation rate, thus enabling the bacterial population to quickly reach the stationary phase. However, after 12 hours of cultivation, the total bacterial content in an equal volume of hydrogel microcarriers was independent of the initial bacterial concentration.

[0144] Meanwhile, the viability of bacteria within the microcarriers during culture was studied using a fluorescence cell viability assay. Figure 4 China e and Figure 13 At 0, 2, 6, and 12 hours, the bacterial mortality to survival rates were 0.0%, 7.1%, 2.8%, and 27.3%, respectively, indicating that after microcolony proliferation reaches saturation, the number of dead bacteria increases over time. The lower mortality rate at 6 hours compared to 2 hours is likely due to the significantly increased proportion of live bacteria resulting from active proliferation within 6 hours. Finally, the release of microcolony from the hydrogel microcarrier was investigated. Figure 4 As shown in Figure f, the alginate hydrogel gradually degrades in the ACF, and the internal microcolony disperses within the ACF within 30 minutes. In summary, this section investigated the effects of initial bacterial concentration and incubation time on microcolony formation and survival, and elucidated the microcolony release characteristics.

[0145] 5. Environmental resistance and colonization potential of self-organizing microcolonies

[0146] The key to successful oral delivery of probiotics lies in their resilience to the harsh gastrointestinal environment. Traditional probiotic delivery strategies employ chemical / genetic engineering to provide each bacterium with a protective "armor," where protective layers such as liposomes, metallophenols, dopamine, or surface structure modifications shield bacteria from stomach acid, bile salts, and antibiotics in the digestive tract. Here, we analyze the resilience of single bacteria and multicellular microcolonies within microcarriers. We also compare them to hydrogel microcarriers containing an equivalent number of uncultured probiotics to determine whether this protection is attributed to the hydrogel matrix or the microcolon structure. Figure 5 (a) We treated single bacteria, an EMS microcarrier system, and a primary microcarrier system (PMS) (containing equal amounts of uncultured bacterial microcarriers, without microcolonization) with AGF, ASF (containing bile salts), and antibiotics. Experiments showed that the hydrogel protected bacteria from gastric acid but not from antibiotics or bile salts. However, compared to the other two groups, the multicellular microcolon structure significantly enhanced resistance to bile salts and antibiotics. Figure 5 (Be). The growth curves of the single bacterial group and the EMS group were comparable, indicating that the structure of the microcolony did not affect bacterial proliferation. Figure 14Finally, we investigated the bacterial survival in PMS and EMS after antibiotic treatment. Figure 5 (f, g). Bacterial mortality in EMS was significantly lower than in PMS, which may be attributed to the dense structure of microcolonies and the accumulation of extracellular polysaccharides. In summary, we demonstrate that microcolon structure confers greater resistance to environmental attacks, including acidic liquids, bile salts, and antibiotics.

[0147] Next, we analyzed the actual colonization capacity of microcolonies. This included the self-aggregation capacity of individual bacteria in PMS and microcolonies in EMS. Figure 15 ) and cell adhesion ability ( Figure 5 h, Figure 16 An evaluation was conducted. The results showed that the aggregation capacity of bacteria in microcolonies was significantly higher than that of individual bacteria, and their adhesion to Caco-2 intestinal epithelial cells was also significantly higher than that of individual bacteria. Extracellular polysaccharides secreted by bacteria constitute the basic extracellular structure of the biofilm, playing a crucial role in the adhesion, mechanical stability, and biofilm protection of probiotics. We used the phenol-sulfuric acid method to detect extracellular polysaccharides, and the results showed that the yield in the multicellular microcolon group was twice that in the single-bacterial group (…). Figure 5 i).

[0148] In addition, the thickness of the biofilm was also measured. Figure 17 ) and quantity ( Figure 5 The biofilm formation capacity was analyzed using the methods described in sections j and k. The study found that, under the same culture conditions, the EMS-induced microcolonies formed a greater biofilm matrix than the EMS-dispersed group. This indicates that microcolon structure plays a crucial role in the colonization process. Existing research has utilized biofilm matrices to encapsulate probiotics for oral administration, demonstrating that this improves the probiotics' environmental tolerance and adhesion in the digestive tract. In this invention, the EMS-induced microcolonies themselves possess strong environmental resistance and adhesion, eliminating the need for additional processing steps requiring matrix or coating extraction as in existing methods, thus exhibiting greater application potential.

[0149] Subsequently, the in vivo colonization capacity of oral EMS or PMS was evaluated. Figure 5 (1). Before administration, all mice were treated for one week with kanamycin (50 μg / mL) dissolved in drinking water. Then, each mouse was administered 20 mg of EMS orally by gavage, while the control group received 20 mg of PMS with bacterial counts matched to EMS. Over the next three days, fecal EcN levels were quantified using a serial dilution sampling method. We found that in the PMS group, fecal EcN levels gradually decreased over time, while in the EMS group, there was only a slight increase on day two, and the levels on day three were essentially the same as on day one. Figure 5Middle m). Since the fecal content of probiotics does not represent the bacterial colonization in the gut, we isolated the small intestine, cecum, and colon tissues from these mice for histological bacterial quantification Figure 5 Middle n, Figure 18 Middle a). The results showed that the highest content of EcN was in the cecum, followed by the colon, and almost no EcN colonization in the small intestine. The average content of EcN in the EMS group was significantly higher than that in the PMS group, specifically, 89 times higher in the cecum, 52 times higher in the colon, and 2 times higher in the small intestine. The colonization of EcN (expressing red fluorescent protein) could be visualized in the frozen tissue sections Figure 18 Middle b).

[0150] 6. Therapeutic effect of oral EMS

[0151] EcN has been widely used in the treatment of inflammatory bowel disease (IBD), and it has been reported that EcN has a therapeutic effect comparable to mesalazine, thanks to its anti-inflammatory and regulation of intestinal flora properties. EcN plays an important role in inducing and maintaining remission of IBD, but is usually limited to the administration period, which indicates that probiotics have not yet colonized. In this study, we constructed a mouse model of colitis induced by dextran sulfate sodium (DSS) Figure 6 Middle a) to detect the therapeutic effect of EcN microcolonies by oral administration of EMS. We directly loaded EcN into hydrogel microcarriers (without culture) as a control group (PMS group) to distinguish the effects of microcolonies or individual probiotics. The first-line drug 5-ASA (5-aminosalicylic acid) was also used as a control for effective treatment.

[0152] The experimental results showed that the EMS group significantly maintained the body weight and colon length of the mice, reduced the disease activity score (DAS) ( Figure 6 Middle b-f, Figure 19 ) by only one gavage of EMS. Compared with the 5-ASA group, there was no significant difference in body weight change and colon length in the EMS group, but the disease activity score was significantly lower.

[0153] After hematoxylin-eosin (H&E) staining of the colon tissue Figure 6 Middle g), it was found that the colon epithelial tissue integrity of the EMS group remained good, and the immune cell infiltration was also significantly reduced. H&E staining of tissue sections of the main organs of the mice (liver, lung, heart, and kidney) also showed that this microcarrier preparation had good biocompatibility Figure 20 ). In addition, the quantification of EcN in the colon tissue by quantitative polymerase chain reaction (qPCR) Figure 6In the middle h), it was found that the tissue EcN content of the EMS group was significantly higher than that of the oral gavage group of EcN suspension (oral EcN suspension), which indicated that the colonization effect of EMS microcolonies in the intestinal tract was better than that of dispersed bacteria. Finally, the mRNA expression of cell junction proteins and inflammatory factors in colon tissue was analyzed Figure 6 In the middle i, j). The study found that the mRNA expression of ZO-1 and Occludin in the EMS group was slightly lower than that in the healthy control group, but significantly higher than that in the DSS group. At the same time, the mRNA expression of cytokines (IFN-γ, IL-1β, IL-6 and MCP-1) in the colon of the EMS group was also significantly lower than that in the DSS group, which was consistent with the trend of disease activity score. In summary, a single oral administration of EMS can effectively achieve the expected colonization and therapeutic effect in the acute colitis model, and does not require additional maintenance therapy.

[0154] The changes of fecal microbial community in the DSS group and the EMS group were analyzed by 16S rRNA sequencing technology. First, the fecal samples collected one day before the administration of DSS were analyzed to ensure that the initial microbial community composition of each mouse was the same. The alpha diversity ( Figure 21 In the middle a) and beta diversity ( Figure 21 In the middle b) between the DSS group and the EMS group were compared, and the results showed that there was no significant difference between the two, indicating that the bacterial abundance and microbial diversity were similar. Further analysis showed that there was no significant difference in the microbial composition at the phylum level (supplement Figure 21 In the middle c) and the functional prediction analysis based on PICRUSt2 system ( Figure 21 In the middle d) were not significantly different. Then, the fecal samples collected after the administration of DSS and EMS were analyzed, and we found that there were 91 ASVs common between the two groups ( Figure 22 In the middle a). Shannon and Simpson indices ( Figure 22 In the middle b) showed that there was no significant difference in alpha diversity between the DSS group and the EMS group, which might be due to the short-term nature of the acute colitis model. In addition, the three-dimensional principal coordinate analysis (PCoA) graph showed that there was a significant difference in microbial community between the DSS group and the EMS group ( Figure 22 In the middle c).

[0155] To further explore the detailed changes of the microbial community, we carried out a detailed study, and found that the relative abundance of Bacteroidetes ( Figure 23The distribution of the gut microbiota at the phylum and genus levels is presented. Here, we identified key bacteria associated with inflammatory bowel disease (IBD), whose abundance differed between the two groups. According to literature reports, Enterococci and Gamma-Proteobacteria are increased in IBD patients, but their abundance was significantly lower in the EMS treatment group than in the DSS control group. Conversely, Bacteroides and Lachnospiraceae, which are significantly reduced in Crohn's disease patients, were significantly increased in mice treated with EMS. An increase in Lactobacilli was found in the feces of the DSS group. Importantly, the expression of Akkermansia muciniphila was significantly upregulated in the EMS group. Figure 23 (b) These mucin-degrading bacteria maintain intestinal homeostasis by reducing inflammatory responses and decreasing intestinal permeability of pro-inflammatory substances such as inflammatory lipopolysaccharides. Furthermore, the content of *Blautia* was significantly higher in the EMS group. This beneficial strain plays a crucial role in regulating colony growth and intestinal inflammation, primarily because it produces bacteriocins that inhibit the colonization of intestinal pathogens such as *Clostridium perfringens* and vancomycin-resistant enterococci.

[0156] Furthermore, linear discriminant analysis (LDA) effect size revealed statistically significant and biologically relevant species between the two groups. Figure 6 k, Figure 24 The phylogenetic tree shows the changes from phylum to genus. Finally, the Tax4Fun2 system (which can predict the functional characteristics of the gut microbiota) is used. Figure 6 The DSS group was used for functional annotation cluster analysis. We found that the DSS group was functionally enriched in human disease and environmental information processing. However, the EMS group showed enhanced features in metabolism, genetic information processing, and systemic processes, consistent with the remission phenotype of the colitis model. In summary, the oral "rapid microbiota service" (EMS) strategy has advantages in terms of economic feasibility, biosafety, delivery efficiency, and therapeutic reliability. This advanced system enhances EcN intestinal colonization, thereby modulating the homeostasis of the entire intestinal microenvironment and promoting the formation of a healthier gut microbiota composition, which helps to alleviate colitis. Figure 6 (m).

[0157] III. Conclusion

[0158] Inspired by the Express Mail Service (EMS), which delivers mail quickly, efficiently, securely, and reliably, this invention uses the abbreviation "EMS" and designs a "microcolony express service" (EMS) system with adjustable matrix stiffness and viscoelastic properties to support the cultivation and oral delivery of probiotic microcolonies based on a multicellular self-organizing strategy. Figure 1The name EMS reflects its core property - to be consistent with the standard of express mail service (speed, efficiency, security and reliability). By developing a series of double cross-linked alginate hydrogel networks with stress relaxation properties, we obtained an optimized hydrogel formulation for microcolony culture and oral administration, and explored the self-organization patterns of microcolonies in microcarriers. Its application in intestinal colonization showed that EMS microcarrier preparations had excellent ability to resist harsh environments in the digestive tract and colonization potential, and oral use of EMS once could significantly alleviate colitis in mice.

[0159] In summary, inspired by the biological behavior of probiotics and the development patterns of biofilms, the present application developed an EMS microcarrier preparation for multi-cell self-organizing microcolony culture and oral delivery, providing a safe, effective and clinically translatable alternative to current probiotic therapy.

[0160] Comparative Example 1

[0161] The scheme of the present application was compared with the sodium alginate hydrogel delivery system in patent document CN118020941A (a probiotic-hydrogel oral delivery system and its preparation method): it was found that pure sodium alginate hydrogel would swell and degrade in bacterial culture medium, so it could not complete the microcolony culture process, and could only simply deliver the probiotics that had been wrapped, but could not deliver microcolonies.

[0162] Comparative Example 2

[0163] The scheme of the present application was compared with the double network hydrogel delivery system in the existing literature (CN117398512A - a living probiotic culture delivery hydrogel scaffold and its preparation method and application; CN119505288A - a hardness and viscoelasticity adjustable biomimetic extracellular matrix hydrogel hydrogel and its preparation method): it was found that the existing literature used gelatin as a provider of covalent network, but the gelatin system degraded slowly in the digestive tract, and some studies showed that the degradation time of GelMA hydrogel could be from several hours to 2 days (PMID:39859377, PMID:40180106), and the microcolonies could not be completely released in a short time, while in this study, the microcolonies could be released in about 30 min in simulated colon fluid.

[0164] Comparative Example 3

[0165] In the present application, probiotics were cultured into a double network hydrogel based on gelatin (A) and hyaluronic acid (B), and it was found that in A, microcolony structures of uneven size were formed, and in B, the growth of bacterial colonies inside changed, and abnormal filamentous structures appeared, while in the double network hydrogel constructed in the present application example, microcolony structures of uniform size (C) could be cultured, and the results could be seen in Figure 25。

Claims

1. A method for preparing a microcarrier for oral delivery of probiotic microcolony, characterized in that, Includes the following steps: (1) Sodium alginate and methacrylate hydrochloride were mixed to obtain solution A. 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholine hydrochloride was dissolved in MES solution to obtain solution B. Solutions A and B were added to sodium alginate solution in batches and stirred to react. The reaction product was dialyzed to obtain methacrylamide sodium alginate hydrogel solution. (2) The hydrogel solution obtained in step (1) is mixed with sodium alginate solution at a weight ratio of 1:

1. Then, microdroplets are collected in calcium chloride solution under nitrogen atmosphere by airflow control method. Then, the microdroplets are photocrosslinked to obtain double network hydrogel microcapsules. (3) Add live probiotics to the double-network hydrogel microcapsules obtained in step (2) and disperse them in LB medium for culture to obtain microcolonies, which are the oral delivery probiotic microcolon microcarriers.

2. The preparation method according to claim 1, characterized in that, The mass ratio of sodium alginate, methacrylate hydrochloride and 4-(4,6-dimethoxy-1,3,5-triazine-2-yl)-4-methylmorpholine hydrochloride in step (1) is 2:0.38:1.

268.

3. The preparation method according to claim 1, characterized in that, The molecular weight cutoff for dialysis in step (1) is 8000-14000 Da.

4. The preparation method according to claim 1, characterized in that, The concentrations of the hydrogel solution and sodium alginate solution mentioned in step (2) are both 0.9%-1.1wt%.

5. The preparation method according to claim 1, characterized in that, The flow rate of nitrogen gas in step (2) is 0.4 L / min.

6. The preparation method according to claim 1, characterized in that, The concentration of the calcium chloride solution in step (2) is 0.1 mol / L.

7. The preparation method according to claim 1, characterized in that, The probiotic mentioned in step (3) is Escherichia coli Nissle 1917, and the concentration of the probiotic is 2×10⁻⁶. 5 ~5×10 6 CFU / mL.

8. The preparation method according to claim 1, characterized in that, The incubation time in step (3) is 2 to 24 hours.

9. A microcarrier for oral delivery of probiotic microcolony prepared by the method according to any one of claims 1-8.

10. The use of the microcarrier for oral delivery of probiotic microcolony as described in claim 9 in the preparation of microbial preparations for treating intestinal diseases.

Images