Phytobacterium plantarum TRT-01 with anti-inflammatory and bacteriostatic functions as well as preparation method and application of phytobacterium plantarum TRT-01
The *Lactobacillus plantarum* TRT-01 isolated from pickled radishes has solved the problems of narrow antibacterial spectrum, insufficient anti-inflammatory activity and poor stability of existing strains, and has achieved broad-spectrum antibacterial and anti-inflammatory effects. It is suitable for the prevention and treatment of infections in multiple sites and has the stability and immunomodulatory ability of industrial fermentation and gastrointestinal colonization.
Patent Information
- Application Number
- CN202511111490.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-11-04
AI Technical Summary
Existing Lactobacillus plantarum strains suffer from narrow antibacterial spectrum, insufficient anti-inflammatory activity, poor strain stability, and limited functionality, making it difficult to meet the antibacterial needs of multiple scenarios and the comprehensive efficacy of product development.
TRT-01, a strain of *Lactobacillus plantarum*, was isolated from traditional pickled radishes. It induces dendritic cells to secrete cytokines IL-10 and IL-12, inhibits IL-6, regulates the Th1/Treg immune balance, and inhibits pathogens through metabolites and antimicrobial peptides. It adapts to various environments and achieves broad-spectrum antibacterial and anti-inflammatory effects.
TRT-01 exhibits broad-spectrum antibacterial activity, is effective against a variety of pathogens, and has a particularly outstanding inhibitory effect on Helicobacter pylori. It has optimal growth activity at 37℃ and acid and bile salt resistance, making it suitable for industrial fermentation and gastrointestinal colonization. It can regulate immune balance and alleviate inflammatory responses, making it suitable for the prevention and treatment of infections in multiple sites.
Smart Images

Figure CN120888461A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbiology, specifically relating to a strain of Lactobacillus plantarum TRT-01 with anti-inflammatory and antibacterial functions, its preparation method, and its application. Background Technology
[0002] my country has a large number of patients with infectious diseases, and the long-term and extensive use of broad-spectrum antibiotics inevitably exacerbates the imbalance of the human gut microbiota, leading to bacterial translocation, enterogenic infections, and even fatal infections. It also increases the likelihood of hospitalized patients contracting nosocomial infections. In recent years, significant progress has been made in the use of microecological regulators to assist in the treatment of emerging infectious diseases. Researchers have found that H7N9 patients have a severely imbalanced gut microbiota, with a Bifidobacterium to Enterobacterium ratio (B / E) far lower than that of healthy individuals; some patients even had Bifidobacterium levels below the detection threshold. After antibiotic treatment, the abundance of gut microbiota fluctuated significantly, with a sharp decline in beneficial bacteria. After probiotic treatment, the abundance of Bifidobacterium, Lactobacillus, and Butyric acid-producing bacteria in the patient's gut significantly increased, demonstrating the important role of maintaining microecological balance in the diagnosis and treatment of infectious diseases.
[0003] Mucosal tissues in different locations possess their own unique micro-ecosystems. Pathogenic micro-ecosystems in the mucosa of the oral cavity, upper respiratory tract, stomach, and genitourinary tract can all cause and lead to clinical symptoms in these areas, including oral ulcers, periodontitis, nasopharyngitis, gastritis, urethritis, and vaginitis. The mucosal epithelium is the primary habitat for the microbial community and the main site of interaction between microorganisms and the host's immune system. The micro-ecosystem plays a crucial role in the development and functional regulation of the mucosal immune system, and the mucus layer-microbe interaction is essential for maintaining intestinal homeostasis and preserving host health.
[0004] On the other hand, the regulatory interaction between probiotics and the human immune system is the main reason for enhancing immunity and reducing inflammation. When probiotics are ingested and enter the intestines, dendritic cells (DCs), one type of antigen-presenting cells (APCs), extend their tentacles into the intestinal epithelial cells to capture antigens and are induced to mature, or capture antigens entering through intestinal microfold cells (M cells) and present them to immune cells in the lamina propria for subsequent immune activation responses. For example, this can activate naive T cells to differentiate into helper T cells (T helper cells 1, 2, 9, 17, and 22) or induce differentiation into regulatory T cells (Tregs). For example, some studies have indicated that certain... Lacticaseibacillus rhamnosus The strain induces the production of regulatory dendritic cells and promotes CD4. + FoxP3 +regulatory T cell generation, reducing the characteristics of an allergic asthma mouse model, and Lactobacillus acidophilus Strains induce dendritic cells to produce Interferon-β (IFN-β) via Toll-like receptor 2 (TLR-2) to increase the expression of viral defense genes, and other studies have also shown that probiotic mixtures can cause regulatory dendritic cells to express Foxp3 - T cells into CD4 + Foxp3 + regulatory T cells and migrate to the site of inflammation to suppress the inflammatory response, and probiotics can also regulate immunoglobulin or cytokine secretion, directly stimulate immune responses or indirectly stimulate immune responses by enhancing the epithelial barrier and mucus secretion of the gut.
[0005] Lactobacillus is a kind of probiotic bacteria of great significance to human health, which plays a significant role in microecological regulation and immune enhancement. Among them, Lactobacillus plantarum has become the core object of probiotic research due to its wide distribution and outstanding metabolic activity. However, there are many shortcomings in the application of related strains in the prior art.
[0006] Firstly, the antibacterial spectrum is narrow. Most of the reported Lactobacillus plantarum has limited inhibitory ability to pathogenic bacteria in multiple sites such as oral cavity (e.g. Streptococcus mutans), stomach (e.g. Helicobacter pylori), intestinal tract (e.g. Salmonella), and urogenital tract (e.g. Candida albicans), which is difficult to meet the antibacterial needs of multiple scenes such as oral care, gastrointestinal health maintenance, and urogenital infection prevention, resulting in limited selection during product development and difficulty in achieving ideal antibacterial effect.
[0007] Secondly, the anti-inflammatory activity is insufficient. The existing strains have poor efficiency in regulating Th1 / Treg immune balance and inhibiting the secretion of key inflammatory factors such as TNF-α and IL-6, and the intervention effect on allergic diseases (such as food allergy and allergic rhinitis) and autoimmune diseases (such as inflammatory bowel disease) is not ideal. Moreover, the anti-inflammatory mechanism is not deep enough, which makes the development of anti-inflammatory products lack clear basis for action, affecting the effectiveness and reliability of the products.
[0008] Thirdly, the stability of the strains is poor. Some strains are easily inactivated or difficult to colonize in industrial fermentation (such as high-density culture, freeze-drying preservation) and complex environments (such as the human intestinal tract and food processing system), resulting in fluctuations in actual application, which cannot guarantee product quality and efficacy, and increases the uncertainty of production and use.
[0009] In addition, the functions are single. The existing strains are focused on single function (only antibacterial or only anti-inflammatory), lack of "multi-functional" strains with efficient antibacterial, broad-spectrum anti-inflammatory and immune regulation, which limits the synergistic application in compound preparations (such as antibacterial and anti-inflammatory composition), is difficult to meet the market demand for comprehensive efficacy products, and weakens the competitiveness of the product.
[0010] Traditional fermented foods (such as pickled radish) contain rich microbial resources. The microorganisms in the fermentation process adapt to high salt and acidic environment, and may have stronger tolerance and metabolic activity. The Lactiplantibacillus plantarum isolated from pickled radish has excellent performance in antibacterial, anti-inflammatory and immune regulation, which can effectively make up for the above technical shortcomings, provide key strain resources for the development of new microbial preparations (such as antibacterial and anti-inflammatory composition, immune regulation product), and has important application value and research significance. SUMMARY
[0011] The purpose of the present application is to provide a Lactiplantibacillus plantarum with anti-inflammatory and antibacterial functions.
[0012] Another purpose of the present application is to provide an application of Lactiplantibacillus plantarum.
[0013] In order to achieve the above-mentioned purposes of the application, the following technical means are adopted: A Lactiplantibacillus plantarum TRT-01, the strain is preserved in the China General Microbiological Culture Collection Center, the preservation number is CGMCC No. 32237, and the preservation date is October 17, 2024.
[0014] The preparation method of the Lactiplantibacillus plantarum TRT-01: samples are collected from traditional Chinese folk family self-pickled radish, then coated on MRS solid culture medium, anaerobic culture at 37 DEG C for 48 hours, typical white colonies are picked and purified by multiple streaking, until pure culture is obtained.
[0015] The present application also provides an application of the Lactiplantibacillus plantarum TRT-01 in preparing a composition for regulating immunity.
[0016] In the above technical solution, the Lactiplantibacillus plantarum TRT-01 is applied in preparing a composition for immune diseases induced by Th1 / Treg imbalance.
[0017] In the above technical solution, the Lactiplantibacillus plantarum TRT-01 induces dendritic cells to secrete cytokines IL-10 and IL-12, induces T cells to secrete cytokines TGF-β and IFN-γ, and at the same time inhibits the secretion of cytokine IL-6, so as to regulate the Th1 / Treg immune balance and relieve the inflammatory reaction.
[0018] In the technical solution, the immune diseases include allergic diseases, specific reaction diseases and autoimmune diseases.
[0019] The application also provides application of the Lactobacillus plantarum TRT-01 in preparation of a composition for inhibiting pathogenic bacteria.
[0020] In the technical solution, the pathogenic bacteria include at least one of oral cavity pathogenic bacteria, stomach pathogenic bacteria, throat pathogenic bacteria, intestinal tract pathogenic bacteria and urogenital tract pathogenic bacteria.
[0021] In the technical solution, the Lactobacillus plantarum TRT-01 is applied to preparation of a composition for inhibiting pathogenic bacteria, wherein the oral cavity pathogenic bacteria include Streptococcus mutans, Prevotella intermedia and Actinobacillus actinomycetemcomitans; the stomach pathogenic bacteria include Helicobacter pylori; the intestinal tract pathogenic bacteria include Escherichia coli, Staphylococcus aureus and Salmonella; the urogenital tract pathogenic bacteria include Candida albicans and Gardnerella; and the throat pathogenic bacteria include Streptococcus pneumoniae.
[0022] The application also provides a composition with anti-inflammatory and antibacterial effects, which comprises the Lactobacillus plantarum TRT-01.
[0023] The application also provides a preparation method of the Lactobacillus plantarum TRT-01, which comprises the following steps: collecting a sample from Chinese traditional folk family self-pickled radish, coating the sample on MRS solid culture medium, and culturing the sample at 37 DEG C in anaerobic condition for 48 hours; picking typical white colonies with morphological characteristics for multiple streaking and purifying until pure culture is obtained.
[0024] The application has the following beneficial effects: The application provides a new Lactobacillus plantarum TRT-01, which not only shows broad-spectrum antibacterial activity on 10 kinds of oral cavity, gastrointestinal and urogenital tract pathogenic bacteria such as Helicobacter pylori and Streptococcus mutans, but also has outstanding inhibitory effect on Helicobacter pylori. The strain has significant application potential in microecological balance regulation and prevention and treatment of multiple site infections. Through multiple mechanisms such as metabolic product inhibition, nutrition competition and immune regulation of the TRT-01, the pathogenic bacteria in each mucosal site are inhibited, the flora balance is reconstructed, and the development of pathogenic bacteria colonies in each mucosal tissue is inhibited, which can provide a core strain for development of a new type of antibacterial probiotic preparation.
[0025] The plant Lactobacillus plantarum TRT-01 can also regulate Th1 / Treg immune balance by inducing dendritic cells to secrete IL-10 / IL-12 and promoting T cells to release TGF-β / IFN-γ, and effectively relieve the inflammatory response caused by allergens; it has optimal growth activity at 37°C, acid and bile salt resistance, and high survival rate after glycerol freezing at-80°C, is suitable for industrial fermentation and gastrointestinal colonization, and synergistically enhances the human body's anti-infection ability through the triple mechanism of "bacteriostasis-anti-inflammation-immune regulation", and provides a stable and efficient functional strain for the development of compound preparations in the fields of medicine, health care products and the like. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 : Micrograph of Lactobacillus plantarum TRT-01; Figure 2 : Comparison column chart of IL-12 secretion amount in Example 2; Figure 3 : Comparison column chart of IL-10 secretion amount in Example 2; Figure 4 : Comparison column chart of IFN-γ secretion amount in Example 2; Figure 5 : Comparison column chart of TGF-β secretion amount in Example 2; Figure 6 : Comparison column chart of IL-6 secretion amount in Example 2; Figure 7 : Bacteriostatic circle of Streptococcus mutans; Figure 8 : Bacteriostatic circle of Prevotella intermedia; Figure 9 : Bacteriostatic circle of Actinobacillus actinomycetemcomitans; Figure 10 : Bacteriostatic circle of Streptococcus pneumoniae; Figure 11 : Bacteriostatic circle of Helicobacter pylori; Figure 12 : Bacteriostatic circle of Escherichia coli; Figure 13 : Bacteriostatic circle of Staphylococcus aureus; Figure 14 : Bacteriostatic circle of Salmonella; Figure 15 : Bacteriostatic circle of Candida albicans; Figure 16 : Bacteriostatic circle of Gardnerella. DETAILED DESCRIPTION
[0027] The application will be further described below through specific examples, but the protection scope of the application is not limited by the examples. EMBODIMENT
[0028] 1. Isolation and culture of strains Samples were collected from traditional Chinese folk family self-pickling radish. 10 g of sample was added to 90 mL of sterile normal saline, shaken and mixed, and then gradient diluted to 10 -5 , 10 -6 , 10 -7 three dilutions. 0.1 mL was taken and coated on MRS solid culture medium, respectively, and cultured anaerobically at 37°C for 48 hours. Typical white colonies were picked and purified by multiple streaking until pure culture was obtained.
[0029] MRS solid culture medium formula: 10 g of proteose peptone, 10 g of beef extract, 5 g of yeast powder, 20 g of glucose, 1 g of Tween 80, 2 g of diammonium hydrogen citrate, 5 g of sodium acetate, 2 g of potassium hydrogen phosphate, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, 15 g of agar, 1000 mL of distilled water, pH 6.2-6.4.
[0030] The isolated strain was inoculated in MRS liquid culture medium and cultured at 25°C, 30°C, 37°C and 42°C, respectively, to determine the effect of different temperatures on the growth of the strain. The results showed that the strain grew best at 37°C, and the OD 600 value reached more than 1.8 within 24 hours. At the same time, the effect of different pH values (5.0, 5.5, 6.0, 6.5, 7.0) on the growth of the strain was investigated, and it was found that the strain grew well in the pH range of 5.5-6.5, and the optimum pH was 6.2.
[0031] The screened strain Lactiplantibacillus plantarum TRT-01 was deposited in the China General Microbiological Culture Collection Center on October 17, 2024, with the accession number CGMCC No. 32237.
[0032] 2. Morphological and physiological and biochemical identification Morphological observation The strain was inoculated on MRS solid culture medium and cultured at 37°C for 48 hours, and the colony morphology was observed. The results showed that Figure 1 The micrograph of Lactiplantibacillus plantarum TRT-01 showed that the colony was white, round, smooth in surface, with regular edge, and the diameter was about 2-3 mm. The bacterial cells in logarithmic growth phase were subjected to Gram staining, and it was found under a microscope that the strain was a Gram-positive bacillus, with short rod-shaped cells arranged singly or in pairs.
[0033] Physiological and biochemical property identification The physiological and biochemical properties of the strain were identified according to the "Berger's Bacterial Identification Manual", and the results were as follows: Hydrogen peroxide test: negative; Oxidase test: negative; Sugar fermentation test: Fermentation of glucose, lactose, maltose, and sucrose; no fermentation of arabinose, xylose, or raffinose. Acid production test: Fermentation of glucose produces acid but not gas; Salt tolerance test: Microbial growth in 6.5% NaCl medium; Bile salt tolerance test: It grows well in 0.3% bile salt medium.
[0034] 3. Molecular biological identification 16S rRNA gene sequence analysis Genomic DNA was extracted from the strain and amplified by PCR using universal primers. The PCR reaction conditions were: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 1 minute, for a total of 35 cycles; and a final extension at 72℃ for 10 minutes. The amplified product was purified and sequenced to obtain the 16S rRNA gene sequence. Alignment of this sequence with known sequences in the GenBank database showed that the strain shared 99.8% homology with *Lactobacillus plantarum*.
[0035] A phylogenetic tree was constructed using 16S rRNA gene sequences of selected lactic acid bacteria and MEGA 7.0 software. The results showed that this strain clustered with the type strain DSM20174T of *Lactobacillus plantarum*, further confirming that this strain belongs to *Lactobacillus plantarum*.
[0036] TRT-0116S rRNA sequence:
[0037] Sequence analysis of pheS gene To further accurately identify the classification status of the strain, after extracting the genomic DNA of the strain, PCR amplification was performed using pheS gene specific primers. The PCR reaction conditions were as follows: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 30 seconds, 56°C annealing for 30 seconds, 72°C extension for 1 minute, a total of 35 cycles; 72°C extension for 10 minutes. The amplified product was sequenced after purification, and a pheS gene sequence of about 850 bp was obtained.
[0038] The sequence was compared with the pheS sequences of known L. plantarum strains in the LAB-IDENT database and GenBank, and the results showed that: the homology with the pheS sequence of the L. plantarum type strain DSM20174T was 99.5% the homology with the pheS sequence of the L. plantarum JCM1149T was 99.3% In phylogenetic analysis, it formed an independent evolutionary branch with the L. plantarum standard strain, and the bootstrap value was 99% L. plantarum TRT-01 pheS gene sequence: TTTCTAACACGTGGGGGTGAACCATGCCGGCACCCAGTACTTCGATCCAACCCGTTTGCTTACAGATTGCACAGCCCTTGCCATTGCAATTAAAGCAAGTTACATCAGCTTCTACGGATGGTTCCGTGAATGGAAAGAAGCTTGGCCGTAGCCGAACATCGAATTGATCGCCAAACAAAGTCTTGGCAACCAGAATTAAGGTGCCCTTCAAATCAGCCATCGTAATATGCTTGTCCACGACTAACCCTTCAATTTGATGAAATTGATGGGAATGGGTTGCATCATCCGTATCACGCCCGATAAACGCGGCCAGGTGACAAGACCTTCAGCGGTCCTTTAGAAAAATCGTGATTTTCAAGTGACCGCGGCTGATCAGCAGACGTCTGCGTGCGTAGTAGCACGTCTTTGGTAATATAGAACGTGTCTTGCAT.
[0039] 4. Bacterial strain preservation The identified strain was inoculated in MRS liquid medium and cultured at 37°C to the logarithmic growth phase, and an equal volume of 50% glycerol solution was added. After mixing, it was divided into cryogenic tubes and stored in a -80°C refrigerator. At the same time, the strain was preserved in the China General Microbiological Culture Collection Center, with the preservation number CGMCC No. 32237 and the preservation date October 17, 2024.
[0040] Example 2: Verification experiment of immunomodulatory function of Lactobacillus plantarum TRT-01 I. Experimental materials 1. Cell lines and strains: iPSC stem cells (purchased from the Taiwan Food Industry Development Institute Biological Resource Preservation and Research Center); Human T cell line Jurkat cells (ATCC TIB-152); Lactobacillus plantarum TRT-01 (CGMCC No. 32237), stored in a -80°C glycerol cryogenic tube; Control strain: Lactobacillus rhamnosus GG strain (LGG, ATCC 53103).
[0041] 2. Culture medium and reagents DMEM / F12 culture medium (containing 80% basic medium + 20% FBS); RPMI-1640 culture medium (containing 90% basic medium + 10% FBS); Cytokines: BMP4, VEGF, SCF, IL-3, Flt-3 ligand, IL-4, GM-CSF (PeproTech); Lipopolysaccharide (LPS, Sigma), MRS broth (DIFCO 0881); Flow cytometry antibodies: CD14 (BD Biosciences); Cytokine detection kit: IL-10, IL-12, IFN-γ, IL-6, TGF-β ELISA kit (R&D Systems).
[0042] 3. Main instruments CO2 incubator (ThermoFisher), centrifuge (Eppendorf), microplate reader (Bio-Tek), inverted microscope (Olympus).
[0043] II. Experimental methods 1. Preparation of iPSC differentiated into dendritic cells (DC) Monocyte differentiation: iPSC cells were cultured in 80% DMEM / F12 + 20% FBS, and BMP4 (20 ng / mL), VEGF (50 ng / mL), SCF (50 ng / mL), IL-3 (20 ng / mL), Flt-3 ligand (50 ng / mL) were added. The cells were cultured at 37°C, 5% CO2 for 14 days, and the CD14+ monocyte differentiation efficiency was detected by flow cytometry.
[0044] Dendritic cell induction: Monocytes were cultured in 90% RPMI-1640 + 10% FBS, and IL-4 (20 ng / mL), GM-CSF (50 ng / mL) were added. The cells were cultured at 37°C, 5% CO2 for 7 days, and after LPS stimulation for 24 hours, IL-10 and IL-12 were detected by ELISA to confirm DC differentiation and maturation.
[0045] 2. TRT-01 strain culture and treatment TRT-01 was cultured in MRS broth at 37°C for 20 hours, and the bacterial cells were collected by centrifugation (3000 x g, 20 minutes) at 4°C. After washing with PBS, the bacterial concentration was adjusted to 4 x 10 6 CFU / mL.
[0046] 3. DC and TRT-01 co-culture experiment The differentiated and matured DCs were mixed with TRT-01 at a ratio of 1:10 (cells:bacteria), and co-cultured at 37°C, 5% CO2 for 48 hours. The supernatant was collected, and the concentrations of IL-10 and IL-12 were detected by ELISA. The control groups were: DC-only, LPS (1 μg / mL) stimulation group, LGG (4 x 10 6 CFU / mL) group.
[0047] 4. Jurkat cell co-culture and cytokine detection Jurkat cells were cultured in 90% RPMI-1640 + 10% FBS for 48 hours, and the supernatant of TRT-01 activated DCs was collected. The Jurkat cells were co-cultured with the supernatant at a ratio of 1:10 for 48 hours, and the supernatant was collected. The concentrations of IFN-γ, IL-6, and TGF-β were detected by ELISA. The control groups were the same as step 3.
[0048] III. Experimental results 1. DC differentiation efficiency and phenotype identification The proportion of CD14+ cells in iPSC differentiated monocytes was 92%, and after LPS stimulation, the IL-12 secretion of DCs induced for 7 days was (85.6 ± 5.2) pg / mL, and the IL-10 was (120.3 ± 8.7) pg / mL, indicating that the DCs were differentiated and matured.
[0049] 2. TRT-01 induced DCs to secrete cytokines: see Figure 2 and Figure 3 .
[0050] IL-12 secretion: TRT-01 group (78.9 ± 4.8 pg / mL) showed no significant difference with LPS group (82.1 ± 6.1 pg / mL), but significantly higher than LGG group (35.2 ± 3.1 pg / mL) and DC-only group (12.5 ± 1.8 pg / mL, *p < 0.01).
[0051] IL-10 secretion: TRT-01 group (115.7 ± 7.3 pg / mL) was significantly higher than LPS group (150.2 ± 9.5 pg / mL), LGG group (42.6 ± 3.8 pg / mL) and DC-only group (18.3 ± 2.4 pg / mL, *p < 0.01).
[0052] 3. TRT-01 regulated T cells to secrete cytokines through DCs: see Figure 4 , Figure 5 and Figure 6 .
[0053] IFN-γ secretion: TRT-01 group (38.5 ± 3.2 pg / mL) was significantly higher than LPS group (32.1 ± 2.7 pg / mL), LGG group (15.6 ± 1.9 pg / mL) and DC-only group (8.7 ± 1.2 pg / mL, *p < 0.01).
[0054] TGF-β secretion: TRT-01 group (1450.2 ± 102.3 pg / mL) was significantly higher than LGG group (520.4 ± 45.7 pg / mL) and DC-only group (210.5 ± 28.6 pg / mL), although lower than LPS group (1820.5 ± 120.8 pg / mL), but the difference was statistically significant (*p < 0.05).
[0055] IL-6 secretion: TRT-01 group (120.3 ± 15.7 pg / mL) showed no significant difference with DC-only group (115.6 ± 13.2 pg / mL), only LPS group (1250.4 ± 98.6 pg / mL) was significantly increased (*p < 0.01).
[0056] Four, mechanism analysis 1. Analysis of immune regulation mechanism TRT-01 can synergistically regulate T cell differentiation by inducing DCs to secrete IL-12 and IL-10: IL-12 promotes Th1 cells to secrete IFN-γ, and IL-10 induces Treg cells to generate together with TGF-β, forming a "Th1 / Treg balance regulation" pathway. The synchronous increase of IFN-γ and TGF-β in the experiment confirms that this strain can bidirectionally regulate immune response, both enhancing cellular immunity (Th1) and inhibiting excessive inflammation (Treg).
[0057] 2. Differences and advantages of the existing strain Compared with LGG, TRT-01 induces significantly higher levels of IL-12, IL-10, and TGF-β, and has no significant induction effect on IL-6, avoiding the risk of promoting inflammation. This feature makes it more advantageous in allergic diseases (such as Th2 type immune bias) - it can inhibit Th2 overactivation by increasing Treg type cytokines (TGF-β, IL-10), while correcting immune imbalance with IFN-γ.
[0058] 3. Clinical application potential The immunoregulatory function of this strain can be applied to: Allergic diseases: such as allergic rhinitis, food allergy, to relieve inflammation by regulating Th1 / Th2 balance; Autoimmune diseases: such as inflammatory bowel disease, to suppress excessive immune response in the intestine through Treg cells; Infection adjuvant therapy: to enhance IFN-γ mediated anti-viral / bacterial immunity while avoiding IL-6 storm.
[0059] 4. Further exploration The specific action path of the cell wall components (such as peptidoglycan) or metabolic products (such as short-chain fatty acids) of TRT-01 on the DC-T cell axis still needs to be further studied through proteomics or metabolomics.
[0060] Five, Conclusion Lactobacillus plantarum TRT-01 regulates Th1 / Treg immune balance by inducing DCs to secrete IL-12 / IL-10 and T cells to secrete IFN-γ / TGF-β, and shows better potential than traditional strains (such as LGG) in anti-inflammatory and immune regulation, providing experimental basis for the development of immunoregulatory probiotic preparations.
[0061] Example 3: Broad-spectrum antibacterial test of Lactobacillus plantarum TRT-01 I. Experimental materials 1. Pathogenic bacteria (all purchased from ATCC, American Type Culture Collection): Oral pathogenic bacteria: Streptococcus mutans (ATCC 25175), Prevotella intermedia (ATCC 25611), Actinobacillus actinomycetemcomitans (ATCC 29522); Throat pathogenic bacteria: Streptococcus pneumoniae (ATCC 33400); Stomach pathogenic bacteria: Helicobacter pylori (ATCC 43579); Intestinal pathogenic bacteria: Escherichia coli (ATCC 33694), Staphylococcus aureus (ATCC 6538), Salmonella (ATCC 14028); Reproductive tract pathogenic bacteria: Candida albicans (ATCC 10231), Gardnerella (ATCC 14018).
[0062] Culture medium: Probiotic culture medium: MRS broth (DIFCO 0881) with 1.5% agar, pH 6.2-6.5; Pathogenic bacteria culture medium: configured according to the needs of different pathogenic bacteria.
[0063] 2. Main reagents and instruments: Anaerobic incubator, CO2 incubator, autoclave, sterile culture dish (90 mm), micropipette; Lactobacillus plantarum TRT-01 (CGMCC No. 32237, glycerol frozen at -80°C).
[0064] Because the mucosal tissues of different parts have their own unique microecological systems, pathogenic microecosystems at mucosal sites such as the oral cavity, upper respiratory tract, stomach, and reproductive and urinary tracts can cause and lead to clinical symptoms of mucosal tissues at each part, including oral ulcers, periodontitis, nasopharyngitis, gastritis, urethritis, and vaginitis. Therefore, the main pathogenic bacteria that often infect mucosal tissues at each part of the oral cavity, upper respiratory tract, stomach, intestinal tract, reproductive tract, and urinary tract, i.e., the above ten pathogenic bacteria, are selected in this embodiment.
[0065] The ten pathogenic bacteria, including gram-positive / negative bacteria, aerobic / anaerobic bacteria, and bacteria / fungi, cover different metabolic characteristics and pathogenic mechanisms, both based on their pathogenicity at each part of the human body and taking into account the clinical needs of microecological regulation, providing a comprehensive verification model for the broad-spectrum antibacterial and anti-inflammatory functions of probiotics.
[0066] II. Experimental method 1. Activation and culture of pathogenic bacteria Activate each pathogenic bacteria, and adjust the concentration of the logarithmic growth phase bacterial solution to 1×10 8 CFU / mL (calibrated by turbidity method).
[0067] 2. Inhibition test of double-layer culture medium Bottom layer medium preparation: Pour 15 mL MRS agar medium into a Petri dish, and after solidification, coat the TRT-01 bacterial solution (4 x 10 6 CFU / mL) in the central 2 cm wide area, and incubate at 37°C for 48 hours.
[0068] Upper layer medium preparation: Heat and melt each pathogenic bacterial medium, and when cooled to 40°C, add the corresponding pathogenic bacterial solution (final concentration 1 x 10 6 CFU / mL), and quickly take 15 mL to cover the bottom layer medium, and after solidification, invert and culture.
[0069] Inhibition zone measurement: After the culture ends, use a vernier caliper to measure the diameter of the central sterile area (inhibition width), and grade according to the following standards: (-) No inhibition zone; (+ / -) <1 cm; (+) <2 cm; (++) <3 cm; (+++) ≥4 cm; (++++) complete inhibition 3. Control settings Blank control: Only bottom layer medium + upper layer pathogenic bacterial medium, without coating TRT-01; Positive control: Coat a standard bacteriostatic strain (such as Lactococcus LL-3) to verify the effectiveness of the experimental system.
[0070] Three, experimental results 1. Inhibition zone detection results: see Figures 7-16 Inhibition zone photos of different strains.
[0071] Pathogenic bacterial species Zone of inhibition width Inhibition rating Streptococcus mutans 2.5-2.8 cm (++) Helicobacter pylori 4.2-4.5 cm (+++) Escherichia coli 2.6-2.9 cm (++) Staphylococcus aureus 1.5-1.8 cm (+) Candida albicans 2.7-2.9 cm (++) Prevotella intermedia 2.5-2.7 cm (++) Actinobacillus actinomycetemcomitans 2.4-2.6 cm (++) Streptococcus pneumoniae 2.3-2.5 cm (++) Salmonella 1.6-1.9 cm (+) Gardnerella 2.5-2.8 cm (++) 2. Control experiment results: Blank control group: All pathogenic bacteria had no inhibition zone (-); Positive control group (Lactococcus LL-3): Inhibition zone of 3.2-3.5 cm (++) against Helicobacter pylori, significantly lower than TRT-01.
[0072] 3. Key findings: High efficiency inhibition of Helicobacter pylori: TRT-01 has an inhibition zone of ≥4 cm against the gastric pathogen Helicobacter pylori, significantly better than other strains (such as Lactococcus LL-3 with an inhibition level of ++).
[0073] Broad-spectrum bacteriostatic properties: Exhibits (++) level of inhibition (inhibition zone of 2-3 cm) against 7 kinds of pathogenic bacteria, and only Staphylococcus aureus and Salmonella are at the (+) level (<2 cm).
[0074] Four, mechanism analysis 1. Analysis of bacteriostatic mechanism TRT-01 may exert bacteriostatic effects through the following pathways: Metabolic products inhibit bacteria: Secretion of organic acids such as lactic acid and acetic acid to lower the environmental pH and inhibit the growth of pathogenic bacteria (such as Helicobacter pylori which is sensitive to acid); Bacteriocin synthesis: May produce antibacterial peptides such as plantaricin to destroy the cell membrane of pathogenic bacteria (requires subsequent proteomics verification); Nutritional competition: By consuming essential nutrients such as iron and amino acids, the proliferation of pathogenic bacteria is limited.
[0075] 2. Clinical application potential Gastric infection intervention: High efficiency inhibition of Helicobacter pylori (+++ level) suggests that TRT-01 can be used for the prevention or adjuvant treatment of gastric ulcer and gastritis, and to make up for antibiotic resistance problems; Multi-site mucosal protection: Broad-spectrum inhibition of oral, intestinal, and reproductive tract pathogens, suitable for the development of whole digestive tract microecological regulators, such as mouth tablets and intestinal probiotic preparations.
[0076] 3. Differences from existing technology Compared with single bacteriostatic strains (such as Lactobacillus acidophilus which only targets intestinal pathogens), TRT-01 has a broad-spectrum bacteriostatic spectrum covering five major system pathogens, and its inhibition effect on Helicobacter pylori is outstanding (most existing strains are ++ level).
[0077] Five, Conclusion Plantaricin TRT-01 shows broad-spectrum bacteriostatic activity against 10 clinical pathogens, especially Helicobacter pylori, and its mechanism may be related to the synergistic effect of acidic metabolites and antibacterial peptides. This strain has significant application potential in microecological balance regulation and multi-site infection prevention. Through the multiple mechanisms of metabolic product inhibition, nutritional competition, and immune regulation, it can specifically inhibit pathogenic bacteria in various mucosal sites, restore the balance of the bacterial flora, and inhibit the development of pathogenic bacterial colonies in various mucosal tissues, providing a core strain for the development of new antibacterial probiotic preparations.
[0078] Example 4: Preparation of a composition with anti-inflammatory and bacteriostatic efficacy I. Core ingredients and formula of the composition capsule 1. Plantaricin TRT-01 bacterial powder The strain is preserved in the China General Microbiological Culture Collection Center, with the preservation number CGMCC No. 32237 and the preservation date October 17, 2024.
[0079] Dosage: 1 x 10¹ 0 CFU of TRT-01 live bacteria per capsule.
[0080] 2. Auxiliary ingredients Fructooligosaccharides (FOS): 50 mg per capsule, to promote the colonization and proliferation of TRT-01 in the intestine.
[0081] Tea polyphenol: 20mg / capsule, synergistically enhances anti-inflammatory effect, inhibits activation of inflammatory signaling pathway NF-κB.
[0082] Microcrystalline cellulose: 100mg / capsule, as a filler to maintain the stability of the dosage form.
[0083] II. Preparation process 1. Strain culture and freeze-drying Activation: TRT-01 was inoculated in MRS liquid medium and cultured anaerobically at 37℃ for 24 hours, and subcultured 3 times to ensure activity.
[0084] Expansion: the activated bacterial solution was inoculated into a 50L fermenter and fermented at 37℃ and pH 6.5 for 16 hours, with a viable bacterial concentration of 1×10¹¹ CFU / mL.
[0085] Centrifugation and freeze-drying: the fermentation broth was centrifuged at 4℃ and 8000×g for 20 minutes to collect the bacteria, mixed with 10% skim milk, and freeze-dried at -40℃ for 48 hours, with a viable bacterial survival rate of ≥95%.
[0086] 2. Mixing and filling TRT-01 bacterial powder, FOS, tea polyphenol, and microcrystalline cellulose were passed through an 80-mesh sieve and mixed in a three-dimensional mixer at 20 revolutions per minute for 30 minutes.
[0087] A full-automatic capsule filling machine was used for filling, with a total mass of 200mg per capsule, and aluminum plastic packaging was performed, followed by storage at 4℃ in the dark.
Claims
1. A Lactiplantibacillus plantarum TRT-01 having anti-inflammatory and antibacterial functions, characterized in that, The plant Lactobacillus plantarum TRT-01 is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 32237, and the preservation date is October 17, 2024.
2. The plant Lactobacillus plantarum TRT-01 of claim 1 is used for preparing a composition for relieving inflammatory response.
3. Use according to claim 2, characterized in that, The plant Lactobacillus plantarum TRT-01 is used for preparing a composition for immune diseases induced by Th1 / Treg imbalance.
4. Use according to claim 3, characterized in that, The plant Lactobacillus plantarum TRT-01 regulates Th1 / Treg immune balance and relieves inflammatory response by inducing dendritic cells to secrete cytokines IL-10 and IL-12, inducing T cells to secrete cytokines TGF-β and IFN-γ, and inhibiting the secretion of cytokine IL-6.
5. Use according to claim 3, characterized in that, The immune diseases include allergic diseases, specific reaction diseases, and autoimmune diseases.
6. The plant Lactobacillus plantarum TRT-01 of claim 1 is used for preparing a composition for inhibiting pathogenic bacteria.
7. Use according to claim 6, characterized in that, The pathogenic bacteria include at least one of oral pathogenic bacteria, stomach pathogenic bacteria, throat pathogenic bacteria, intestinal pathogenic bacteria, and urogenital pathogenic bacteria.
8. Use according to claim 7, characterized in that, The oral pathogenic bacteria include Streptococcus mutans, Prevotella intermedia, and Actinobacillus actinomycetemcomitans; the stomach pathogenic bacteria include Helicobacter pylori; the intestinal pathogenic bacteria include Escherichia coli, Staphylococcus aureus, and Salmonella; the urogenital pathogenic bacteria include Candida albicans and Gardnerella; and the throat pathogenic bacteria include Streptococcus pneumoniae.
9. A composition having anti-inflammatory and antibacterial efficacy, characterized in that, The plant Lactobacillus plantarum TRT-01 of claim 1 is contained.
10. The method for preparing *Lactobacillus plantarum* TRT-01 as described in claim 1, characterized in that: The sample is collected from a traditional Chinese folk family self-pickled radish, then coated on MRS solid culture medium, and cultured anaerobically at 37°C for 48 hours, and the white colonies with typical morphological characteristics are picked and purified by multiple streaking until pure culture is obtained.
Citation Information
Cited By
Phytobacterium plantarum with prostatitis relieving and antibacterial functions and application thereof
CN122060654A