Application and method of CircAAGAB in regulation and control of proliferation and differentiation of bovine skeletal muscle satellite cells

Abstract

The invention belongs to the technical field of biology and cells, and discloses application of a circAAGAB gene in regulation and control of proliferation and differentiation of bovine skeletal muscle satellite cells, the circAAGAB gene truly exists and is in a ring shape, and the nucleotide sequence of the circAAGAB gene is shown as SEQ ID NO.1. The circAAGAB gene has a nucleotide sequence shown as SEQ ID NO.2. The circAAGAB gene has a nucleotide sequence shown as SEQ ID NO.1. According to the method disclosed by the invention, the proliferation and myogenic differentiation process of the bovine muscle satellite cells can be effectively regulated and controlled by regulating the expression of circAAGAB. A new enlightenment is provided for researching muscle development and differentiation, and an important reference is provided for exploring a muscle growth and development mechanism and improving the yield and quality of beef. In addition, a good foundation is laid for deeply discussing the action mechanism of circAAGAB in the muscle development process, and theoretical support is provided for rapid breeding and meat quality improvement of new varieties of high-quality beef cattle.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biology and cell technology, and particularly relates to an application and method of CircAAGAB in regulating proliferation and differentiation of bovine skeletal muscle satellite cells. BACKGROUND

[0002] Skeletal muscle is an important part of the body, accounting for about 40%-60% of the mature body weight of animals, and participating in activities such as movement, metabolism and internal balance of the body. Skeletal muscle is composed of multinucleated contractile muscle fibers, and muscle fibers are generated by fusion of multiple mononucleated myoblasts through myogenesis. The growth and development process of skeletal muscle: mesenchymal stem cells of mesoderm differentiate and redifferentiate to form mononucleated myoblasts; the mononucleated myoblasts fuse into spindle-shaped multinucleated myotubes under the action of cell mucin factors; muscle fibers are formed with the increase of the inner diameter of the myotubes and the movement of the nuclei to the periphery of the cell membrane; and muscle fibers continue to grow to form muscle tissue, which occurs during the embryonic period. After birth, the number of muscle fibers no longer changes, but the length and volume of muscle fibers increase, which is the growth process of skeletal muscle. The growth and development of skeletal muscle are regulated by various genetic factors, such as myogenic regulatory factors (MRFs), myogenic enhancer factor 2 (MEF2), PAX family, myostatin (MSTN), etc. in various ways. In addition to these specific transcriptional regulatory factors, small RNAs and non-coding RNAs (miRNA, lncRNA, circRNA) also play an important role in the regulation of animal skeletal muscle development.

[0003] Among them, circAAGAB belongs to exonic circular RNA, and circular RNA plays an important role in disease regulation and muscle development. Circular RNA has various biological functions, including: inhibiting the expression of miRNA by adsorbing miRNA; circular RNA located in the nucleus can participate in transcriptional regulation; circular RNA can regulate protein expression and affect protein structure by binding to RNA-binding proteins. In recent years, relevant research has gradually revealed its key role in skeletal muscle development. At present, there is still a lack of an efficient and stable means for directional induction of high-quality skeletal muscle satellite cells.

[0004] Research on circRNA in human diseases has made many breakthroughs, especially in diseases such as tumors and cancers. However, the research on circRNA in muscle development is still in its infancy. At present, based on the influence of circRNA on muscle development, the main researches are on the identification, expression pattern and regulation mechanism of circRNA. The specific regulation mechanism is still unclear. There is a lack of an efficient and stable regulation means for directional induction of high-quality skeletal muscle satellite cells. The research on circAAGAB gene in muscle cell development is insufficient, and the specific role of circAAGAB gene in muscle cell development has not been clearly studied.

[0005] Therefore, the present application finds that the circAAGAB gene has not been clearly studied in muscle cell development, so circAAGAB is taken as the research object, and interference and overexpression are carried out, respectively, and the regulation effect of the circAAGAB gene on the myogenic differentiation of bovine skeletal muscle satellite cells is detected by qRT-PCR technology and Western blot technology, so as to study the effect of circAAGAB on the myogenic differentiation process of bovine skeletal muscle satellite cells in vitro, and lay a foundation for further exploring the related genes affecting the development of beef.

[0006] Through retrieval, no patent disclosure related to the present patent application has been found. SUMMARY

[0007] The present application aims to overcome the deficiencies in the prior art, and provides the application and method of CircAAGAB in regulating the proliferation and differentiation of bovine skeletal muscle satellite cells.

[0008] The technical scheme adopted by the present application to solve its technical problems is:

[0009] The application of circAAGAB gene in regulating the proliferation and differentiation of bovine skeletal muscle satellite cells, wherein the circAAGAB gene exists in bovine skeletal satellite cells and is circular, and the nucleotide sequence is shown as SEQ ID No. 1, and specifically is:

[0010] ATATTCTTGGAACAGAAGACGTTGTTGTGGAAGTGACTGCCAATGATGCTGTGAGGTTTTATCCCTGGACCATCGATAATAAATACTACTCAGCAGATATCAATCTGTGCGTGGTGCCAAACAAATTTCTAGTCACCGCAGAGATTGCAGAGTCTGTCCAAGCATTTGTGGTTTACTTTGACAGCACACAAAAATCTGGTCTTGATAGTGTTTCCTCCTGGCTTCCTCTGGCAGAGTCGTGGTTACCTGAGGTGATGATCTTGGTCTGCGATAGAGTATCCGAGAATGGTGTAAACCGACAGAAAGCTCAAGAGTGGTGTATCAAACATGGCTTTGAATTGGTAGAACTTAGTCCGGAAGAGTTGCCTGAGGAAGATG.

[0011] Further, reducing the expression amount of the circAAGAB gene can inhibit the proliferation of muscle satellite cells and promote the differentiation of bovine muscle satellite cells; increasing the expression amount of the circAAGAB gene can promote the expression of bovine skeletal muscle satellite cells in the proliferation period and inhibit differentiation.

[0012] Further, the circAAGAB gene can regulate bovine skeletal muscle satellite cell myogenic differentiation and affect myotube formation.

[0013] A method for regulating bovine skeletal muscle satellite cell myogenic differentiation by a circAAGAB gene, the method being for regulating bovine skeletal muscle satellite cell myogenic differentiation by reducing the expression amount of circAAGAB and increasing the expression amount of the circAAGAB gene, the nucleotide sequence of the circAAGAB being shown as SEQ ID No. 1.

[0014] Further, the method comprises the following steps:

[0015] According to the sequence of the circAAGAB gene, siRNA and pcDNA3.1-circAAGAB overexpression plasmid vectors of the circAAGAB gene are designed and synthesized, and a control group si-NC and pcDNA3.1-(+) are set, and the siRNA and pcDNA3.1-circAAGAB are respectively transfected into bovine skeletal muscle satellite cells; the expression amounts of proliferation and differentiation marker genes between the control group and the experimental group are detected by qRT-PCR and Western blot technology, so as to detect the influence of the circAAGAB gene on the bovine skeletal muscle satellite cell myogenic differentiation process.

[0016] After the expression amount of the circAAGAB is reduced by the siRNA, the expression amount of the bovine skeletal muscle satellite cell differentiation marker gene is increased and the expression amount of the proliferation marker gene is decreased compared with the control group; after the circAAGAB is overexpressed by the pcDNA3.1-circAAGAB, the expression amount of the bovine skeletal muscle satellite cell differentiation marker gene is decreased and the expression amount of the proliferation marker gene is increased compared with the control group, which proves that the circAAGAB has a positive regulation effect on the proliferation of bovine skeletal muscle satellite cells.

[0017] Further, according to the sequence of the circAAGAB gene, si-RNA of the circAAGAB gene is designed and synthesized, the si-RNA is transfected into cells to ensure that the interference efficiency is more than 50%, the expression of the circAAGAB gene in bovine skeletal muscle satellite cells is interfered, and the influence on the proliferation and differentiation process is detected.

[0018] Or, according to the sequence of the circAAGAB gene, a pc-DNA3.1-circAAGAB overexpression recombinant plasmid of the circAAGAB gene is designed and synthesized, the pc-DNA3.1-circAAGAB is transfected into bovine skeletal muscle satellite cells, the expression amount of the circAAGAB in the bovine skeletal muscle satellite cells is increased, and the influence of the circAAGAB overexpression on muscle cell proliferation and differentiation is detected.

[0019] A method for promoting bovine skeletal muscle satellite cell proliferation by a circAAGAB gene, comprising the following steps:

[0020] An overexpression model of bovine circAAGAB is constructed, and the bovine circAAGAB overexpression model is transfected into bovine skeletal muscle satellite cells, the method is to promote the proliferation of bovine skeletal muscle satellite cells by promoting the expression of circAAGAB, and the nucleotide sequence of the circAAGAB is shown as SEQ ID No. 1.

[0021] A method for promoting bovine skeletal muscle satellite cell differentiation by a circAAGAB gene, comprising the following steps:

[0022] An interference RNA, i.e., si-RNA, of the circAAGAB gene is designed and synthesized, and the bovine siRNA is transfected into bovine skeletal muscle satellite cells, the method is to promote the differentiation of bovine skeletal muscle satellite cells by reducing the expression of circAAGAB, and the nucleotide sequence of the circAAGAB is shown as SEQ ID No. 1.

[0023] The method described above is applied to bovine skeletal muscle satellite cell myogenic differentiation.

[0024] The advantages and positive effects obtained by the present application are as follows:

[0025] 1. The present application can effectively regulate the proliferation and differentiation process of bovine muscle satellite cells by regulating the expression of circAAGAB. This provides a new inspiration for the study of muscle development and differentiation, and provides an important reference for exploring the mechanism of muscle growth and development, improving beef yield and quality, and providing theoretical support for the rapid cultivation of new varieties of high-quality beef cattle and meat quality improvement.

[0026] 2. The present application mainly regulates the change of the expression amount of the circAAGAB gene to affect the differentiation of bovine skeletal muscle satellite cells. This research provides an important reference for further exploring the role of muscle myogenic differentiation in muscle injury repair, and also lays a new research foundation for revealing the specific mechanism of muscle development.

[0027] 3、In view of the fact that it is not yet clear whether circAAGAB has a regulatory effect on bovine skeletal muscle satellite cells and its specific effect, the present application designs and synthesizes siRNA of circAAGAB, and transfects it into bovine skeletal muscle satellite cells to interfere with the expression level of circAAGAB in the cells, so as to explore its role in inhibiting the myogenic differentiation process of bovine skeletal muscle satellite cells. In addition, the present application also designs and synthesizes an overexpression plasmid vector (pcDNA3.1-circAAGAB) of circAAGAB, which is transfected into bovine skeletal muscle satellite cells to change the expression level of circAAGAB in the cells, so as to study its effect on promoting the proliferation of bovine skeletal muscle satellite cells. Based on the above method, the present application aims to provide a reference for the application of circAAGAB in muscle development, differentiation and injury repair, and open up new ideas and methods for related clinical research and treatment.

[0028] 4、The present application can more accurately simulate the muscle generation process of bovine skeletal muscle by expressing the circAAGAB gene. In this field, the research on how genes regulate skeletal muscle growth and development is gradually deepening. At the same time, this research provides a new type of intervention means for treating muscle injury repair related clinical diseases and achieving rapid increase of bovine skeletal muscle.

[0029] 5、The present application first discovers the regulatory effect of circAAGAB gene on bovine skeletal muscle satellite cell differentiation, that is, when circAAGAB gene is interfered, the proliferation of bovine skeletal muscle satellite cells is blocked, and overexpression of circAAGAB gene promotes the proliferation of bovine skeletal muscle satellite cells, indicating that circAAGAB has a positive regulatory effect on proliferation. The present application uses circAAGAB to regulate myogenic differentiation of muscle satellite cells, which can provide a basis for the research of muscle development and differentiation process, and provide a reference for further exploring the specific mechanism of muscle development and improving the yield and quality of beef. The circAAGAB gene can be used for rapid breeding of beef cattle, promoting rapid muscle growth and improving meat quality production.

[0030] 6、The circAAGAB gene of the present application can regulate bovine skeletal muscle satellite cell differentiation and affect myotube formation. First, circAAGAB gene is interfered or overexpressed to regulate bovine skeletal muscle satellite cell differentiation, and the method is to improve the endogenous expression amount of circAAGAB gene in bovine skeletal muscle satellite cells, or to reduce the endogenous expression amount of circAAGAB gene in bovine skeletal muscle satellite cells, so as to regulate the differentiation of bovine skeletal muscle satellite cells.

[0031] 7、The application discloses application of a circAAGAB gene in regulating development of bovine skeletal muscle satellite cells, and the circAAGAB gene actually exists and is circular.The method of the application can effectively regulate proliferation and myoblast differentiation of bovine muscle satellite cells by regulating expression of the circAAGAB, which provides new enlightenment for research on muscle development and differentiation, and provides an important reference for exploring muscle growth and development mechanism and improving beef yield and quality.In addition, the application lays a good foundation for in-depth exploration of the action mechanism of the circAAGAB in the muscle development process, and provides theoretical support for rapid cultivation of a new breed of high-quality beef cattle and improvement of beef quality. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 A series of experiments in the application verify the circular characteristics of the circAAGAB and the important role of the circAAGAB in the development process of bovine muscle satellite cells; the application verifies existence of a circular transcript circAAGAB of an AAGAB gene, determines a circular structure of the circAAGAB, Figure 1 A, B, C, quantitatively finds that the circAAGAB is highly expressed in muscle, Figure 1 D. The circAAGAB belongs to a down-regulated gene, and the expression amount of the circAAGAB is highest in a proliferation period, and continuously decreases with growth of a day age, Figure 1 E.;

[0033] Figure 2 The application designs a bovine skeletal muscle satellite cell interference model and an overexpression model of the circAAGAB gene, and transfects bovine skeletal muscle satellite cells (a test diagram of effects of interference RNA and overexpression plasmid of the circAAGAB); wherein, Figure 2 A, the interference effect of the circAAGAB gene is detected, Figure 2 B, the overexpression effect of the circAAGAB gene is detected;

[0034] Figure 3 The application adopts siRNA interference of the circAAGAB gene to detect results of proliferation and differentiation marker genes in bovine skeletal muscle satellite cells (a diagram of effects of interference of the circAAGAB on proliferation and differentiation of muscle satellite cells); wherein, Figure 3 A, 3-B are qRT-PCR detection results, and 3-C, 3-D are Western blot results;

[0035] Figure 4 The application adopts overexpression of the circAAGAB gene to detect results of proliferation and differentiation marker genes in bovine skeletal muscle satellite cells (a diagram of effects of overexpression of the circAAGAB on differentiation of muscle satellite cells); wherein, Figure 4A, 4-B are qRT-PCR detection results, 4-C, 4-D are Western blot results. DETAILED DESCRIPTION

[0036] The application is further described below in conjunction with examples, which are descriptive rather than limiting, and cannot be used to limit the protection scope of the application.

[0037] The various experimental operations involved in the specific embodiments are all conventional techniques in the art, and the parts not specifically annotated in the text can be implemented by referring to various commonly used tool books, scientific and technical literature or related instructions, manuals, etc. before the filing date of the present application.

[0038] The application of the circAAGAB gene in regulating the proliferation and differentiation of bovine skeletal muscle satellite cells, the circAAGAB gene exists in bovine skeletal satellite cells and is circular, and the nucleotide sequence is shown as SEQ ID No. 1, specifically:

[0039] ATATTCTTGGAACAGAAGACGTTGTTGTGGAAGTGACTGCCAATGATGCTGTGAGGTTTTATCCCTGGACCATCGATAATAAATACTACTCAGCAGATATCAATCTGTGCGTGGTGCCAAACAAATTTCTAGTCACCGCAGAGATTGCAGAGTCTGTCCAAGCATTTGTGGTTTACTTTGACAGCACACAAAAATCTGGTCTTGATAGTGTTTCCTCCTGGCTTCCTCTGGCAGAGTCGTGGTTACCTGAGGTGATGATCTTGGTCTGCGATAGAGTATCCGAGAATGGTGTAAACCGACAGAAAGCTCAAGAGTGGTGTATCAAACATGGCTTTGAATTGGTAGAACTTAGTCCGGAAGAGTTGCCTGAGGAAGATG.

[0040] Preferably, reducing the expression amount of the circAAGAB gene can inhibit the proliferation of muscle satellite cells and promote the differentiation of bovine muscle satellite cells; increasing the expression amount of the circAAGAB gene can promote the expression of bovine skeletal muscle satellite cells in the proliferation period and inhibit differentiation.

[0041] Preferably, the circAAGAB gene can regulate the myogenic differentiation of bovine skeletal muscle satellite cells and affect myotube formation.

[0042] A method for regulating myogenic differentiation of bovine skeletal muscle satellite cells by circAAGAB gene, the method is to regulate the myogenic differentiation of bovine skeletal muscle satellite cells by reducing the expression amount of circAAGAB and increasing the expression amount of circAAGAB gene, the nucleotide sequence of circAAGAB is shown as SEQ ID No. 1.

[0043] More preferably, the method comprises the following steps:

[0044] According to the sequence of the circAAGAB gene, the siRNA and the pcDNA3.1-circAAGAB overexpression plasmid vector of the circAAGAB gene are designed and synthesized, and the control group si-NC and pcDNA3.1-(+) are set, and the siRNA and the pcDNA3.1-circAAGAB are respectively transfected into bovine skeletal muscle satellite cells; the expression amount of the proliferation and differentiation marker genes between the control group and the experimental group is detected by qRT-PCR and Western blot technology, so as to detect the influence of the circAAGAB gene on the myogenic differentiation process of bovine skeletal muscle satellite cells.

[0045] After the expression amount of circAAGAB is reduced by siRNA, the expression amount of the differentiation marker gene of bovine skeletal muscle satellite cells is increased, and the expression amount of the proliferation marker gene is decreased compared with the control group; the expression of circAAGAB is overexpressed by pcDNA3.1-circAAGAB, and the expression amount of the differentiation marker gene of bovine skeletal muscle satellite cells is decreased, and the expression amount of the proliferation marker gene is increased compared with the control group, which proves that circAAGAB has a positive regulation effect on the proliferation of bovine skeletal muscle satellite cells.

[0046] More preferably, according to the sequence of the circAAGAB gene, the si-RNA of the circAAGAB gene is designed and synthesized, the si-RNA is transfected into cells, the interference efficiency is ensured to be more than 50%, the expression of the circAAGAB gene in bovine skeletal muscle satellite cells is interfered, and the influence on the proliferation and differentiation process is detected.

[0047] Alternatively, according to the sequence of the circAAGAB gene, the pc-DNA3.1-circAAGAB overexpression recombinant plasmid of the circAAGAB gene is designed and synthesized, the pc-DNA3.1-circAAGAB is transfected into bovine skeletal muscle satellite cells, the expression amount of circAAGAB in bovine skeletal muscle satellite cells is increased, and the influence of circAAGAB overexpression on muscle cell proliferation and differentiation is detected.

[0048] A method for promoting the proliferation of bovine skeletal muscle satellite cells by circAAGAB gene, comprising the following steps:

[0049] The method comprises the following steps: constructing a circAAGAB overexpression model, and transfecting the circAAGAB overexpression model into bovine skeletal muscle satellite cells, so as to promote the proliferation of the bovine skeletal muscle satellite cells by promoting the expression of circAAGAB, wherein the nucleotide sequence of the circAAGAB is shown as SEQ ID No. 1.

[0050] A method for promoting the differentiation of bovine skeletal muscle satellite cells by a circAAGAB gene, comprising the following steps:

[0051] The method comprises the following steps: designing and synthesizing si-RNA of the circAAGAB gene, and transfecting the bovine siRNA into bovine skeletal muscle satellite cells, so as to promote the differentiation of the bovine skeletal muscle satellite cells by reducing the expression of circAAGAB, wherein the nucleotide sequence of the circAAGAB is shown as SEQ ID No. 1.

[0052] The method is applied to the myogenic differentiation of bovine skeletal muscle satellite cells.

[0053] Specifically, the preparation and detection are as follows:

[0054] The design idea of the present application is:

[0055] The interference model and the overexpression model of the circAAGAB gene are constructed, and the bovine skeletal muscle satellite cells are transfected by Lipofectamine tM 3000 reagent (Thermo Fisher Scientific) to reduce the expression level of the circAAGAB gene of the bovine skeletal muscle satellite cells, inhibit the proliferation of the bovine skeletal muscle satellite cells, promote the differentiation of the bovine skeletal muscle satellite cells, overexpress the circAAGAB gene, promote the proliferation of the bovine skeletal muscle satellite cells, and inhibit the differentiation of the bovine skeletal muscle satellite cells.

[0056] The application and method of the circAAGAB gene in regulating the differentiation of bovine skeletal muscle satellite cells, comprising the following steps:

[0057] Step 1: isolation and culture of bovine skeletal muscle satellite cells, and establishment of an in-vitro differentiation model.

[0058] The specific steps are as follows:

[0059] Isolation and culture of cells, and establishment of an in-vitro transfection and differentiation model:

[0060] The main reagents used in the culture process are growth medium (10% fetal bovine serum + 90% DMEM high-sugar medium) and differentiation medium (2% horse serum + 98% DMEM high-sugar medium).

[0061] Isolation of bovine skeletal muscle satellite cells according to the method of trypsin and type II collagenase. Under sterile conditions, the hind leg muscles of 3-month-old fetal bovine were isolated, cut into fine meat paste, 1x PBS buffer (pH 7.2-7.4) was used to collect the meat paste into a centrifuge tube, the centrifuge tube was placed in a centrifuge at a speed of 1000 r / min for 5 min, the supernatant was discarded, 5 ml of 0.2% collagenase II was added and digested in a 37°C water bath for 1 h, with vortex oscillation every 10 min for 10 s during the period, then 0.25% trypsin containing EDTA was added and digested for 30 min, with vortex oscillation every 10 min for 10 s during the period, and finally 20% fetal bovine serum medium (20% FBS + 80% DMEM) was added to terminate the digestion, the above mixture was filtered through 100 mesh, 200 mesh and 400 mesh cell screens, the filtrate was collected into a 50 ml centrifuge tube, centrifuged in a centrifuge at 1000 r / min for 10 min, resuspended with medium (20% FBS + 80% DMEM), inoculated into a suitable culture dish, and cultured in a 37°C, 5% CO2 incubator. Cultured in DMEM growth medium containing 20% fetal bovine serum, when the cells grew to 80% confluence, 2% horse serum-containing DMEM differentiation medium was added for in vitro myogenic induction and differentiation, the differentiation of muscle satellite cells and the formation of myotubes were observed, and an in vitro myogenic induction and differentiation model of bovine skeletal muscle satellite cells was established.

[0062] Step 2: Detection of the effects of the interference model and the overexpression model of circAAGAB.

[0063] According to the sequence of the circAAGAB gene, interference RNA (siRNA) and overexpression plasmid vector (pcDNA3.1-circAAGAB) were designed and synthesized, transfected into bovine skeletal muscle satellite cells, and the expression level of circAAGAB was detected by quantitative PCR method to detect the interference effect of siRNA on circAAGAB and the overexpression effect of pcDNA3.1-circAAGAB on circAAGAB;

[0064] The specific steps are as follows:

[0065] (1) Design and synthesis of interference RNA (siRNA) of circAAGAB.

[0066] According to the base sequence of circAAGAB, siRNA (si-circAAGAB-1 and si-circAAGAB-2, as shown in Table 1) was designed and synthesized by a biological company.

[0067] Table 1 si-circAAGAB sequence information

[0068] Fragment name Sense (5'-3') Antisense (5'-3') circAAGAB Interference 1 AGAAGACGUUGUUGUGGAA UUCCACAACAACGUCUUCU circAAGAB Interference 2 GGUAGAACUUAGUCCGGAA UUCCGGACUAAGUUCUACC

[0069] (2) Establishment of bovine skeletal muscle satellite cell overexpression model.

[0070] The pcDNA3.1-Circ Mini Vector was selected to promote the circularization of the vector, and the full-length sequence of circAAGAB was designed and synthesized. The recombinant plasmid was synthesized by Shanghai Ebos Biotechnology Co., Ltd., and the plasmid was extracted for subsequent overexpression experiments.

[0071] (3) Cell transfection

[0072] The main reagents used during the culture process were growth medium (10% fetal bovine serum + 90% DMEM high-sugar medium) and differentiation medium (2% horse serum + 98% DMEM high-sugar medium).

[0073] The cell density change in the culture dish was observed in real time by optical microscope, and cell transfection was performed when the cell adhesion rate reached 80%. According to the actual liquid volume size of the selected transfection well plate, the sample was added to ensure the target transfection efficiency. The specific steps are as follows:

[0074] Bovine myoblasts were inoculated into 12-well plates or 6-well plates, and the culture medium was replaced when the cell density was about 80% for transfection. After incubation at room temperature for 15 minutes, the transfection mixture was slowly added to the cells, and the culture plate was gently shaken to ensure that the transfection mixture could fully penetrate into the cells. Then, the culture plate was returned to the cell incubator for overnight culture, and the new culture medium was replaced. Continue to culture the cells for 24 hours, then collect the cells in the proliferation phase, and perform the related processing and identification work. At the same time, the culture medium was replaced with induction differentiation medium, and the cells were collected after 48 hours of differentiation, and the related identification analysis was performed.

[0075] (4) Using qRT-PC technology to screen and obtain circAAGAB recombinant plasmid (pcDNA3.1-circAAGAB) with overexpression effect, and small interfering RNA (si-circAAGAB, two interference sequences were designed, only si1 interference efficiency was successful, so only si1) with inhibitory effect of circAAGAB gene. Confirm the effective transfection of bovine skeletal muscle satellite cells. The results are shown in Figure 2, interference RNA transfection (si-NC and si-circAAGAB-1 and si-circAAGAB6-2, and circAAGAB overexpression plasmid vector (pcDNA3.1(+) and pcDNA3.1) transfection. The interference effect of circAAGAB-2 is not significant (P>0.05), while the interference efficiency of si-circAAGAB-1 on circAAGAB gene is significant (P<0.01) Figure 2 -A). After overexpression of circAAGAB, the results of qRT-PCR detection show that the expression amount of circAAGAB is up-regulated by 40 times compared with the control group (P<0.01) Figure 2 -B). (* indicates P<0.05, ** indicates P<0.01).

[0076] Extraction of total RNA and reverse transcription:

[0077] Extraction of total RNA of skeletal muscle satellite cells needs to be extracted according to the instructions of Trizol reagent, and the specific steps are as follows:

[0078] Cell sample collection: discard the original culture medium, wash twice with enzyme-free PBS, add 500 μL Reagent lysis solution, blow and suck 10 times at room temperature, quickly collect the lysis solution into an enzyme-free centrifuge tube, stand on ice for 20 min, and observe the residual situation in the cell culture plate under a microscope. Add 200 μL chloroform, shake vigorously for 15 seconds, and stand at room temperature for 10 minutes. 4℃, 12000rpm centrifugation for 10 minutes, carefully transfer the supernatant to a new centrifuge tube for standby. Add 300 μL isopropanol, mix gently, stand at room temperature for 30 minutes. 4℃, 12000rpm centrifugation for 10 minutes, discard the supernatant, carefully reserve the sediment. Add 1 mL of 75% enzyme-free ethanol, gently and slowly wash, ice bath for 5 minutes. 4℃, 7500rpm centrifugation for 10 minutes, discard the supernatant, leave the sediment, after the centrifuge tube is inverted and dried at room temperature, add 20 μL DEPC water to dissolve, store at-80℃. Measure the concentration and OD260 / 280 ratio of the obtained total RNA, and prepare a 2% agarose gel for electrophoresis analysis. Mix 1 μL 4x loading buffer with 3 μL RNA sample uniformly, and then load, electrophorese at 120V for 15 minutes, to detect the quality of RNA.

[0079] Reverse transcription of total RNA of skeletal muscle satellite cells is carried out according to the instructions of All-in-One tM First-Strand cDNA Synthesis Kit. The specific steps are as follows:

[0080] According to the following configuration 25 μL reaction system, the prepared reaction body is mixed and the following Tables 1, 2 reactions are carried out.

[0081] Table 2 RNA reverse transcription first step

[0082]

[0083] Table 3 total RNA reverse transcription first step reaction procedure

[0084] Temperature °C Time 65℃ 10 min 4℃ ∝

[0085] Table 4 RNA reverse transcription first step

[0086]

[0087]

[0088] Table 5 total RNA reverse transcription second step reaction procedure

[0089] Temperature °C Time 37℃ 60 min 85℃ 5 min 4℃ ∝

[0090] The RNA expression amount of the gene is detected by using a qRT-PCR method, and the specific steps are as follows:

[0091] The cDNA sample obtained by reverse transcription is subjected to cDNA real-time fluorescence quantitative PCR, and the reaction solution is configured according to the following system, and 4 repeats are set for each sample (PCR primer Table 7).

[0092] qRT-PCR conditions: pre-denaturation 95℃, 10min, cycle number 1; denaturation temperature 95℃, 10sec; annealing temperature 60℃, 20sec; extension temperature 72℃, 15sec; cycle number 40.

[0093] Table 6 qRT-PCR system

[0094]

[0095] Table 7 primer sequence information

[0096]

[0097]

[0098] Step 3: detecting the effects of interfering circAAGAB and overexpressing circAAGAB on the proliferation and differentiation of bovine skeletal muscle satellite cells, respectively:

[0099] The siRNA and pcDNA3.1-circAAGAB are used to transfect the bovine skeletal muscle satellite cells, and then the muscle satellite cells are induced to proliferate and differentiate. The expression of the proliferation and differentiation marker gene M is detected by quantitative PCR and Western blot technology to evaluate the influence of the expression change of circAAGAB on the proliferation and differentiation of the bovine muscle satellite cells.

[0100] The specific steps are as follows:

[0101] The main reagents used in the culture process are the growth medium (10% fetal bovine serum + 90% DMEM high-sugar medium) and the differentiation medium (2% horse serum + 98% DMEM high-sugar medium).

[0102] The circAAGAB is transfected into the bovine skeletal muscle satellite cells by using the thermo Invitrogen L3000015 liposome 3000 transfection reagent, and the specific operation is the same as the transfection method in the second step. After 24 hours of transfection, the culture medium is replaced with the myogenic induction and differentiation medium, and the muscle satellite cells are induced and differentiated in a 37°C constant temperature incubator for 48 hours. The mRNA expression of the proliferation and differentiation marker genes is detected by quantitative PCR, the primer sequences are shown in Table 7, and the detection results are shown in Figure 3 As shown in the table, the results show that after the interference of circAAGAB, the expression levels of the differentiation marker factors are significantly increased, and the expression levels of the proliferation marker factors are decreased. In addition, as shown in Figure 4 After the overexpression of circAAGAB, the expression levels of the differentiation marker factors are significantly decreased, and the expression levels of the proliferation marker factors are increased.

[0103] According to the instructions of the "one-step PAGE gel preparation kit", the separation gel and the concentration gel are prepared:

[0104] Stand for 45 min to complete the preparation. Place the rack in the electrophoresis tank, and electrophorese at 70-80V for 20 min and at 120V for 50 min.

[0105] An appropriate amount of transfer liquid is added to the tray, then the gel plate is taken out from the electrophoresis tank and placed in the tray. The glass plate is gently pried open with a spatula, and the gel is completely immersed in the transfer liquid. Then, the excess gel part is cut off with a spatula, and only the desired target gel is reserved. According to the size of the reserved gel, cut the filter paper and PVDF membrane of the corresponding size, make sure that the PVDF membrane is slightly larger than the filter paper, and the filter paper is slightly larger than the gel. The cut PVDF membrane is immersed in methanol to activate the molecules on the membrane. Place the clamp in the tray, make sure that the transparent side is facing up and the black side is facing down. Then, clamp them in the order of black clamp-sponge pad-filter paper-gel-transfer membrane-filter paper-sponge pad-white clamp. Place the clamped device in the transfer tank, pour enough transfer liquid, and place the entire transfer tank in an ice bowl. Set the current to 300 mA and transfer for 2 h. After the transfer is completed, take out the PVDF membrane and place it in the blocking solution, making sure that the side close to the gel is the front side, and the front side is facing up for 2 h of shaking bed blocking. After the blocking process is completed, wash it with TBST for 3 times, each for 10 min. Use a glass slide, a knife, and tweezers to cut the PVDF membrane according to the size of the desired band, and make sure that the PVDF membrane is wet during the process. Prepare a hybridization strip, add the primary antibody, and place the PVDF membrane in the hybridization strip for overnight incubation at 4°C. Cut the hybridization strip and place the overnight incubated PVDF membrane in the Western blotting membrane washing box. Wash the overnight incubated PVDF membrane with TBST for 3 times, each for 10 min. After washing, incubate the secondary antibody for the primary antibody species for 1 h on a shaking bed, and then wash it with TBST for 3 times, each for 10 min. Mix the luminescent solution A and the luminescent solution B at a volume ratio of 1:1, wrap them with tin paper, and use them immediately after preparation. Place the front side of the strip in the high-sensitivity chemiluminescence imaging analysis system, add the luminescent solution to the strip, expose it, and store the image. Figure 3 The protein expression of differentiation marker factors significantly decreased and the protein expression of proliferation marker factors increased after overexpression of circAAGAB, indicating that down-regulation of circAAGAB can promote myogenic differentiation of muscle satellite cells, and overexpression of circAAGAB promotes the expression of bovine skeletal muscle satellite cells in the proliferation stage. The above research results suggest that changing the expression of muscle development and differentiation related circAAGAB in bovine skeletal muscle satellite cells can affect the myogenic differentiation process of bovine skeletal muscle satellite cells.

[0106] Although the embodiments of the present application have been disclosed for illustrative purposes, those skilled in the art can understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present application and the appended claims, and thus the scope of the present application is not limited to the disclosed embodiments.

Claims

1. Application of the circAAGAB gene in regulating the proliferation and differentiation of bovine skeletal muscle satellite cells, wherein the circAAGAB gene is present in bovine skeletal satellite cells and is circular, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that: Decreasing the expression level of the circAAGAB gene can inhibit the proliferation of bovine muscle satellite cells and promote their differentiation; increasing the expression level of the circAAGAB gene can promote the expression of bovine skeletal muscle satellite cells during the proliferative phase and inhibit their differentiation.

3. The application according to claim 1 or 2, characterized in that: The circAAGAB gene can regulate the myogenic differentiation of bovine skeletal muscle satellite cells and affect myotube formation.

4. A method for regulating bovine skeletal muscle satellite cell myogenic differentiation via the circAAGAB gene, characterized in that: The method described above regulates the myogenic differentiation of bovine skeletal muscle satellite cells by reducing the expression level of circAAGAB and increasing the expression level of the circAAGAB gene. The nucleotide sequence of circAAGAB is shown in SEQ ID No.

1.

5. The method according to claim 4, characterized in that: Includes the following steps: Based on the sequence of the circAAGAB gene, interfering RNA (siRNA) and overexpression plasmid vector (pcDNA3.1-circAAGAB) were designed and synthesized. Control groups (si-NC and pcDNA3.1-(+)) were set up. The siRNA and overexpression plasmid vector (pcDNA3.1-circAAGAB) were transfected into bovine skeletal muscle satellite cells, respectively. The expression levels of proliferation and differentiation marker genes between the control and experimental groups were detected by qRT-PCR and Western blot techniques to examine the effect of the circAAGAB gene on the myogenic differentiation process of bovine skeletal muscle satellite cells. After siRNA reduced the expression level of circAAGAB, the expression levels of differentiation markers of bovine skeletal muscle satellite cells increased and the expression levels of proliferation markers decreased compared with the control group. Overexpression of circAAGAB by pcDNA3.1-circAAGAB resulted in decreased expression levels of differentiation marker genes and increased expression levels of proliferation markers of bovine skeletal muscle satellite cells compared with the control group, demonstrating that circAAGAB has a positive regulatory effect on the proliferation of bovine skeletal muscle satellite cells.

6. The method according to claim 4 or 5, characterized in that: Based on the sequence of the circAAGAB gene, we designed and synthesized interfering RNA (si-RNA) for the circAAGAB gene. We then transfected the si-RNA into cells to ensure an interference efficiency of over 50%, thereby interfering with the expression of the circAAGAB gene in bovine skeletal muscle satellite cells and examining its effects on proliferation and differentiation. Alternatively, based on the sequence of the circAAGAB gene, a pc-DNA3.1-circAAGAB overexpression recombinant plasmid can be designed and synthesized. The pc-DNA3.1-circAAGAB can be transfected into bovine skeletal muscle satellite cells to increase the expression level of circAAGAB in bovine skeletal muscle satellite cells, and the effect of circAAGAB overexpression on myocyte proliferation and differentiation can be detected.

7. A method for promoting the proliferation of bovine skeletal muscle satellite cells via the circAAGAB gene, characterized in that: Includes the following steps: An overexpression model of bovine circAAGAB was constructed, and the bovine circAAGAB overexpression model was transfected into bovine skeletal muscle satellite cells. The method promotes the proliferation of bovine skeletal muscle satellite cells by promoting the expression of circAAGAB. The nucleotide sequence of circAAGAB is shown in SEQ ID No.

1.

8. A method for promoting bovine skeletal muscle satellite cell differentiation via the circAAGAB gene, characterized in that: Includes the following steps: Interference RNA (siRNA) for the circAAGAB gene was designed and synthesized. The bovine siRNA was transfected into bovine skeletal muscle satellite cells. The method promotes the differentiation of bovine skeletal muscle satellite cells by reducing circAAGAB expression. The nucleotide sequence of circAAGAB is shown in SEQ ID No.

1.

9. The application of the method as described in any one of claims 4 to 8 in the myogenic differentiation of bovine skeletal muscle satellite cells.

Images