Use of a plasma tsRNA molecular marker in preparation of a kit for diagnosing early Alzheimer's disease

Abstract

The application discloses a kind of plasma tsRNA molecular markers in preparation diagnosis early Alzheimer's disease in the application of kit, characterized by tsRNA molecular marker is tRF-Lys-TTT-3, its nucleotide sequence is as shown in SEQ ID NO.1: TCTGAGGGTCCAGGGTTCAAGTCCCTGTTCGGGCGCC, the kit includes the forward and reverse primers of fluorescent quantitative PCR for amplifying tRF-Lys-TTT-3, respectively TCTGAGGGTCCAGGGTTCAAGT and TATGGTTGTTGACGACTGGTTGAC, advantage is that the marker is higher in plasma Stability, expression is rich, with good diagnostic performance, high sensitivity, strong specificity, can effectively improve the early screening rate of AD, provide strong support for clinical intervention and accurate treatment.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of Alzheimer's disease diagnosis, and in particular to application of a plasma tsRNA molecular marker in preparation of a kit for diagnosing early Alzheimer's disease. BACKGROUND

[0002] Alzheimer's disease (AD) is a progressive neurodegenerative disease, mainly manifested as gradual decline in cognitive function, ultimately affecting the patient's memory, thinking and daily life ability. Its pathological features include deposition of beta-amyloid protein (Aβ), over-phosphorylation of tau protein and neuroinflammation, etc., which lead to neuronal damage and death, and ultimately cause cognitive dysfunction.

[0003] Currently, the diagnosis of AD mainly relies on the detection of Aβ / tau levels in cerebrospinal fluid and PET imaging technology. Although the cerebrospinal fluid collection method can effectively reflect the pathological changes in the brain, it is highly invasive and expensive, and the operation of each collection is inconvenient, which limits its application in large-scale screening. Although PET imaging technology has high diagnostic sensitivity, its high cost and radiation risk limit its application to only a few high-risk patients, making it difficult to be widely used in early diagnosis of AD. Therefore, there is an urgent need for a high-sensitivity, non-invasive early diagnostic marker to enable precise screening and intervention in the early stages of AD. This need provides impetus for the development of new diagnostic technologies.

[0004] In recent years, tRNA-derived small RNAs (tsRNAs) have become a research hotspot due to their potential in neurodegenerative diseases. tsRNAs are a class of non-coding RNAs generated by specific cleavage of mature tRNAs or their precursors, typically between 18 and 40 nucleotides in length, and mainly include tRNA halves (tiRNAs) and tRNA-derived fragments (tRFs). tsRNA molecules have 5' end phosphorylation modification and 3' end CCA tail structure, which endow them with strong nuclease resistance, allowing them to maintain high stability in body fluids such as blood and cerebrospinal fluid. Compared to traditional cerebrospinal fluid detection, tsRNAs can be detected through non-invasive collection (such as plasma), which makes them have a very broad application prospect in early screening. Moreover, tsRNAs have higher stability and abundance in plasma than other non-coding RNAs (such as lncRNAs and miRNAs), making them potential circulating biomarkers. Therefore, developing a plasma tsRNA-based diagnostic marker for early Alzheimer's disease has important clinical significance. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a plasma tsRNA molecular marker with high diagnostic sensitivity and specificity for preparing a kit for diagnosing early Alzheimer's disease.

[0006] The application solves the above technical problems by adopting the technical scheme of application of a plasma tsRNA molecular marker in preparation of a kit for diagnosing early Alzheimer's disease, wherein the tsRNA molecular marker is tRF-Lys-TTT-3, and the nucleotide sequence of the tRF-Lys-TTT-3 is shown in SEQ ID NO. 1: 5'-TCTGAGGGTCCAGGGTTCAAGTCCCTGTTCGGGCGCC-3'.

[0007] Further, the kit comprises a fluorescent quantitative PCR forward primer and a fluorescent quantitative PCR reverse primer for amplifying the tRF-Lys-TTT-3, the nucleotide sequence of the fluorescent quantitative PCR forward primer is SEQ ID NO. 2: 5'-TCTGAGGGTCCAGGGTTCAAGT-3', and the nucleotide sequence of the fluorescent quantitative PCR reverse primer is SEQ ID NO. 3: 5'-TATGGTTGTTGACGACTGGTTGAC-3'.

[0008] Compared with the prior art, the application has the advantages that the application discloses application of a plasma tsRNA molecular marker in preparation of a kit for diagnosing early Alzheimer's disease, wherein the tRF-Lys-TTT-3 molecular marker is highly expressed in the plasma of patients with early Alzheimer's disease, can be detected by peripheral blood liquid biopsy, has small trauma and is easy to obtain. The plasma tsRNA molecular marker tRF-Lys-TTT-3 of a patient is detected by using the collected peripheral blood sample, so that early diagnosis of patients with Alzheimer's disease can be conveniently, quickly and efficiently performed at the molecular level, the early AD detection rate is improved, the early diagnosis and early warning of early Alzheimer's disease are provided by the application, high-risk patients can be identified in time, clinical intervention is guided, and early discovery and timely treatment of Alzheimer's disease are facilitated. BRIEF DESCRIPTION OF DRAWINGS

[0009] Figure 1 FIG. 1 is a cluster heat map of the plasma tsRNA expression profiles of early AD patients and healthy volunteers in the screening set of samples;

[0010] Figure 2 FIG. 2 is a volcano plot of the expression level difference of tsRNA between the early AD patient group and the healthy volunteer group in the screening set of samples, wherein the X axis usually represents the fold difference of gene expression, and the Y axis represents the statistical significance of the difference;

[0011] Figure 3 FIG. 3 is a gel electrophoresis result map of the PCR product of tRF-Lys-TTT-3;

[0012] Figure 4 Significant difference analysis results of tRF-Lys-TTT-3 between healthy volunteer group and early AD patient group in small sample data set;

[0013] Figure 5 Significant difference analysis results of tRF-Lys-TTT-3 between healthy volunteer group and early AD patient group in large sample data set;

[0014] Figure 6 Area under ROC curve and diagnostic value of tRF-Lys-TTT-3 between early AD patient group and healthy volunteer group. DETAILED DESCRIPTION

[0015] The application will be further described in detail below with reference to the embodiments of the drawings.

[0016] Specific embodiment one: screening tRF-Lys-TTT-3 as an early AD diagnostic biomarker.

[0017] Screening sample collection: 3 cases of AD diagnosed patients admitted to the Department of Neurology of the First Affiliated Hospital of Ningbo University in April 2023 were collected, and 3 cases of healthy people were selected as controls. All patients signed the informed consent form before operation, and the research was approved by the hospital ethics committee.

[0018] AD group inclusion criteria: the inclusion criteria of the AD group include age between 50 and 85 years old, gender unrestricted; meeting the diagnostic criteria of the National Institute on Aging-Alzheimer's Association (NIA-AA 2011) modified in 2011; on cognitive assessment, the total score of Clinical Dementia Rating Scale (CDR-GS) is ≥0.5, and the total score of Mini-Mental State Examination (MMSE) is ≤26; biomarker requires positive detection by Aβ-PET or cerebrospinal fluid (CSF) Aβ; and memory decline has lasted for at least 12 months. The patient himself or his guardian needs to sign the informed consent form and voluntarily participate in the research. The exclusion criteria of the AD group include: if there is other disease that may cause cognitive decline, such as vascular dementia, Parkinson's disease, etc., or brain imaging examination finds infarction lesion larger than 2 cm or other space-occupying lesions; individuals with a history of stroke, transient ischemic attack (TIA) or epilepsy within 6 months before screening also need to be excluded. In addition, if there is a mental illness such as schizophrenia, major depression, or the Hachinski ischemic score is greater than 4, and the Hamilton Depression Scale (HAMD) score is greater than 10, the patient also does not meet the inclusion criteria. Individuals known to be HIV positive or with a history of neurosyphilis also need to be excluded, severe cardiovascular disease, important organ dysfunction, recent history of malignant tumor, contraindication of magnetic resonance imaging (MRI), etc. are also exclusion criteria.

[0019] Inclusion criteria for healthy control group: The inclusion criteria for the healthy control group required that the subjects be similar in age to the AD group and that the results of the clinical examination of the nervous system be normal. The mental and cognitive functions were within the normal range, and the subjects were able to live independently and had the ability to participate in the study. Exclusion criteria for the healthy control group: The exclusion criteria for the healthy control group included the presence of a family history of Alzheimer's disease (AD), abnormal thyroid hormone, liver and kidney function, and did not meet the criteria. In addition, individuals with infectious diseases such as syphilis, HIV, or positive tumor markers, or brain imaging suggesting structural or pathological changes were not included. Other serious underlying diseases such as diseases affecting the nervous system were also excluded.

[0020] Collection of plasma samples: During the clinical sample collection process of this study, fasting venous blood was collected from early AD patients and healthy volunteers. The elbow vein was selected for puncture, and 5 mL of venous blood was collected. After collection, the blood samples were left to stand at 4°C for 30 min to promote the natural sedimentation of blood components, and then placed in a high-speed centrifuge (centrifugation conditions: 3000 g / min, 5 min). After centrifugation, the upper layer of the yellow transparent plasma was carefully extracted using an enzyme-free disposable pipette into an enzyme-free centrifuge tube, and stored in a -80°C refrigerator to ensure its quality and stability. Due to the easily degradable nature of RNA, the extraction of total RNA from plasma is usually performed on the same day to maximize the integrity and activity of RNA.

[0021] Differential expression analysis of plasma tsRNA in early AD patients and healthy volunteers: R language was used for differential expression analysis of tsRNA. The P The absolute value of the difference ratio and the P value were used to screen tsRNA molecules with significant differential expression between the case group and the control group. We defined tsRNA with a difference ratio absolute value > 1.5 and P value < 0.05 as significantly differentially expressed. Volcano plots and heat maps were used to display differentially expressed tsRNA.

[0022] Unsupervised hierarchical tsRNA clustering heat map analysis was used to analyze the differential tsRNA expression profiles between early AD patients and healthy volunteers. The results are shown in FIG. 6. Figure 1As shown, expression levels on the heatmap are represented by different colors, ranging from blue (below average) to red (above average). K-means clustering was used to classify and separate the samples. Genes with similar expression patterns were clustered together. The clustering analysis heatmap visually reflects the significant differences in expression patterns between early-stage AD patients and healthy volunteers. Volcano plots were used to compare tsRNA expression levels between the two groups. Volcano plots of differentially expressed tsRNAs can directly display the fold change (FC) of tsRNA expression and the significance of these differences, and can visually obtain information on tsRNA upregulation and downregulation. According to FC>1.5, P Statistical analysis was performed using a threshold of <0.05, resulting in 14 significantly differentially expressed tsRNAs. For example... Figure 2 As shown, one upregulated tsRNA is indicated in red, 13 downregulated tsRNAs are indicated in green, and tsRNAs with no significant difference in expression between the two groups are indicated in gray.

[0023] 6. Identification of differentially expressed tsRNAs: This study primarily focused on molecules with the most significant changes in expression levels and high expression between the case and control groups, as these molecules are most likely to serve as early diagnostic biomarkers. For example... Figure 2 The selected highly expressed tsRNA (tRF-Lys-TTT-3) was chosen as the target gene. The nucleotide sequence of tRF-Lys-TTT-3 is shown in SEQ ID NO.1: 5'-TCTGAGGGTCCAGGGTTCAAGTCCCTGTTCGGGCGCC-3', with a fold change of 1457. P The value of 0.025 indicates that it has potential diagnostic value in early Alzheimer's disease.

[0024] Specific Example 2: The diagnostic value of tRF-Lys-TTT-3 as a molecular marker for early AD.

[0025] 1. Sample Collection: In addition, 90 patients diagnosed with early-stage Alzheimer's disease (AD) admitted to the Department of Neurology at the First Affiliated Hospital of Ningbo University between April 2023 and January 2025 were collected, and 90 healthy individuals were selected as controls. All patients signed informed consent forms before the procedure, and the study was approved by the hospital's ethics committee.

[0026] AD group inclusion criteria: The inclusion criteria of the AD group included age between 50 and 85 years, regardless of gender; meeting the diagnostic criteria of the National Institute on Aging-Alzheimer's Association (NIA-AA 2011) revised in 2011; on cognitive assessment, the total score of Clinical Dementia Rating Scale (CDR-GS) was ≥0.5, and the total score of Mini-Mental State Examination (MMSE) was ≤26; biomarker requirement was positive by Aβ-PET or cerebrospinal fluid (CSF) Aβ detection; and memory decline lasted for at least 12 months. The patient himself or his guardian signed the informed consent and voluntarily participated in the study. AD group exclusion criteria: The exclusion criteria of the AD group included: if there were other diseases that could cause cognitive decline, such as vascular dementia, Parkinson's disease, etc., or brain imaging examination found infarction lesions greater than 2 cm or other space-occupying lesions; individuals with a history of stroke, transient ischemic attack (TIA) or epilepsy within 6 months before screening were also excluded. In addition, patients with mental illness such as schizophrenia, major depression, or Hachinski ischemic score greater than 4 and Hamilton Depression Scale (HAMD) score greater than 10 were also not included. Individuals known to be HIV positive or with a history of neurosyphilis were also excluded, as were severe cardiovascular disease, major organ dysfunction, recent history of malignant tumor, contraindications for magnetic resonance imaging (MRI), etc.

[0027] Healthy control group inclusion criteria: The inclusion criteria of the healthy control group required that the age of the subjects was similar to that of the AD group, and no abnormalities were found in the clinical examination results of the nervous system. The mental and cognitive functions were within the normal range, and the subjects were able to live independently and had the ability to participate in the study. Healthy control group exclusion criteria: The exclusion criteria of the healthy control group included: if there were cases of familial Alzheimer's disease (AD), or thyroid hormone, liver and kidney function abnormalities, they were also not included. In addition, individuals with infectious diseases such as syphilis and HIV, or positive tumor markers, or brain imaging examination suggesting structural or pathological changes were not included. Other serious underlying diseases such as diseases affecting the nervous system were also excluded. Table 1 shows the comparison of demographic and clinical characteristics of the early AD patient case group (90 cases) and the healthy volunteer control group (90 cases) in the verification set.

[0028] Table 1 Demographic and clinical characteristics of early AD patient case group and healthy volunteer control group

[0029]

[0030] qRT-PCR determination of the expression level of tsRNA: The total RNA of the collected preoperative plasma samples of elderly patients was extracted using Trizol LS reagent (Invitrogen Corporation, USA), and the total RNA of the plasma was reverse transcribed into cDNA using a cDNA reverse transcription kit (Gimaa Gene, China). The reverse transcription reaction system was as follows: 5x reverse transcription reagent 4.00 μL, deoxyribonucleotide triphosphate 0.75 μL, reverse transcription primer 1.20 μL, RNase inhibitor 0.25 μL, M-MLV reverse transcriptase 0.20 μL, RNA (2 μg) 10 μL, and enzyme-free water 3.6 μL; the reaction program was as follows: 26°C for 40 minutes, 42°C for 40 minutes, 85°C for 10 minutes, and 4°C for storage.

[0031] SYBR Green SuperMix kit (Gimaa Gene, China) was used to perform qRT-PCR on the Applied BiosystemsTM QuantStudioTM3 real-time quantitative PCR instrument system of Invitrogen Corporation; the qRT-PCR reaction system was as follows: 2x real-time quantitative PCR premix (SYBR) 10 μL, PCR primer 0.4 μL, recombinant Taq DNA polymerase 0.2 μL, cDNA 2.0 μL, and enzyme-free water 7.4 μL; the reaction program was as follows: 95°C for 3 minutes, 1 cycle; 95°C for 12 seconds, 62°C for 40 seconds, 40 cycles. The relative expression amount of the target gene was analyzed by -△Ct.

[0032] The nucleotide sequence of the forward primer for the fluorescence quantitative PCR amplification of tRF-Lys-TTT-3 is shown in SEQ ID NO. 2: 5'-TCTGAGGGTCCAGGGTTCAAGT-3', and the nucleotide sequence of the reverse primer for the fluorescence quantitative PCR amplification of tRF-Lys-TTT-3 is shown in SEQ ID NO. 3: 5'-TATGGTTGTTGACGACTGGTTGAC-3'. As Figure 3As shown, the results showed that the designed primers only specifically amplified a single product, and the qRT-PCR amplification product size was 88 bp. After T-A cloning sequencing, it was confirmed that the sequence of the PCR product specifically amplified by the designed primers was consistent with the sequencing sequence of tRF-Lys-TTT-3, indicating that the designed primers could specifically amplify tRF-Lys-TTT-3. The nucleotide sequence of the forward primer for the U6 fluorescence quantitative PCR amplification is shown in SEQ ID NO. 4: 5'-ATTGGAACGATACAGAGAAGATT-3', and the nucleotide sequence of the reverse primer for the U6 fluorescence quantitative PCR amplification is shown in SEQ ID NO. 5: 5'-GGAACGCTTCACGAATTTG-3'.

[0033] In the validation sample set, 90 early AD confirmed patients and 90 healthy people were taken, and 13 early AD confirmed patients and 13 healthy people were taken for preliminary verification of the diagnostic value of the marker. The results are shown in Figure 4 As shown in Figure 5 Further expanding the sample size, in the remaining 77 large sample verification queue (the remaining 77 early AD confirmed patients and 77 healthy people), it was also shown that compared with the healthy volunteer group, the expression level of tRF-Lys-TTT-3 in the early AD patient group was significantly increased (P<0.001). P <0.001).

[0034] 3. Analyze the diagnostic value of tRF-Lys-TTT-3 as an early AD molecular marker by ROC curve: The area under the ROC curve is an important indicator for judging the diagnostic ability of the test index, and the larger the value, the stronger the prediction ability. According to the level of tRF-Lys-TTT-3 in the plasma of healthy people and early AD patients, the area under the ROC curve of tRF-Lys-TTT-3 level for distinguishing healthy people and early AD patients, sensitivity, specificity, positive predictive value and negative predictive value were analyzed to evaluate the diagnostic value of tRF-Lys-TTT-3 in judging early AD patients.

[0035] The results are shown in Figure 6As shown, the diagnostic value of tRF-Lys-TTT-3 in the plasma of patients with early Alzheimer's disease is: the area under the ROC curve is 0.948, the sensitivity is 0.832, and the specificity is 0.987, which fully meets the standard of a good diagnostic standard, fully proving its value in predicting early AD. In summary, tRF-Lys-TTT-3 shows very strong predictive ability in ROC analysis, and the area under the curve and high sensitivity indicate that it can be a good diagnostic marker to screen for early AD patients.

[0036] The above description is not a limitation of the present application, and the present application is not limited to the above examples. Changes, modifications, additions or substitutions made by those skilled in the art within the spirit and scope of the present application should also be within the protection scope of the present application.

Claims

1. Use of a reagent for detecting a plasma tsRNA molecular marker in the manufacture of a kit for diagnosing early Alzheimer's disease, characterized in that: The tsRNA molecular marker is tRF-Lys-TTT-3, and the nucleotide sequence of the tRF-Lys-TTT-3 is shown in SEQ ID NO. 1: 5'-TCTGAGGGTCCAGGGTTCAAGTCCCTGTTCGGGCGCC-3'.

2. Use according to claim 1, characterized in that: The kit comprises fluorescent quantitative PCR forward and reverse primers for amplifying tRF-Lys-TTT-3, the nucleotide sequence of the fluorescent quantitative PCR forward primer is SEQ ID NO. 2: 5'-TCTGAGGGTCCAGGGTTCAAGT-3', and the nucleotide sequence of the fluorescent quantitative PCR reverse primer is SEQ ID NO. 3: 5'-TATGGTTGTTGACGACTGGTTGAC-3'.

Images