System and method for detecting mononucleotide mutation

Abstract

The invention provides a system and a method for detecting mononucleotide mutation, and belongs to the technical field of biomedicine. The system for detecting mononucleotide mutation provided by the invention comprises an upstream primer and a downstream primer designed aiming at a wild type gene and a mutant type gene, an enhanced mediation probe designed aiming at the wild type gene and a universal fluorescent probe designed aiming at the mutant type gene, the enhanced mediating probe plays a role in inhibiting wild-type amplification and generating a mediator. According to the present invention, by using the enhanced mediating probe and the mutant upstream or downstream primer, the selective efficient amplification of the mutant template is achieved, and the mononucleotide mutation with the mutation allele frequency as low as 0.03% can be detected. The detection method provided by the invention solves the problem that the number of targets is limited by the limited number of probe fluorescence colors, and the detection method provided by the invention does not need a special reaction reagent and is low in cost; special reaction procedures and instruments are not needed, and the operation is simple.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedical technology, and particularly relates to a system and method for detecting single nucleotide mutation. BACKGROUND

[0002] Circulating tumor DNA (ctDNA) is a single-stranded or double-stranded extracellular fragmented DNA existing in peripheral blood or urine. It is highly concerned due to its sample accessibility, non-invasiveness and lower tumor heterogeneity. The detection of ctDNA mutation in cancer patients shows great prospects in guiding treatment, monitoring cancer recurrence and even early cancer screening. However, the large amount of wild template background in ctDNA brings great challenges to high-sensitivity detection of low-frequency single nucleotide variation, thereby hindering the clinical application of mutation detection.

[0003] PCR technology has become a widely used molecular biology technique for detecting mutations due to its stability, simplicity and powerfulness. Various PCR methods such as ARMS, ASB-PCR, HCA, BDA and COLD-PCR have been developed. However, the sensitivity of these PCR methods is still limited when detecting mutations. In addition, due to the limitation of the number of fluorescence channels of qPCR instruments, the number of targets that can be simultaneously detected is not more than 5, which greatly reduces the number of targets that can be simultaneously detected. The existing methods for detecting multiple single nucleotide mutations are limited to detecting mutations with a variant allele frequency (VAF) of 5% or 10%, and cannot effectively detect low-abundance mutant DNA, such as mutations with a VAF of less than 1%. SUMMARY

[0004] Therefore, one of the purposes of the present application is to provide a system for detecting single nucleotide mutation, which can realize high sensitivity and simultaneous multiple detection of single nucleotide variation, and can realize detection of low-frequency mutations of 0.03%, thereby providing a new tool for tumor liquid biopsy.

[0005] The second purpose of the present application is to provide a method for detecting single nucleotide mutation, which realizes high sensitivity and multiple detection of single nucleotide mutation based on PCR and melting curve analysis (MCA), thereby breaking the technical bottleneck of insufficient detection sensitivity and multiplicity of DNA mutation.

[0006] In order to achieve the above-mentioned purposes of the application, the present application provides the following technical solutions:

[0007] The application provides a system for detecting single nucleotide mutation, which comprises upstream primers and downstream primers designed for wild type genes and mutant genes, an enhancement mediated probe designed for wild type genes and a universal fluorescent probe designed for mutant genes; one of the upstream primers and the downstream primers is a mutant primer designed for mutant genes, and the enhancement mediated probe plays a role of inhibiting wild type amplification and generating a mediated primer.

[0008] The enhancement mediated probe is composed of a 5' end overhanging sequence, a middle sequence and a 3' end; the 5' end overhanging sequence is a 1-25 base sequence which can be separated by Taq polymerase to generate a mediated primer and be complementary to the fluorescent probe; the middle sequence is a 15-40 base sequence which can be complementary to the template, and the 5' base of the middle sequence is complementary to the wild type base but not to the mutant base; and the 3' end is a 2-8 base sequence which is not complementary to the template.

[0009] Preferably, when amplifying the mutant template, the 3' end of the mutant primer is paired with the mutant template to initiate extension, the enhancement mediated probe is cut by Taq polymerase to generate the mediated primer, the mediated primer is combined with the universal fluorescent probe and extended by Taq polymerase to generate fluorescent double-stranded DNA; when amplifying the wild type template, the 5' of the enhancement mediated probe is preferentially paired with the wild type template, thereby hindering the 3' end of the mutant primer from being paired with the wild type template, failing to be cut and release the mediated primer, and thus failing to generate fluorescent double-stranded DNA.

[0010] Preferably, the enhancement mediated probe is replaced by an enhancement blocker and a mediated probe, the enhancement blocker plays a role of inhibiting wild type amplification, and the mediated probe plays a role of generating a mediated primer.

[0011] Preferably, the 3' end base of the mutant primer is complementary to the mutant base and has a length of 10-30 bases; and the universal fluorescent probe uses a linear Taqman probe, a hairpin Taqman probe or a molecular beacon light emitting probe.

[0012] Preferably, the system further comprises a hot start polymerase, dNTPs, MgCl2 and a template.

[0013] Preferably, the single nucleotide mutation comprises at least one of V600E mutation of BRAF gene, H1047R mutation of PIK3CA gene, L858R mutation of EGFR gene, R175H mutation of TP53 gene, G719A mutation of EGFR gene, Q61K mutation of NRAS gene and Y220C mutation of TP53 gene.

[0014] Preferably, when detecting the V600E mutation of the BRAF gene, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe are respectively shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4;

[0015] When detecting the H1047R mutation of the PIK3CA gene, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe are respectively shown as SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 4;

[0016] When detecting the L858R mutation of the EGFR gene, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe are respectively shown as SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14 and SEQ ID NO. 4.

[0017] Preferably, when the V600E mutation of the BRAF gene, the H1047R mutation of the PIK3CA gene, the L858R mutation of the EGFR gene, the R175H mutation of the TP53 gene, the G719A mutation of the EGFR gene, the Q61K mutation of the NRAS gene and the Y220C mutation of the TP53 gene are detected simultaneously, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 1 designed for the V600E mutation of the BRAF gene are shown in SEQ ID NO. 5, SEQ ID NO. 2, SEQ ID NO. 18 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 1 designed for the H1047R mutation of the PIK3CA gene are shown in SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 19 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 1 designed for the L858R mutation of the EGFR gene are shown in SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 1 designed for the R175H mutation of the TP53 gene are shown in SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 2 designed for the G719A mutation of the EGFR gene are shown in SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25 and SEQ ID NO. 16, respectively; the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 2 designed for the Q61K mutation of the NRAS gene are shown in SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28 and SEQ ID NO. 16, respectively; the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediated probe and the universal fluorescent probe 3 designed for the Y220C mutation of the TP53 gene are shown in SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31 and SEQ ID NO. 17, respectively; the universal fluorescent probe 1, the universal fluorescent probe 2 and the universal fluorescent probe 3 are labeled with different colors of fluorescence.

[0018] The application also provides a method for detecting single nucleotide mutation, which mixes a template gene to be detected with the system, performs PCR amplification, then performs melting curve analysis and collects fluorescence, if a melting peak with a corresponding Tm value is generated, it indicates that the template to be detected contains a mutant gene.

[0019] Preferably, the PCR amplification program is: 95℃ enzyme activation for 3min; then 95℃ denaturation for 10s, 58℃ annealing for 15s, 72℃ extension for 10s, 55 cycles; and the melting curve analysis program is: 95℃ denaturation for 3min, then cooling to 50℃ and maintaining for 2min, and then heating to 85℃ at a heating speed of 0.04℃ / s.

[0020] Preferably, the reaction system of the PCR amplification comprises, according to 30μL, 2-4.5mM MgCl2, 0.2-0.25mM dNTPs, 0.03-0.06U / μL hot start polymerase, 0.15-0.3μM upstream primer, 0.05-0.35μM mutant downstream primer, 0.2-1.2μM enhanced mediator probe, 0.1-0.15μM universal fluorescent probe, and 10μL template.

[0021] The application has the following beneficial effects:

[0022] The detection system provided by the application realizes selective and efficient amplification of mutant templates by using an enhanced mediator probe and a mutant primer, and can detect single nucleotide mutation with a variation allele frequency (VAF) as low as 0.03%.

[0023] The detection method provided by the application realizes multiple detection of single nucleotide mutation by using melting curve analysis, solves the problem that the number of targets is limited by the number of probe fluorescent colors, and has low cost as it does not require special reaction reagents, and is simple to operate as it does not require special reaction procedures and instruments. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 FIG. 1 is a schematic diagram of the principle of realizing high-sensitivity and multiple detection of single nucleotide mutation according to the application, wherein A is a schematic diagram of the principle of detecting single nucleotide mutation by using an enhanced blocker and a mediator probe according to Example 2, and B is a schematic diagram of the principle of detecting single nucleotide mutation by using an enhanced mediator probe according to the application;

[0025] Figure 2 FIG. 2 is an effect diagram of detecting BRAF gene V600E mutation by using an enhanced mediator probe;

[0026] Figure 3 FIG. 3 is an effect diagram of detecting BRAF gene V600E mutation by using an enhanced blocker and a mediator probe;

[0027] Figure 4 Effect diagram for detecting PIK3CA gene H1047R mutation using enhanced mediated probe;

[0028] Figure 5 Effect diagram for detecting EGFR gene L858R mutation using enhanced mediated probe;

[0029] Figure 6 Schematic diagram for simultaneously detecting 7 mutations and 1 internal reference based on multiplex melting curve;

[0030] Figure 7 Peak diagram for multiplex melting curve system to detect 7 different mutations with 1% VAF abundance and 1 internal reference;

[0031] Figure 8 Peak diagram for multiplex system to detect BRAF V600E mutation at different abundances;

[0032] Figure 9 Peak diagram for multiplex detection system to analyze 3 plasma ctDNA samples. DETAILED DESCRIPTION

[0033] The present application provides a system for detecting single nucleotide mutation, comprising upstream primer and downstream primer designed for wild type gene and mutant gene, enhanced mediated probe designed for wild type gene and universal fluorescent probe designed for mutant gene; one of the upstream primer and the downstream primer is mutant primer designed for mutant gene, and the enhanced mediated probe plays a role of inhibiting wild type amplification and generating mediated primer.

[0034] The enhanced mediated probe is composed of 5' end overhang sequence, middle sequence and 3' end; the 5' end overhang sequence is a sequence of 1-25 bases which can be separated by Taq polymerase enzyme to generate mediated primer and complementarily paired with fluorescent probe; the middle sequence is a sequence of 15-40 bases which can be complementarily paired with template, and the 5' base of the middle sequence is complementarily paired with wild type base, but not paired with mutant base; the 3' end is a sequence of 2-8 bases which is not complementarily paired with template.

[0035] In the present application, the binding site of the enhanced mediated probe is preferably located in the region between the binding sites of the upstream primer and the downstream primer.

[0036] In some embodiments of the present application, PCR amplification and melting curve analysis are performed using a mutant downstream primer, an upstream primer designed for both wild-type and mutant genes, an enhanced mediator probe designed for wild-type gene and a universal fluorescent probe designed for mutant gene. The enhanced mediator probe has a higher Tm or concentration compared to the mutant downstream primer in order to hybridize to the template more rapidly. When amplifying the mutant template, the 3' end of the mutant downstream primer binds to the template and initiates extension. In this process, the enhanced mediator probe is cleaved by Taq polymerase to generate a mediator primer, which has one or two template-specific nucleotides at the 3' end. Subsequently, the mediator primer binds to the universal fluorescent probe and is extended by Taq polymerase to generate fluorescent double-stranded DNA. During melting curve analysis, these fluorescent double-strands melt at a specific temperature (Tm value) as the temperature increases, resulting in a decrease in fluorescence and thus an observable melting peak. However, when amplifying the wild-type template, the 5' end of the enhanced mediator probe preferentially binds to the wild-type template, thus hindering the hybridization of the 3' end of the mutant downstream primer to the template. This hindrance effectively suppresses the amplification of the wild-type template, the generation of the mediator primer and the appearance of the melting peak, thus ultimately enabling the effective detection of single nucleotide mutant DNA. A schematic diagram of the above detection principle of the present application is shown in FIG. B of Figure 1

[0037] In the present application, the binding of the mediator primer generated by the cleavage of the enhanced mediator probe by Taq polymerase to different regions of the universal fluorescent probe can generate fluorescent double-strands of different lengths (Tm values), while the use of multiple fluorescent probes of different colors can greatly expand the ability to detect multiple targets in a single reaction. Thus, the present application can enable the detection of multiple mutant targets by generating fluorescent double-strands of different lengths (Tm values) and colors. The present application combines the wild-type enhanced blocker and the mediator probe into a single enhanced mediator probe, which plays the roles of suppressing the amplification of the wild-type template and generating the mediator primer. This method reduces costs and reduces the probability of cross-reactions of oligonucleotide strands, while effectively shortening the amplicon length, which is beneficial for the detection of fragmented ctDNA.

[0038] ​In the present application, the enhanced mediator probe can be replaced by an enhanced blocker and a mediator probe. The enhanced blocker inhibits the amplification of the wild type, and the mediator probe generates a mediator primer. The enhanced blocker preferably has a 5' end base complementary to the wild type base and non-complementary to the mutant base, which inhibits the non-specific amplification of the wild type template, thereby increasing the recognition ability of the mutant and the wild type template. The 3' end is a base sequence of 2-8 bases, which is non-complementary to the template, or is modified by a phosphate group, or is modified by MGB, or is any chemical modification that can hinder the extension of the mediator blocker. The mediator probe preferably consists of three parts. The 5' end overhang sequence is a base sequence of 1-25 bases, which can be separated by Taq polymerase to generate a mediator primer and be complementary to the fluorescent probe. The middle sequence is a base sequence of 15-40 bases complementary to the template. The 3' end is a base sequence of 2-8 bases, which is non-complementary to the template, or is modified by a phosphate group, or is modified by MGB, or is any chemical modification that can hinder the extension of the mediator blocker. The principle of using the enhanced blocker and the mediator probe to detect single nucleotide mutation is shown in A of Figure 1 .

[0039] In the present application, the 3' end base of the mutant primer is complementary to the mutant base, and the length is preferably 10-30 bases. The universal fluorescent probe uses linear Taqman probe, hairpin Taqman probe or molecular beacon light-emitting probe. In the system of the present application, it preferably further comprises a hot-start polymerase, dNTPs, MgCl2 and a template. In the present application, the single nucleotide mutation preferably comprises at least one of V600E mutation of BRAF gene, H1047R mutation of PIK3CA gene, L858R mutation of EGFR gene, R175H mutation of TP53 gene, G719A mutation of EGFR gene, Q61K mutation of NRAS gene and Y220C mutation of TP53 gene.

[0040] In the present application, the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediated probe and universal fluorescent probe for detecting the V600E mutation of the BRAF gene are preferably shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, respectively; the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediated probe and universal fluorescent probe for detecting the H1047R mutation of the PIK3CA gene are preferably shown in SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 4, respectively; the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediated probe and universal fluorescent probe for detecting the L858R mutation of the EGFR gene are preferably shown in SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14 and SEQ ID NO. 4, respectively.

[0041] In the present application, when the V600E mutation of the BRAF gene, the H1047R mutation of the PIK3CA gene, the L858R mutation of the EGFR gene, the R175H mutation of the TP53 gene, the G719A mutation of the EGFR gene, the Q61K mutation of the NRAS gene and the Y220C mutation of the TP53 gene are simultaneously detected, the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 1 designed for the V600E mutation of the BRAF gene are shown in SEQ ID NO. 5, SEQ ID NO. 2, SEQ ID NO. 18 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 1 designed for the H1047R mutation of the PIK3CA gene are shown in SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 19 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 1 designed for the L858R mutation of the EGFR gene are shown in SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 1 designed for the R175H mutation of the TP53 gene are shown in SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22 and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 2 designed for the G719A mutation of the EGFR gene are shown in SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25 and SEQ ID NO. 16, respectively; the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 2 designed for the Q61K mutation of the NRAS gene are shown in SEQ ID NO. 26, SEQ ID NO. 27, SEQ ID NO. 28 and SEQ ID NO. 16, respectively; the nucleotide sequences of the upstream primers, mutant downstream primers, enhanced mediated probes and universal fluorescent probe 3 designed for the Y220C mutation of the TP53 gene are shown in SEQ ID NO. 29, SEQ ID NO. 30, SEQ ID NO. 31 and SEQ ID NO. 17, respectively; the universal fluorescent probe 1, the universal fluorescent probe 2 and the universal fluorescent probe 3 are labeled with different colors of fluorescence.

[0042] The application also provides a method for detecting single nucleotide mutation, which comprises mixing a template gene to be detected with the system, performing PCR amplification, then performing melting curve analysis and collecting fluorescence, and if a melting peak with a corresponding Tm value is generated, it indicates that the template to be detected contains a mutant gene.

[0043] The application combines an enhanced mediated probe, a universal fluorescent probe and other reaction systems to form a PCR system, and performs amplification and melting curve analysis on a sample to realize high-sensitivity and multiplex detection of low-abundance single nucleotide mutation. In the application, the program of the PCR amplification is preferably 95℃ enzyme activation for 3 min, then 95℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension for 10 s, 55 cycles; and the program of the melting curve analysis is preferably 95℃ denaturation for 3 min, then cooling to 50℃ and maintaining for 2 min, and then heating to 85℃ at a heating rate of 0.04℃ / s. In the application, the reaction system of the PCR amplification, according to 30 μL, preferably comprises 2-4.5 mM MgCl2, 0.2-0.25 mM dNTPs, 0.03-0.06 U / μL hot-start polymerase, 0.15-0.3 μM upstream primer, 0.05-0.35 μM mutant downstream primer, 0.2-1.2 μM enhanced mediated probe, 0.1-0.15 μM universal fluorescent probe, and 10 μL template.

[0044] The technical solutions provided by the application will be described in detail below in combination with the embodiments, but they should not be understood as limiting the protection scope of the application.

[0045] In the following examples, all the conventional methods are used unless otherwise specified.

[0046] In the following examples, all the materials and reagents used are commercially available unless otherwise specified.

[0047] Example 1

[0048] A method for detecting BRAF gene V600E mutation by using an enhanced mediated probe, which comprises the following steps:

[0049] (1) The nucleotide sequences of the upstream primer and the mutant downstream primer designed according to the wild-type gene template and the mutant gene template, the enhanced mediated probe designed for the wild-type gene, and the universal fluorescent probe designed for the mutant gene are ACCTCAGATATATTTCTTCATGAAG (SEQ ID NO. 1), CCACTCCATCGAGATTTCT (SEQ ID NO. 2), CGACTTCCTCTGACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGttta (SEQ ID NO. 3), ROX-AGAGACCACTCACGAGGCGCTAGAGTCAGATCACCAGAGTCAGAGGAAGTCG (SEQ ID NO. 4)-BHQ2.

[0050] (2) The reaction volume is 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot start polymerase, 0.25 μM upstream primer, 0.06 μM mutant downstream primer, 0.8 μM enhanced mediated probe, 0.15 μM universal fluorescent probe, and 10 μL template. In this embodiment, the mutant template is BRAF V600E mutant genomic DNA, and the wild-type template is 293T cell line genomic DNA, and the simulated samples with different mutation frequencies (NC, 0%, 0.03%, 0.1%, 1%, 10%) are prepared in proportion. Each mutation frequency is tested in triplicate.

[0051] (3) The mutation detection system in steps (1) and (2) is subjected to PCR amplification, and the specific procedure is as follows: enzyme activation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 15 s, and extension at 72°C for 10 s, for 55 cycles. The program for melting curve analysis is as follows: denaturation at 95°C for 3 min, then cooling to 50°C and maintaining for 2 min, and then slowly heating to 85°C at a rate of 0.04°C / s, and collecting fluorescence.

[0052] PCR amplification and signal collection are performed using the SLAN-96S system, and the results are shown in Figure 2 It can be seen that the method using the enhanced mediated probe realizes high-sensitivity detection of mutations (0.03% VAF).

[0053] Example 2

[0054] The difference from Example 1 is that the enhanced mediated probe is not contained, but the enhanced blocker and the mediated probe are used to detect the V600E mutation of the BRAF gene, and the steps are as follows:

[0055] (1) The primer set for V600E mutation of BRAF gene, the upstream primer and mutant downstream primer are designed according to the wild type gene template and the mutant gene template, the mediated probe and the enhanced blocker designed for the wild type gene, and the nucleotide sequences of the universal fluorescent probe designed for the mutant gene are TGAGATCTACTGTTTTCCTTTAC (SEQ ID NO. 5), SEQ ID NO. 2,

[0056] AGATCCTGTGACCACTTCATGAAGAAATATATCTGAGGTGTAGTAAaatt (SEQ ID NO. 6), ACTGTAGCTAGACCAAAATCACCTATTTTACTGTGAgttta (SEQ ID NO. 7) and ROX-AAGATGATACTTCTCTCTAGGACGACACGAGACCTGAGCAGTGGTCACAGGATCTCCA (SEQ ID NO. 8)-BHQ2.

[0057] (2) The difference from step (2) of Example 1 is that it does not contain enhanced mediated probe 0.8 μM, but is replaced with mediated probe 1 μM and enhanced blocker 0.8 μM, and the rest is the same as step (2) of Example 1.

[0058] (3) The same as step (3) of Example 1. The results are shown in Figure 3 Figure 2 and Figure 3 It can be seen from the comparison of

[0059] Example 3

[0060] A method for detecting H1047R mutation of PIK3CA gene by using enhanced mediated probe, the steps are as follows:

[0061] (1) The upstream primer and mutant downstream primer are designed according to the wild type gene template and the mutant gene template, the enhanced mediated probe designed for the wild type gene template and the universal fluorescent probe designed for the mutant gene, and the nucleotide sequences are TGCATGCTGTTTAATTGTGTG (SEQ ID NO. 9), AACAAATGAATGATGCACG (SEQ ID NO. 10), TCTGACTCTGGTGATCATGGTGGCTGGACAACAAAAATGGATTGGATCTaaat (SEQ ID NO. 11) and ROX-SEQ ID NO. 4-BHQ2.​

[0062] (2) The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.2 μM upstream primer, 0.05 μM mutant downstream primer, 1.2 μM enhanced mediation probe, 0.15 μM universal fluorescent probe template, and 10 μL template. In this example, the mutant template was the H1047R mutant genomic DNA of the PIK3CA gene, the wild-type template was the genomic DNA of the 293T cell line, and the simulated samples with different mutation frequencies (NC, 0%, 0.03%, 0.1%, 1%, and 10%) were prepared in proportion (each in a separate tube, and the reaction volume of each tube was 30 μL). Each mutation frequency was tested in triplicate.

[0063] (3) The same as step (3) of Example 1. The results, as shown in Figure 4 , showed that the enhanced mediation probe method achieved high-sensitivity detection of the H1047R mutation of the PIK3CA gene (0.03% VAF).

[0064] Example 4

[0065] A method for detecting the L858R mutation of the EGFR gene using an enhanced mediation probe, the steps are as follows:

[0066] (1) The primer set for the L858R mutation of the EGFR gene, the upstream primer and the mutant downstream primer were designed according to the wild-type gene template and the mutant gene template, and the nucleotide sequences of the enhanced mediation probe designed for the wild-type gene template and the universal fluorescent probe designed for the mutant gene from 5' end to 3' end were ACGTACTGGTGAAAACACCG (SEQ ID NO. 12), CCAGCAGTTTGGCCC (SEQ ID NO. 13),

[0067] GTGATCTGACTCTAGCCCAAAATCTGTGATCTTGACATGCTGC aaaa (SEQ ID NO. 14), and ROX-SEQ ID NO. 4-BHQ2.

[0068] (2) The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot start polymerase, 0.2 μM upstream primer, 0.08 μM mutant downstream primer, 1.2 μM enhanced mediated probe, 0.15 μM universal fluorescent probe template, and 10 μL template. In this example, the mutant template was a synthetic L858R mutant plasmid DNA of EGFR gene, and the wild type template was the genomic DNA of 293T cell line. The mock samples with different mutation frequencies (NC, 0%, 0.1%, 1%, 10%) were prepared in proportion (each in a separate tube, and the reaction volume of each tube was 30 μL). Each mutation frequency was tested in triplicate.

[0069] (3) The same as step (3) of Example 1. The results, as shown in Figure 5 Table 3, demonstrated that the enhanced mediated probe method achieved high sensitivity detection of L858R mutation of EGFR gene (0.1% VAF).

[0070] Example 5

[0071] A method for single-tube detection of multiple mutation sites using enhanced mediated probe detection, the steps are as follows:

[0072] (1) This multiple detection system targets seven mutation sites of BRAF gene V600E mutation (abbreviated as BRAF V600E), PIK3CA gene H1047R mutation (abbreviated as PIK3CA H1047R), EGFR gene L858R mutation (abbreviated as EGFR L858R), TP53 gene R175H mutation (abbreviated as TP53 R175H), EGFR gene G719A mutation (abbreviated as EGFR G719A), NRAS gene Q61K mutation (abbreviated as NRAS Q61K), and TP53 gene Y220C mutation (abbreviated as TP53 Y220C), and reference gene ACTB, a total of eight targets.

[0073] Among them, BRAF V600E, PIK3CA H1047R, EGFR L858R and TP53 R175H target the same universal fluorescent probe 1, the nucleotide sequence from 5' end to 3' end is:

[0074] ROX-AGACACACATCTGCTGCGAGAGGCTAGAGTCAGATCACCAGAGTCAGAGGAAGT CG (SEQ ID NO. 15)-BHQ2;

[0075] EGFR G719A and NRAS Q61K target the same universal fluorescent probe 2, the nucleotide sequence from 5' end to 3' end is FAM-TCAGACGACACATGACATCTGCGACTCACTCAGACCTGGGACTCAGTCAGACTC (SEQ ID NO. 16)-BHQ1;

[0076] TP53 Y220C and reference gene ACTB target the same universal fluorescent probe 3, the nucleotide sequence from 5' end to 3' end is CY5-TGTCACTCAGACTCAGACTGATGCCAGACCGTCAGCTAATCACCGAGCACAG (SEQ ID NO. 17)-BHQ3.

[0077] (2) The primer set for BRAF V600E mutation, the upstream primer and mutant downstream primer are designed according to the wild type gene template and mutant gene template, the nucleotide sequence of the enhanced mediated probe designed for the wild type gene template and the universal fluorescent probe 1 designed for the mutant gene from 5' end to 3' end is SEQ ID NO. 5, SEQ ID NO. 2, CGACTTCCTCTGACTGTAGCTAGACCAAAATCACCTATTTTTACTGaataa (SEQ ID NO. 18) and ROX-SEQ ID NO. 15-BHQ2, respectively, and the concentration of each oligonucleotide chain is 0.3 μM, 0.35 μM, 0.2 μM and 0.1 μM.

[0078] The primer set for PIK3CA H1047R mutation, the upstream primer and mutant downstream primer are designed according to the wild type gene template and mutant gene template, the nucleotide sequence of the enhanced mediated probe designed for the wild type gene template and the universal fluorescent probe 1 designed for the mutant gene from 5' end to 3' end is SEQ ID NO. 9, SEQ ID NO. 10, TCTGACTCTGGTGATCATGGTGGCTGGACAACAAAAATGGATTGGtaaaa (SEQ ID NO. 19) and ROX-SEQ ID NO. 15-BHQ2, respectively, and the concentration of each oligonucleotide chain is 0.25 μM, 0.07 μM, 0.3 μM and 0.1 μM.

[0079] The primer set for EGFR L858R mutation, the upstream primer and mutant downstream primer are designed according to the wild-type gene template and mutant gene template, the nucleotide sequences of the enhanced mediated probe designed for the wild-type gene template and the universal fluorescent probe 1 designed for the mutant gene from 5' end to 3' end are shown in SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14 and ROX-SEQ ID NO. 15-BHQ2 respectively, and the concentrations of the oligonucleotide chains are 0.2 μM, 0.15 μM, 0.25 μM and 0.1 μM respectively.

[0080] The primer set for TP53 R175H mutation, the upstream primer and mutant downstream primer are designed according to the wild-type gene template and mutant gene template, the nucleotide sequences of the enhanced mediated probe designed for the wild-type gene template and the universal fluorescent probe 1 designed for the mutant gene from 5' end to 3' end are TGTGGGTTGATTCCACAC (SEQ ID NO. 20), CTCATGGTGGGGGCAGT (SEQ ID NO. 21),

[0081] GACTCTAGCCTCTCGCCTCACAACCTCCGTCATGaaaa (SEQ ID NO. 22) and ROX-SEQ ID NO. 15-BHQ2, and the concentrations of the oligonucleotide chains are 0.3 μM, 0.05 μM, 0.25 μM and 0.1 μM respectively.

[0082] The primer set for EGFR G719A mutation, the upstream primer and mutant downstream primer are designed according to the wild-type gene template and mutant gene template, the nucleotide sequences of the enhanced mediated probe designed for the wild-type gene template and the universal fluorescent probe 2 designed for the mutant gene from 5' end to 3' end are CTCTCTTGAGGATCTTGAAGGA (SEQ ID NO. 23), CGAACGCACCGGAGG (SEQ ID NO. 24),

[0083] GAGTCTGACTGAGTCCCAGCACTTTGATCTTTTTGAATTCAGTaaaa (SEQ ID NO. 25) and FAM-SEQ ID NO. 16-BHQ1, and the concentrations of the oligonucleotide chains are 0.25 μM, 0.25 μM, 0.3 μM and 0.1 μM respectively.

[0084] The primer set for NRAS Q61 K mutation, the upstream primer and mutant downstream primer are designed according to the wild type gene template and mutant gene template, the nucleotide sequences of the enhanced mediated probe designed for the wild type gene template and the universal fluorescent probe 2 designed for the mutant gene from 5' end to 3' end are GATTCTTACAGAAAACAAGTGG (SEQ ID NO. 26), CATGGCACTGTACTCTTCTTT (SEQ ID NO. 27),

[0085] CCCAGGTCTGAGTGAGTCCAGCTGTATCCAGTATGTCCAACAAACAaaaa (SEQ ID NO. 28) and FAM-SEQ ID NO. 16-BHQ1, the concentrations of each oligonucleotide chain are 0.3 μM, 0.1 μM, 1.1 μM and 0.1 μM.

[0086] The primer set for TP53 Y220C mutation: the upstream primer and mutant downstream primer are designed according to the wild type gene template and mutant gene template, the nucleotide sequences of the enhanced mediated probe designed for the wild type gene template and the universal fluorescent probe 3 designed for the mutant gene from 5' end to 3' end are TGCGTGTGGAGTATTTGG (SEQ ID NO. 29), AGACCTCAGGCGGCTCAC (SEQ ID NO. 30),

[0087] CTGTGCTCGGTGATTAGGGCACCACCACACTATGTCGAAAAGaaaa (SEQ ID NO. 31) and CY5-SEQ ID NO. 17-BHQ3, the concentrations of each oligonucleotide chain are 0.3 μM, 0.1 μM, 0.3 μM and 0.2 μM.

[0088] The primer set for the internal reference ACTB: the upstream primer, the downstream primer, the mediated probe and the universal fluorescent probe 3 are designed according to the template, the nucleotide sequences from 5' end to 3' end are AGGCATCCTCACCCTGAAG (SEQ ID NO. 32), CATTGTAGAAGGTGTGGTGCC (SEQ ID NO. 33),

[0089] GCTGACGGTCTGGCATCGTCACCAACTGGGACGACAaaat (SEQ ID NO. 34) and CY5-SEQ ID NO. 17-BHQ3, the concentrations of each oligonucleotide chain are 0.15 μM, 0.15 μM, 0.3 μM and 0.2 μM.

[0090] (3) The reaction volume was 30 μL, containing 4.5 mM MgCl2, 0.25 mM dNTPs, 0.06 U / μL hot start polymerase, 10 μL template, and the concentrations of each oligonucleotide in the primer set of each mutant gene were as shown in step (2) (wherein the final concentration of universal fluorescent probe 1 was 0.1 μM, the final concentration of universal fluorescent probe 2 was 0.1 μM, and the final concentration of universal fluorescent probe 3 was 0.2 μM). The mutation detection system in the above step was subjected to PCR amplification, and the specific procedure was the same as step (3) of Example 1. The PCR amplification and signal acquisition were performed using the SLAN-96S system.

[0091] The schematic diagram of the above-mentioned single-tube detection of multiple mutation sites using enhanced mediator probes is shown in Figure 6 The detection target contains 7 mutations (M1-M7) and an internal reference (R). The peak diagram of different mutations at 1% VAF abundance is shown in Figure 7 The results of detecting different abundance of BRAF V600E mutations using the above-mentioned multiple melting curve detection are shown in Figure 8 It is shown that the multiple system can achieve 0.1% mutation detection.

[0092] Example 6

[0093] Three lung cancer plasma samples were collected respectively, and after obtaining ctDNA, the single-tube detection method of multiple mutation sites in Example 5 was used to detect the eight targets of the three lung cancer plasma samples respectively, and the results are shown in Figure 9 If there is no corresponding mutation, no melting peak is generated, only the melting peak corresponding to the internal reference. Sample 2 is EGFR L858R mutation positive, and the others are negative.

[0094] The above-mentioned is only the preferred embodiment of the present application, and it should be pointed out that for ordinary skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should be considered as the protection scope of the present application.

Claims

1. A system for detecting single nucleotide mutations, characterized in that, It includes upstream and downstream primers designed for wild-type and mutant genes, an enhancement-mediated probe designed for wild-type genes, and a universal fluorescent probe designed for mutant genes; one of the upstream and downstream primers is a mutant primer designed for mutant genes, and the enhancement-mediated probe plays the role of inhibiting wild-type amplification and generating the mediator primer; The enhanced mediating probe consists of a 5' overhang sequence, an intermediate sequence, and a 3' end. The 5' overhang sequence is a 1-25 base sequence that can be separated by Taq polymerase to generate a mediating primer that is complementary to the fluorescent probe. The intermediate sequence is a 15-40 base sequence that is complementary to the template, and the 5' base of the intermediate sequence is complementary to wild-type bases but not to mutant bases. The 3' end is a 2-8 base sequence that is not complementary to the template.

2. The system according to claim 1, characterized in that, When amplifying a mutant template, the 3' end of the mutant primer pairs with the mutant template, initiating extension and enhancing the cleavage of the probe by Taq polymerase, producing a mediator primer. The mediator primer binds to a universal fluorescent probe and is extended by Taq polymerase, generating fluorescent double-stranded DNA. When amplifying a wild-type template, the 5' end of the enhancement-mediated probe preferentially pairs with the wild-type template, thereby preventing the 3' end of the mutant primer from pairing with the wild-type template. As a result, the mutant primer cannot be cleaved and released, thus preventing the generation of fluorescent double-stranded DNA.

3. The system according to claim 1, characterized in that, The enhanced mediating probe is replaced with an enhanced blocker and a mediating probe, wherein the enhanced blocker inhibits wild-type amplification and the mediating probe generates mediating primers.

4. The system according to claim 1, characterized in that, The 3' end base of the mutant primer is complementary to the mutant base, and its length is 10 to 30 bases; the universal fluorescent probe is a linear Taqman probe, a hairpin Taqman probe, or a molecular beacon luminescent probe.

5. The system according to claim 1, characterized in that, It also includes hot-start polymerase, dNTPs, MgCl2, and template.

6. The system according to claim 1, characterized in that, The single nucleotide mutations include at least one of the following: V600E mutation in the BRAF gene, H1047R mutation in the PIK3CA gene, L858R mutation in the EGFR gene, R175H mutation in the TP53 gene, G719A mutation in the EGFR gene, Q61K mutation in the NRAS gene, and Y220C mutation in the TP53 gene.

7. The system according to claim 6, characterized in that, When detecting the V600E mutation in the BRAF gene, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediating probe, and the universal fluorescent probe are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. When detecting the H1047R mutation in the PIK3CA gene, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediating probe, and the universal fluorescent probe are shown in SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.4, respectively. When detecting the L858R mutation in the EGFR gene, the nucleotide sequences of the upstream primer, the mutant downstream primer, the enhanced mediator probe, and the universal fluorescent probe are shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.4, respectively.

8. The system according to claim 6, characterized in that, Simultaneously detecting the V600E mutation of the BRAF gene, the H1047R mutation of the PIK3CA gene, the L858R mutation of the EGFR gene, the R175H mutation of the TP53 gene, the G719A mutation of the EGFR gene, the Q61K mutation of the NRAS gene, and the Y220C mutation of the TP53 gene, the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediating probe, and universal fluorescent probe 1 designed for the V600E mutation of the BRAF gene are shown in SEQ ID NO.5, SEQ ID NO.2, SEQ ID NO.18, and SEQ ID NO.15, respectively; the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediating probe, and universal fluorescent probe 1 designed for the H1047R mutation of the PIK3CA gene are shown in SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.19, and SEQ ID NO.15, respectively. The nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediating probe, and universal fluorescent probe 1 designed for the L858R mutation of the EGFR gene are shown in SEQ ID NO. 15, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediating probe, and universal fluorescent probe 1 designed for the R175H mutation of the TP53 gene are shown in SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, and SEQ ID NO. 15, respectively; the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediating probe, and universal fluorescent probe 2 designed for the G719A mutation of the EGFR gene are shown in SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25, and SEQ ID NO. 16, respectively; and the nucleotide sequences of the upstream primer, mutant downstream primer, enhancement-mediating probe, and universal fluorescent probe 2 designed for the Q61K mutation of the NRAS gene are shown in SEQ ID NO. 26, SEQ ID NO. 175H, SEQ ID NO. 175H, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15, respectively. The nucleotide sequences of the upstream primer, mutant downstream primer, enhanced mediating probe, and universal fluorescent probe 3 designed for the Y220C mutation of the TP53 gene are shown in SEQ ID NO.27, SEQ ID NO.28, and SEQ ID NO.16, respectively. The universal fluorescent probe 1, universal fluorescent probe 2, and universal fluorescent probe 3 are labeled with different colors of fluorescence.

9. A method for detecting single nucleotide mutations, characterized in that, The template gene to be tested is mixed with the system described in any one of claims 1 to 8, PCR amplification is performed, and then melting curve analysis and fluorescence acquisition are performed. If a melting peak with a corresponding Tm value is generated, it indicates that the template to be tested contains a mutant gene.

10. The method according to claim 9, characterized in that, The PCR amplification program is as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s, annealing at 58℃ for 15 s, extension at 72℃ for 10 s, for 55 cycles; the melting curve analysis program is as follows: denaturation at 95℃ for 3 min, cooling to 50℃, holding for 2 min, then heating to 85℃ at a rate of 0.04℃ / s; the PCR amplification reaction system, in 30 μL volumes, includes 2–4.5 mM MgCl2, 0.2–0.25 mM dNTPs, 0.03–0.06 U / μL hot-start polymerase, 0.15–0.3 μM upstream primer, 0.05–0.35 μM mutant downstream primer, 0.2–1.2 μM enhancement-mediated probe, 0.1–0.15 μM universal fluorescent probe, and 10 μL template.

Images