SNP (Single Nucleotide Polymorphism) molecular marker combination related to duck feather color, primer group, kit and application of SNP molecular marker combination, primer group and kit
By combining SNP molecular markers at specific loci on duck chromosomes 32 and 12, the problem of purifying duck plumage color in hybrid offspring was solved, enabling rapid purification and prediction of duck plumage color and improving duck breeding efficiency.
Patent Information
- Application Number
- CN202511326923.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-17
- Publication Date
- 2025-11-04
AI Technical Summary
Existing technologies make it difficult to quickly and effectively purify the plumage of duck hybrid offspring, resulting in time-consuming and labor-intensive breeding of new duck strains. Traditional methods are limited by multi-gene control and dominant or epistatic effects.
A combination of SNP molecular markers related to duck plumage color is provided, including molecular markers S1 and S2, located at specific base sites on duck chromosomes 32 and 12. Genotype can be detected by PCR amplification and sequencing to achieve rapid purification and prediction of duck plumage color.
This technology enables rapid purification and prediction of duck plumage color, enriches the database of molecular markers for duck plumage color, and improves the efficiency of duck breeding.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker combination related to duck feather color, a primer group, a kit and application thereof. BACKGROUND
[0002] With economic development, the consumption demand for duck meat and duck eggs is gradually diversified, which puts forward more requirements for duck breeding work, and the cultivation of different duck new strains has become a hot direction in the duck breeding industry.
[0003] Ducks have rich feather colors, including white, gray, black, rough and red-brown types. Feather color is an important index for evaluating new breed development. The genetic mechanism of different duck feather colors is complex and is regulated by a complex network of signals composed of multiple genes such as MC1R, TGFbeta, Wnt, Kit and ENDRB, resulting in chaotic feather color after crossbreeding of different duck varieties. It is time-consuming and laborious to obtain a new strain with a single feather color by traditional methods, which poses a challenge to duck new strain breeding. Because feather color is controlled by multiple genes, and different genes have dominant or epistatic effects, the previously reported duck feather color-related molecular markers are mostly single markers, which are often subject to many application conditions.
[0004] Therefore, how to provide a method for quickly purifying the feather color of the crossbred offspring of different feather color duck groups has become a problem to be solved in the field. SUMMARY
[0005] The purpose of the present application is to provide a SNP molecular marker combination related to duck feather color, a primer group, a kit and application thereof. The SNP molecular marker combination has a significant correlation with the duck feather color trait, can enrich the duck feather color molecular marker database, and is beneficial to the rapid breeding of ducks. The present application specifically includes the following technical solutions: The present application provides a SNP molecular marker combination related to the duck feather color trait, which comprises molecular marker S1 and molecular marker S2. The molecular marker S1 is located at position 388 of the sequence shown in SEQ ID NO: 1 in duck chromosome 32, and there is a C / T base mutation; The molecular marker S2 is located at position 194 of the sequence shown in SEQ ID NO: 2 in duck chromosome 12, and there is a G / A base mutation.
[0006] The present application also provides a primer group combination for detecting the SNP molecular marker combination as described above, which comprises primer group 1 and primer group 2. The primer set 1 is used to detect the molecular marker S1, including the upstream primer as shown in SEQ ID NO:3 and the downstream primer as shown in SEQ ID NO:4; The primer set 2 is used to detect the molecular marker S2, including the upstream primer as shown in SEQ ID NO:5 and the downstream primer as shown in SEQ ID NO:6.
[0007] The present invention also provides a kit comprising the primer set and PCR amplification reagents as described above.
[0008] Preferably, the PCR amplification reagent includes one or more of the following: PCR buffer, dNTPs, MgSO4 solution, and KOD enzyme.
[0009] The present invention also provides the application of the SNP molecular marker combination or the primer set combination or kit described above in marker-assisted breeding of duck plumage color.
[0010] Preferably, the marker-assisted breeding of duck plumage color includes prediction and / or purification of duck plumage color.
[0011] Preferably, the prediction of duck plumage includes the prediction of plumage from the hybrid offspring of the Black-billed White-feathered Duck and the Muscovy Duck; the purification of duck plumage includes the purification of plumage from the hybrid offspring of the Black-billed White-feathered Duck and the Muscovy Duck.
[0012] The present invention also provides a method for predicting duck feather color, characterized in that the prediction is performed using the SNP molecular marker combination described above; The method includes the following steps: Using the genomic DNA or cDNA of the duck to be tested as a template, PCR amplification was performed using the primer set combination described above. The obtained amplification products were sequenced to detect the genotype of the duck DNA at molecular marker S1 and molecular marker S2. The duck feather color was predicted based on the genotype. When the genotype is TTAA or TTGA, the duck's plumage is white; When the genotype is CCAA or CCGA, the duck's plumage is black; When the genotype is CCGG or CTGG, the duck's plumage is mottled. When the genotype is TTGG, the duck's plumage is reddish-brown; When the genotype is TCAA or TCGA, the duck's plumage is gray.
[0013] The present invention also provides a rapid purification method for duck feather color, which utilizes the SNP molecular marker combination described above for purification; The rapid purification method includes the following steps: Using the genomic DNA of the duck to be tested as a template, PCR amplification was performed using the primer set combination described above. The amplification products were sequenced to detect the genotype of the duck DNA at molecular marker S1 and molecular marker S2, and breeding was carried out based on the genotype. White-feathered ducks with genotype TTAA, black-feathered ducks with genotype CCAA, mottled-feathered ducks with genotype CCGG, and red-brown-feathered ducks with genotype TTGGG were selected to obtain ducks with purified feather color.
[0014] Preferably, the predicted duck plumage color includes the prediction of plumage color from the hybrid offspring of the Black-billed White-feathered Duck and the Muscovy Duck; the purification includes the purification of plumage color from the hybrid offspring of the Black-billed White-feathered Duck and the Muscovy Duck.
[0015] The beneficial effects of this invention are as follows: This invention provides a combination of SNP molecular markers related to duck plumage traits, comprising molecular marker S1 and molecular marker S2. Molecular marker S1 is located at position 388 of the sequence shown in SEQ ID NO:1 on duck chromosome 32 and exhibits a C / T base mutation. Molecular marker S2 is located at position 194 of the sequence shown in SEQ ID NO:2 on duck chromosome 12 and exhibits a G / A base mutation. The SNP molecular markers of this invention show a significant correlation with duck plumage traits, enriching the duck plumage molecular marker database. Rapid purification of duck plumage can be achieved using these two SNP molecular markers, providing an effective approach for duck plumage prediction and plumage purification breeding. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0017] Figure 1 The results of GWAS screening analysis for plumage-related S1 marker sites; Figure 2 Results of GWAS screening analysis for plumage-related S2 marker sites; Figure 3 This is a schematic diagram of the sequencing results for the S1 and S2 sites. Detailed Implementation
[0018] This invention provides a combination of SNP molecular markers related to duck plumage traits, the combination of molecular markers including molecular marker S1 and molecular marker S2; molecular marker S1 is located at position 388 of the sequence shown in SEQ ID NO:1 on duck chromosome 32 and has a C / T base mutation; molecular marker S2 is located at position 194 of the sequence shown in SEQ ID NO:2 on duck chromosome 12 and has a G / A base mutation.
[0019] As an embodiment, the SNP molecular marker combination of the present application is combined with a self-assembled genome version. As an embodiment, the position of the molecular marker S1 in the self-assembled genome version is the 388th position of the sequence shown in SEQ ID NO: 1 in the duck chromosome 32, and the position in the IASCAAS_PekinDuck_T2T genome version on the NCBI website is: the 28th chromosome of the duck. As an embodiment, the position of the molecular marker S2 in the self-assembled genome version is the 194th position of the sequence shown in SEQ ID NO: 2 in the duck chromosome 12, and the position in the IASCAAS_PekinDuck_T2T genome version on the NCBI website is: the 12th chromosome of the duck. As an embodiment, the SNP molecular marker combination of the present application is related to the duck feather color trait. As an embodiment, the duck feather color trait includes flaky feather, red-brown feather, white feather, black feather and gray feather. According to the SNP molecular marker combination of the present application, ducks with different feather colors can be distinguished, and the duck feather color of the duck offspring can be purified according to the genotype of the molecular marker combination. As an embodiment, the prediction of the duck feather color includes the prediction of the feather color of the offspring of the cross between the white beak white feather duck and the flaky feather duck; and the purification of the duck feather color includes the purification of the feather color of the offspring of the cross between the white beak white feather duck and the flaky feather duck.
[0020] SEQ ID NO: 1: 5'-CAGTCAGAGCTCCAGAAACAGGTTTGGAAACGACTCGGGGAAGCGAGACGCGCAGCACATCAAAGGGGCAGGGGCCAGCGCTGCGGGCGCGTGGGACCGGAGGGCCGGGAGCTGGCGAAGCGGAGCCCATCCCGCGGGGCCCCGACGCTGCAGGACCGCGGCTCTGAGGCAGGGCGCGTGCTCTGCGCCCCGACACGGCGCCCGGCTGACGCGGGGGACGCCTCGCTGGGGCTCAGGGCGAGTTTCGCTGCCTGCTTCGCACGTCTTCGGGTGCCTCCGAGTCCCGGCAGCCTCTCGGCTCCGGCGTGCCCGGAGCTTTGCGGGACGGCCCCGTGGGCTCCCCGCGGCCCCCAGCTGCTCCCCCTCTTCCTCCTCGTGAAGCCGGGG [C / T]GCTCCACCAGGACTCGAGGCTTACACTAACGTTTATTTTCAGGTCCTGGTGTCCTCGCAGCCTCCCCGTGCACTTTTTTTGCTCCGGGAAGCGCTTCCCCTCCGTGGGAGCTTCTGTCAGTGACGGGGCGCGTGCTGCACAAGTGCCCGAGGAGGGGTTTACGGGGCCGGGCTCTTATCGGTTCCTTGACACCAAAACCC-3' wherein [C / T] shown by underlined indicates that C / T base mutation exists at the site.
[0021] SEQ ID NO: 2: 5'- CCCATGTCCCCTTGACCTCGCAGCTGGGTGCTGCGGGAGCGCTGGCGGGGCCAGCCGGGCACTCAGGGGGCCTGCAGGTGCTGTGGGGGGCCCTGGGGCCACGGCCGCCATCCAGGGAGCCCCCGGGGCTGAGGTCGGGGCCATGTCAACATTGGCCCCCCTGCGCCTGCTCCGTGAGCCCTGGAACGCCAGC [G / A]AGGGCAACCAGAGCAACGCCACGGCCGGGGCTGGAGGCGCCTGGTGCCAGGGGCTCGACGTGCCCAACGAACTCTTCCTCACGCTGGGGCTGGTGAGCCTGGTGGAGAACCTGCTGGTGGTGGCCGCCATCCTAAAGAACAGGAACCTGCACTCGCCCATGTACTACTTCATCTGCTGCCTGGCCGTCTCCGACATGCTGGTGAGCGTCAGCAACCTGGCGGAGACGCTCTTCATGCTGCTGATGGAGCATGGCGTGCTGGTGATCCACGCCAGCATCATCCGCCACATGGACAACATCATCGACATGCTCATCTGCAGCTCCGTCGTGTCCTCCCTCTCCTTCCTAGGGGTGATCACCGTGGACCGCTACATCACCATCTTCTACGCCCTGCGCTACCACAGCATCATGACGCTGCAGCGGGCCGTGGTCACCATGGCCAGCGTCTGGCTGGCCAGCACCGTCTCCAGCACCGTCTTCATCACCTACTACCGCAACAACGCCATCCTCCTCTGCCTCATCGGCTTCTTCC-3'.
[0022] wherein, [G / A] shown by underlined indicates that G / A base mutation exists at the site.
[0023] The application also provides a primer set combination for detecting the SNP molecular marker combination as described above, which comprises primer set 1 and primer set 2; the primer set 1 is used for detecting the molecular marker S1, comprising an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4; the primer set 2 is used for detecting the molecular marker S2, comprising an upstream primer as shown in SEQ ID NO: 5 and a downstream primer as shown in SEQ ID NO: 6.
[0024] The application also provides a kit, which comprises the primer set combination as described above and PCR amplification reagents.
[0025] As an implementation form, the PCR amplification reagents comprise one or more of PCR buffer, dNTPs, MgSO4 solution and KOD enzyme. As an implementation form, the PCR amplification reagents further comprise ddH2O.
[0026] The application also provides application of the SNP molecular marker combination or primer group combination or kit in duck feather color marker assisted breeding.
[0027] As an embodiment, the duck feather color marker assisted breeding comprises prediction of duck feather color and / or purification of duck feather color. As an embodiment, the duck feather color comprises white feather duck, black feather duck, scab feather duck, red-brown feather duck and gray feather duck. As an embodiment, the corresponding relationship between the genotype at the SNP molecular marker combination and the feather color is that when the genotype is TTAA or TTGA, the duck feather color is white feather; when the genotype is CCAA or CCGA, the duck feather color is black feather; when the genotype is CCGG or CTGG, the duck feather color is scab feather; when the genotype is TTGG, the duck feather color is red-brown feather; and when the genotype is TCAA or TCGA, the duck feather color is gray feather.
[0028] The application also provides a method for predicting duck feather color, which utilizes the SNP molecular marker combination as described above; the method comprises the following steps: taking genomic DNA of a duck to be tested as a template, performing PCR amplification by using the primer group combination as described above, sequencing the obtained amplification product, detecting the genotype of the duck to be tested at the molecular marker S1 and the molecular marker S2, and predicting the duck feather color according to the genotype.
[0029] As an embodiment, the prediction of duck feather color comprises prediction of feather color of offspring of cross between white-feathered duck with black beak and scab feather duck. As an embodiment, the corresponding relationship between the genotype and the duck feather color is the same as described above, which is not repeated here. As an embodiment, the PCR amplification procedure comprises 95℃ for 2 min, 95℃ for 30 s, 68℃ for 45 s, and a total of 35 cycles. As an embodiment, the amplification system comprises 50 ng / μl DNA 1 μl, 10 pmol / μl upstream primer and downstream primer each 0.5 μl, 10×PCR buffer 5 μl, 2 mM dNTPs 5 μl, 25 mM MgSO4 solution 2.5 μl, KOD-PLUS-Neo PCR enzyme 1 μl and ddH2O 35.5 μl.
[0030] The application also provides a rapid purification method for duck feather color, which utilizes the SNP molecular marker combination as described above; the rapid purification method comprises the following steps: taking genomic DNA or cDNA of a duck to be tested as a template, performing PCR amplification by using the primer group combination as described above, sequencing the obtained amplification product, detecting the genotype of the duck to be tested at the molecular marker S1 and the molecular marker S2, and performing breeding according to the genotype.
[0031] As an implementation form, the rapid purification method comprises feather color purification of the hybrid offspring of the white-feathered duck with black beak and the scab feather duck. As an implementation form, the selection according to the genotype comprises: selecting the white-feathered duck with the genotype of TTAA, the black-feathered duck with the genotype of CCAA, the scab feather duck with the genotype of CCGG, and the red-brown feather duck with the genotype of TTGG, to obtain the duck after feather color purification. As an implementation form, the PCR amplification procedure and the amplification system are the same as described above, and will not be repeated here.
[0032] In order to further illustrate the present application, the SNP molecular marker combination, primer group, kit and application thereof related to duck feather color provided by the present application are described in detail below in combination with the drawings and examples, but they cannot be understood as limiting the protection scope of the present application.
[0033] The white-feathered duck with black beak referred to in the present application comprises Liancheng white duck and other breeding duck varieties or strains with the characteristics of white feather and black beak, such as Wushu 10 meat duck, etc. The scab feather duck referred to in the present application comprises Miaoyang scab feather duck, Jinding duck, Gaoyang duck, etc.
[0034] Example 1 Screening of molecular markers The male scab feather duck and the female Liancheng white duck are crossed to obtain F1 generation; and the F1 is self-crossed to obtain F2 generation with separated feather color traits. The F2 generation includes scab feather duck, red-brown feather duck, white-feathered duck, black-feathered duck, and gray-feathered duck, etc. The feather colors of the F2 generation resource group are counted, and 29 black-feathered ducks, 35 white-feathered ducks, 10 gray-feathered ducks, 25 red-brown feather ducks, and 28 scab feather ducks are selected, totaling 127 ducks with different feather colors, which are subjected to 10X genome resequencing, and genome-wide association analysis (GWAS analysis). The results of the GWAS analysis are shown in Figures 1-3
[0035] Figures 1-3 As can be seen, two markers related to duck feather color are obtained by screening, which are named as molecular marker S1 and molecular marker S2. The molecular marker S1 is located at the 388th position of the sequence shown in SEQ ID NO: 1, and there is a C / T base mutation. The sequence shown in SEQ ID NO: 1 is located on the 32nd chromosome of the duck reference genome assembled by Wuhan Academy of Agricultural Sciences, and the corresponding position in the IASCAAS_PekinDuck_T2T genome version disclosed in NCBI is: the 28th chromosome of the duck. The molecular marker S2 is located at the 194th position of the sequence shown in SEQ ID NO: 2, and there is a G / A base mutation. The sequence shown in SEQ ID NO: 2 is located on the 12th chromosome of the duck reference genome assembled by Wuhan Academy of Agricultural Sciences, and the corresponding position in the IASCAAS_PekinDuck_T2T genome version disclosed in NCBI is: the 12th chromosome of the duck.
[0036] Example 2 Genotype-phenotype association analysis of SNP molecular marker combinations Using duck DNA as templates, as shown in SEQ ID NO:1 and SEQ ID NO:2, the target fragments were amplified by PCR using primer sets 1 and 2 as shown in Table 1, respectively. Primer set 1 is the amplification primer for SEQ ID NO:1, and primer set 2 is the amplification primer for SEQ ID NO:2.
[0037] Table 1 PCR Primer Information
[0038] Note: In Table 1, F is the upstream primer and R is the downstream primer.
[0039] The PCR reaction program was: 95℃ for 2 min, 95℃ for 30 s, 68℃ for 45 s, for a total of 35 cycles.
[0040] The PCR reaction system, in 50 μl increments, consisted of: 1 μl of 50 ng / μl DNA, 0.5 μl each of 10 pmol / μl upstream and downstream primers, 5 μl of 10× PCR buffer, 5 μl of 2 mM dNTPs, 2.5 μl of 25 mM MgSO4 solution, 1 μl of KOD-PLUS-Neo PCR enzyme, and 35.5 μl of ddH2O.
[0041] Using the specific primer sets shown in Table 1, nucleotides at the two variant sites S1 and S2 were detected by PCR. Allele sequencing of the amplified products was performed by direct sequencing to determine the genotype. The results are shown in Table 2.
[0042] Table 2 Genotype combinations corresponding to ducks of different plumage colors
[0043] As shown in Table 2, the correspondence between different genotype combinations and plumage color is as follows: TTAA is a homozygous white-feathered duck, CCAA is a homozygous black-feathered duck, CCGG is a homozygous mottled duck, and TTGG is a homozygous red-brown-feathered duck. Individuals with heterozygous genotypes such as TTGA, CCGA, TCGG, TCAA, and TCGA will be directly eliminated because the plumage color of their offspring will continue to separate after self-pollination.
[0044] Example 3: Validation of genotype-phenotype associations among duck populations with different plumage colors Blood samples were collected from Liancheng White Duck, Wuqin 10 Meat Duck, Mianyang Ma Duck, and Jinding Duck. DNA was extracted using the Tiangen Blood Genomic DNA Extraction Kit (catalog number: DP-304). PCR amplification and Sanger sequencing were performed using the primer set and PCR method shown in Table 1 of Example 1.
[0045] The amplified PCR products were subjected to Sanger sequencing to obtain the amplified sample sequences, and the genotypes of the two feather color-related markers were statistically analyzed. It was found that all genotypes of the White-billed Duck were GGAA, and all genotypes of the Muscovy Duck were TTGG. Therefore, the SNP marker combinations screened in Example 1 of this invention can effectively identify feather color traits in ducks.
[0046] Table 3. Correspondence between different feather colors and SNP molecular marker combination genotypes
[0047] Example 4: Rapid purification of feather color in the offspring of Liancheng White Duck and Mianyang Muscovy Duck hybrids Sixty families were established using Mianyang Muscovy ducks (♂) and Liancheng White ducks (♀) at a male-to-female ratio of 1:5. Hatching of eggs yielded the F1 generation, all of which were grey-feathered ducks.
[0048] The F1 generation was then used to create 60 families with a male-to-female ratio of 1:5 for self-pollination. The eggs were collected and incubated to produce the F2 generation, which included 797 grey-feathered ducks, 441 white-feathered ducks, 421 black-feathered ducks, 437 mottled ducks, and 146 red-feathered ducks.
[0049] Blood was collected from the wing veins of F2 generation ducks of different feather colors. DNA was extracted using the Tiangen Blood Genomic DNA Extraction Kit (catalog number: DP-304). The genotypes of molecular markers S1 and S2 were detected using Sanger sequencing. The TTAA genotype combination was retained in white-feathered ducks, the CCAA genotype combination was retained in black-feathered ducks, the CCGG genotype combination was retained in mottled-feathered ducks, and the TTGG genotype combination was retained in red-brown-feathered ducks. All gray-feathered ducks were heterozygous and could not be purified, so they were all culled.
[0050] Self-crossing the white-feathered ducks selected from the F2 generation produces an F3 generation entirely composed of white-feathered ducks; self-crossing the black-feathered ducks selected from the F2 generation produces an F3 generation entirely composed of black-feathered ducks; self-crossing the mottled-feathered ducks selected from the F2 generation produces an F3 generation entirely composed of mottled-feathered ducks; and self-crossing the red-brown-feathered ducks selected from the F2 generation produces an F3 generation entirely composed of red-brown-feathered ducks.
[0051] It can be seen that by using the molecular marker combination selected in Example 1 of this invention for breeding, after two generations, resource populations with purified plumage colors can be obtained for further breeding of production performance such as growth and reproduction.
[0052] Example 5: Rapid purification of feather color in the offspring of Wuqin 10 meat duck and Jinding duck hybrids 50 families were established using Wuqin 10 meat ducks (♂) (black-billed white-feathered) and Jinding ducks (spotted feathered) (♀) at a male-to-female ratio of 1:4. Hatching of eggs yielded the F1 generation, all of which were grey-feathered ducks.
[0053] F1 generation was used to construct 50 families with a male-to-female ratio of 1:4 for self-pollination. The eggs were collected and incubated to obtain F2 generation.
[0054] The F2 generation includes 296 grey-feathered ducks, 142 white-feathered ducks, 154 black-feathered ducks, 148 mottled ducks, and 48 red-feathered ducks.
[0055] DNA was extracted from the wing veins of ducks of different feather colors according to the method described in Example 3. The genotypes of molecular markers S1 and S2 were sequenced and detected. The TTAA genotype combination was left in white-feathered ducks, the CCAA genotype combination was left in black-feathered ducks, the CCGG genotype combination was left in mottled-feathered ducks, and the TTGG genotype combination was left in red-brown-feathered ducks. All gray-feathered ducks were heterozygous and could not be purified, so they were all eliminated.
[0056] The selected white-feathered ducks were self-crossed, and the F3 generation produced all white-feathered ducks; the selected black-feathered ducks were self-crossed, and the F3 generation produced all black-feathered ducks; the selected mottled-feathered ducks were self-crossed, and the F3 generation produced all mottled-feathered ducks; the selected red-brown-feathered ducks were self-crossed, and the F3 generation produced all red-brown-feathered ducks.
[0057] It can be seen that by using the molecular marker combination selected in Example 1 of this invention for breeding, after two generations, resource populations with purified plumage colors can be obtained for further breeding of production performance such as growth and reproduction.
[0058] In summary, this invention provides two SNP molecular markers that are highly correlated with duck feather color. These two SNP molecular markers can be used to achieve rapid purification of duck feather color, providing an effective approach for duck breeding.
[0059] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A combination of SNP molecular markers related to duck feather color traits, characterized in that, The molecular marker combination includes molecular marker S1 and molecular marker S2; The molecular marker S1 is located at position 388 of the sequence shown in SEQ ID NO:1 on duck chromosome 32 and has a C / T base mutation. The molecular marker S2 is located at position 194 of the sequence shown in SEQ ID NO:2 in duck staining No. 12, and has a G / A base mutation.
2. A primer set for detecting the SNP molecular marker combination as described in claim 1, characterized in that, The primer set combination includes primer set 1 and primer set 2; The primer set 1 is used to detect the molecular marker S1, including the upstream primer as shown in SEQ ID NO:3 and the downstream primer as shown in SEQ ID NO:4; The primer set 2 is used to detect the molecular marker S2, including the upstream primer as shown in SEQ ID NO:5 and the downstream primer as shown in SEQ ID NO:
6.
3. A reagent kit, characterized in that, The kit includes the primer set and PCR amplification reagents as described in claim 2.
4. The kit according to claim 3, characterized in that, The PCR amplification reagents include one or more of the following: PCR buffer, dNTPs, MgSO4 solution, and KOD enzyme.
5. The application of the SNP molecular marker combination of claim 1, the primer set combination of claim 2, or the kit of claim 3 or 4 in marker-assisted breeding of duck plumage color.
6. The application as described in claim 5, characterized in that, The marker-assisted breeding of duck plumage color includes the prediction and / or purification of duck plumage color.
7. The application as described in claim 6, characterized in that, The prediction of duck plumage includes the prediction of plumage from the hybrid offspring of the Black-billed White-feathered Duck and the Muscovy Duck; the purification of duck plumage includes the purification of plumage from the hybrid offspring of the Black-billed White-feathered Duck and the Muscovy Duck.
8. A method for predicting duck feather color, characterized in that, Prediction is performed using the SNP molecular marker combination as described in claim 1; The method includes the following steps: Using the genomic DNA or cDNA of the duck to be tested as a template, PCR amplification was performed using the primer set combination as described in claim 2. The obtained amplification products were sequenced to detect the genotype of the duck DNA at molecular marker S1 and molecular marker S2, and the duck feather color was predicted based on the genotype. When the genotype is TTAA or TTGA, the duck's plumage is white; When the genotype is CCAA or CCGA, the duck's plumage is black; When the genotype is CCGG or CTGG, the duck's plumage is mottled. When the genotype is TTGG, the duck's plumage is reddish-brown; When the genotype is TCAA or TCGA, the duck's plumage is gray.
9. A rapid purification method for duck feather color, characterized in that, Purification was performed using the SNP molecular marker combination as described in claim 1; The rapid purification method includes the following steps: Using the genomic DNA of the duck to be tested as a template, PCR amplification was performed using the primer set combination as described in claim 2. The obtained amplification products were sequenced to detect the genotype of the DNA of the duck to be tested at molecular marker S1 and molecular marker S2, and breeding was carried out according to the genotype. White-feathered ducks with genotype TTAA, black-feathered ducks with genotype CCAA, mottled-feathered ducks with genotype CCGG, and red-brown-feathered ducks with genotype TTGGG were selected to obtain ducks with purified feather color.
10. The method for predicting duck feather color as described in claim 8 or the rapid purification method as described in claim 9, characterized in that, The predicted duck plumage includes the predicted plumage of hybrid offspring of the Black-billed White-feathered Duck and the Muscovy-feathered Duck; The purification includes the purification of feather color in the offspring of crosses between the Black-billed White-feathered Duck and the Muscovy Duck.