Salmonella typhimurium sensor for regulating CRISPR / Cas12a activity based on DNAzyme conformation conversion and application
By using a biosensor combining DNAzyme with CRISPR/cas12a, the DNAzyme is activated by the specific binding of the aptamer to Salmonella Typhimurium, which solves the problem of insufficient sensitivity in existing detection methods and achieves highly sensitive, rapid and accurate quantitative detection of Salmonella Typhimurium.
Patent Information
- Application Number
- CN202511050616.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-29
- Publication Date
- 2025-11-04
AI Technical Summary
Existing technologies lack sufficient sensitivity in detecting Salmonella typhimurium, making it difficult to achieve rapid and accurate quantitative detection.
A biosensor combining DNAzyme and CRISPR/Cas12a is used to activate the blocked DNAzyme by the specific binding of the aptamer to Salmonella typhimurium. The reporter probe is then cleaved by the trans-cleavage activity of CRISPR/Cas12a to restore the fluorescence signal, thus achieving highly sensitive detection of Salmonella typhimurium.
It achieves highly specific detection of Salmonella Typhimurium, with a detection limit as low as 7.52 cfu/mL and a detection range of 10-105 cfu/mL. It is rapid, simple, and accurate, and reduces the background signal of the test sample.
Smart Images

Figure CN120888680A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of medical microbiological examination, and particularly relates to a biosensor for detecting Salmonella by DNAzyme and CRISPR / Cas12a. BACKGROUND
[0002] The information disclosed in this background section is intended to provide an overview of the general background of the application and is not necessarily a concession that the information was prior art to the present application.
[0003] Food safety is a global public health concern, which not only affects human health but also brings huge losses to society and economy. Consuming food contaminated by foodborne pathogenic bacteria often causes symptoms such as diarrhea, vomiting, nausea, and even death in severe cases. The incidence and mortality of foodborne diseases are high worldwide, and Salmonella typhimurium (S. typhimurium) is a common microorganism that can be ingested through food and cause foodborne diseases, which can cause foodborne diseases including diarrhea, abdominal cramps, fever, gastroenteritis, and severe sepsis. Salmonella typhimurium
[0004] As a functional nucleic acid that can specifically cleave RNA, DNAzyme has become a common tool in biosensing. Because DNAzyme has high programmability, it can be easily combined with nanomaterials, nucleic acid circuit modules, etc., and can easily realize signal amplification and has high sensitivity. Due to its high catalytic efficiency, good chemical stability, strong specificity, and easy preparation, DNAzyme has been widely used in various biomedical and biosensor designs. The CRISPR / Cas system, as a new gene editing method, has attracted attention due to its economy, efficiency, simplicity of design, and high specificity, and has shown good prospects in the field of instant diagnosis and pathogen detection. At the same time, biosensors as signal amplification elements can quickly acquire and process information. Pathogen nucleic acid sequences can be converted into physical and chemical information that is easy to measure, enabling qualitative or quantitative detection. SUMMARY
[0005] To solve the problems in the prior art, the application provides a sensor for detecting S. typhimurium, which improves the detection sensitivity of S. typhimurium by using the combination of DNAzyme and CRISPR / cas12a.
[0006] To achieve the above-mentioned purpose, the application adopts the following technical solutions.
[0007] A DNAzyme and CRISPR / cas12a-based biosensor for detecting Salmonella typhimurium, comprising: an Apt-T complex probe, a D strand, a TS strand, a crRNA, a Cas12a protein, Mg 2+ and a reporter probe FQ. The Apt-T complex probe is obtained by hybridization of an aptamer Apt and a T strand. The D strand and the TS strand are hairpin structures. The nucleotide sequences of the aptamer Apt, the T strand, the D strand, the TS strand and the crRNA are as shown in SEQ ID NOs: 1-5. The 44th position of the TS strand is a ribonucleotide site. The sequence of the reporter probe FQ is 5'-TTATT-3', and one end is connected with a fluorescent group and the other end is connected with a quenching group.
[0008] Preferably, the fluorescent group is FAM and the quenching group is BHQ1.
[0009] A preparation method of the above biosensor, comprising the following steps: (1) obtaining an Apt-T complex probe by naturally cooling the aptamer Apt and the T strand after heat denaturation; (2) obtaining a hairpin structure D strand or TS strand by cooling on ice after heat denaturation of the D strand or the TS strand, respectively; (3) mixing the Apt-T complex probe, the D strand, the TS strand, the crRNA, the Cas12a protein, Mg 2+ and the reporter probe FQ in a solution to obtain the biosensor.
[0010] The above biosensor can be used to prepare a kit for detecting Salmonella typhimurium.
[0011] Preferably, the kit further comprises a ribonuclease inhibitor.
[0012] A method for detecting Salmonella typhimurium using the above biosensor and kit, comprising the following steps: (1) incubating the test solution or the control solution with each component of the biosensor to obtain an incubation solution; (2) selecting appropriate fluorescence detection conditions according to the fluorescent group of the reporter probe FQ, and detecting the fluorescence intensity.
[0013] The control solution can be a blank control or a series of positive controls.
[0014] In order to adapt to the portability of detection and prevent ribozyme in the environment from degrading the components in the sensor, a ribonuclease inhibitor is also added for co-incubation in step (1).
[0015] The principle of the present application is as shown Figure 1 The specific nucleic acid elements used are as follows: APT: 5'-CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATT GGGCCTTTGTGATGTCGGTAGT -3'; T strand: 5'-ACCGAGCC ACTACCGACATCACAAAGGCCC TGACGAACGGTT-3'; D strand: 5'-CTACCGACATCA TCCGAGCCGGTCGTCGAAA AACCGTTCGTCAGGGCCTTTGTGATGTCGGTAGTGGCTCGGT-3'; TS strand: 5'-ACCGAGCCACTACCGACATCACAAAGGCCCTGACGAACGGTTG / rA / TAATGACGAACTCCTCCTTATGATTTGTGATGTCGG-3'; crRNA: 5'-CCGACAUCACAAAUCAUAGAUGUGAAUCAUCUUUAAUU-3'; FQ: 5'-FAM-TTATT-BHQ1-3' Among them, S. typhimurium The aptamer Apt and the T strand, both of which have complementary underlined parts, can form a complex probe; The T strand contains a region complementary to the aptamer and the D strand; The region marked by the underlined part in the D strand is the active center of the DNAzyme, which can be closed by forming a hairpin structure; The TS strand contains an rA site, which is the substrate of the DNAzyme.
[0016] The above nucleic acid elements, crRNA, Cas12a protein, Mg 2+ and the reporter probe FQ, in the presence of the target, undergo the following processes: Through the binding of the aptamer Apt to the target, the T strand is released; the T strand binds to the D strand of the hairpin structure, which opens the hairpin structure and exposes the active region of the DNAzyme, in the presence of Mg 2+Under the action of [unclear], DNAzyme activation is achieved, enabling specific cleavage of the hairpin TS modified with rA sites, thereby releasing the CRISPR / Cas12a activation strand S (5'-TAATGACGAACTCCTCCTTATGATTTGTGATGTCGG-3'). The activated CRISPR / Cas12a, guided by crRNA, cleaves the reporter probe FQ through its trans-cleavage activity, restoring the fluorescence signal. The presence and concentration of the target analyte are detected by detecting changes in fluorescence intensity. Through this strategy, this invention achieves signal amplification even in the presence of small amounts of the target analyte, which can [unclear] S. typhimurium This provides a stable, simple, and efficient biosensing platform for detection.
[0017] The present invention has the following advantages: The biosensor provided by this invention has a low detection limit and utilizes the specific recognition of nucleic acid aptamers. It achieves highly specific detection of the target analyte by leveraging the binding of the aptamer to *Salmonella typhimurium*. This is achieved through the binding of the aptamer with... S. typhimurium The binding of activators releases and activates the blocked DNAzyme, and the activated DNAzyme then reacts with Mg. 2+ Under the action of [unclear], the target hairpin is cut, generating a single strand that activates the trans-cleavage activity of CRISPR / Cas12a. The trans-cleavage activity of CRISPR / Cas12a then non-specifically cleaves the reporter probe FQ, restoring the fluorescence signal and thus achieving specific detection of Salmonella typhimurium. This biosensor [unclear]... S. typhimurium The detection limit is 7.52 cfu / mL, and the detection range is 10⁻¹⁰. 5 The cfu / mL concentration is superior to most existing methods. Furthermore, compared to existing detection methods, this method effectively reduces the background signal of the sample. This sensor offers advantages such as fast detection speed, simple operation, low detection limit, and high specificity, overcoming the shortcomings and deficiencies of existing detection methods for Salmonella typhimurium and achieving rapid and accurate quantitative detection. Attached Figure Description
[0018] Figure 1 This is a schematic diagram of the experiment. Figure 2 This is a diagram showing the feasibility verification results of the biosensor. Figure 3 Optimized detection results for reaction time, reaction temperature, and the ratio of hairpin D to hairpin TS; Figure 4 The graph shows the results of the biosensor performance analysis. Detailed Implementation
[0019] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.
[0020] Example 1: Construction of Biosensors 1. Preparation of bacterial samples All bacteria used in the experiment were grown in Luria-Bertani medium prepared with 12 g tryptone, 7 g sodium chloride, and 6 g yeast extract, and incubated at 37°C for 12 h in a constant temperature shaker. After centrifugation at 800 rpm for 5 min, the cultured bacteria were washed once with PBS and resuspended in PBS. Bacterial concentration was determined using the plate count method.
[0021] 2. Preparation of nucleic acid elements (1) Equal volumes of 10 μM Apt chain and 10 μM T chain were incubated together in NEBuffer 2.1 reaction buffer solution at 95 °C for 5 min, and then naturally cooled and annealed to room temperature to form Apt-T composite probe.
[0022] (2) All used for S. typhimurium All samples tested were prepared in NEBuffer 2.1 reaction buffer solution. The detailed steps are as follows: D-chain or TS-chain was incubated in NEBuffer 2.1 reaction buffer solution in a 95°C water bath for 5 min, and then quickly placed in an ice-water bath for at least 40 min.
[0023] All of the above DNA strands were stored at 4°C for later use.
[0024] 3. Construction of biosensors Biosensors can be constructed in the following manner: a. Take 3 μL of S. typhimurium (10) 5 (cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T composite probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10× buffer (3 μL), ribonuclease inhibitor (1 μL), and 8 μL of water; b. Add 3 μL of S. typhimurium (10) 5 (cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T complex probe (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10× buffer (3 μL), ribonuclease inhibitor (1 μL), and 11 μL of water; c. Take 3 μL of S. typhimurium (10) 5 (cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T complex probe (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10× buffer (3 μL), ribonuclease inhibitor (1 μL), and 11 μL of water; d. Add 3 μL of Escherichia coli (10) 5 (cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T composite probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10× buffer (3 μL), ribonuclease inhibitor (1 μL), and 8 μL of water; e. Add 3 μL of PBS to 18 μL of a mixed solution consisting of Apt-T composite probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10× buffer (3 μL), ribonuclease inhibitor (1 μL), and 8 μL of water; The above systems were incubated at 37°C for 90 min; then, measurements were performed using a fluorescence spectrophotometer. The excitation wavelength of the fluorescence spectrometer was 480 nm, and the emission wavelengths between 500 and 650 nm were collected. The slit width for both the excitation and emission wavelengths was 3 nm.
[0025] The results are as follows Figure 2 As shown: When the target substance exists in the system S. typhimurium When the target analyte is present, a strong fluorescence signal is clearly obtained at 525 nm (curve a); conversely, when the target analyte is absent, only a weak fluorescence signal is obtained at 525 nm (curve e). This indicates that the sensing platform has a strong signal-to-background ratio. When the target analyte is present, it triggers specific cleavage of the DNAzyme, thereby activating the trans-cleavage activity of CRISPR / Cas12a to cleave the reporter probe FQ and thus restore the fluorescence signal. If the D chain with the DNAzyme sequence or the hairpin TS is not added in the system, the obtained fluorescence signal is not obvious (curves b, c), which shows that the system can only obtain a weak fluorescence signal because it lacks DNAzyme that can release the cut hairpin TS and S chain that triggers CRISPR / Cas12a, indicating that the hairpin TS with DNAzyme and the trigger chain S are indispensable important parts in the reaction system. In addition, when the target is replaced by non-target E. coli, only a weak fluorescence signal can be obtained (curve d), which shows that only when the target exists in the system, the probe Apt-T can accurately recognize, thereby triggering the subsequent reaction to obtain a strong fluorescence signal. S. typhimurium
[0026] Example 2 Influence of reaction time on the performance of the sensor 3 μL of E. coli (10 S. typhimurium 5 cfu / mL) was added to 18 μL of a mixed solution composed of Apt-T complex probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10x buffer (3 μL), ribonuclease inhibitor (1 μL), and water 8 μL; the above system was incubated at 37°C for 30, 60, 90, and 120 min, respectively; then the fluorescence spectrophotometer was used for determination. The excitation wavelength of the fluorescence instrument was 480 nm, and the emission wavelength at 525 nm was collected.
[0027] The results are shown in Figure 3 A, the fluorescence intensity of the system continuously increased with the increase of time, and when the time reached 90 min, the fluorescence intensity reached a maximum value, and then the fluorescence intensity changed little with the further increase of reaction time. Therefore, 90 min was selected as the optimal reaction time.
[0028] Example 3 Influence of reaction temperature on the performance of the sensor 3 μL of E. coli (10 S. typhimurium 5 cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T complex probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10x buffer (3 μL), RNase inhibitor (1 μL), and water 8 μL; the above system was incubated at 17, 27, 37, 47, 57°C for 90 min, respectively; then the fluorescence spectrophotometer was used for determination. The excitation wavelength of the fluorescence instrument was 480 nm, and the emission wavelength at 525 nm was collected.
[0029] The results are shown in Figure 3 As shown in FIG. B, with the increase of temperature, the fluorescence intensity in the reaction system also increased, and after exceeding 37°C, the fluorescence intensity gradually decreased, indicating that the activity of CRISPR / Cas12 was strongly affected. Therefore, 37°C was selected as the optimal reaction temperature.
[0030] Example 4 Influence of the ratio of hairpin D to TS on the performance of the sensor 3 μL of S. typhimurium (10 5 cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T complex probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10x buffer (3 μL), RNase inhibitor (1 μL), and water 8 μL; the above system was incubated at 17, 27, 37, 47, 57°C for 90 min, respectively; then the fluorescence spectrophotometer was used for determination. The excitation wavelength of the fluorescence instrument was 480 nm, and the emission wavelength at 525 nm was collected.
[0031] The results are shown in Figure 3 As shown in FIG. C, when the ratio was 1:1, the fluorescence intensity reached the maximum, and when the ratio exceeded this, the fluorescence intensity did not change significantly, because when the molar concentration ratio of the two was 1:1, the DNAzyme sequence in the hairpin D chain could open the closed TS to produce enough S, thereby activating the activity of CRISPR / Cas12a to produce a fluorescence signal, and therefore 1:1 was selected as the optimal molar concentration ratio of the two hairpins.
[0032] Example 5 Performance analysis of the sensor Under the optimal experimental conditions, the constructed sensor was used to detect different concentrations ofS. typhimurium The detection performance was analyzed: 3 μL of S. typhimurium (0, 10, 50, 1×10 2 , 5×10 2 , 1×10 3 , 5×10 3 , 1×10 4 , 5×10 4 , 1×10 5 cfu / mL) was added to 18 μL of a mixed solution consisting of Apt-T complex probe (3 μL, 10 μM), hairpin D (3 μL, 10 μM), hairpin TS (3 μL, 10 μM), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 10×buffer (3 μL), ribonuclease inhibitor (1 μL), and water 8 μL; the above system was incubated at 37°C for 90 min; then the fluorescence spectrophotometer was used for determination. The excitation wavelength of the fluorescence instrument was 480 nm, and the emission wavelength between 500-650 nm was collected; and the fluorescence intensity calibration curve at different concentrations S. typhimurium of 525 nm was constructed.
[0033] The results are shown in Figure 4 A, when Figure 4 the concentration of S. typhimurium increased from 0-1×10 5 cfu / mL, the fluorescence intensity of the sensor at 525 nm also increased. From Figure 4 B, it can be seen that S. typhimurium the concentration has a good linear relationship in the range of 10-1×10 5 cfu / mL. The regression linear equation is F=162.759+40.120lg C , and the correlation coefficient R 2 is 0.987. According to the three standard deviations of the blank response, the detection limit of the sensor is calculated as 7.52 cfu / mL.
[0034] The above only describes the embodiments of the present application and is not used to limit the present application. For those skilled in the art, the present application can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the scope of the claims of the present application.
Claims
1. A DNAzyme and CRISPR / Cas12a-based biosensor for detecting Salmonella Typhimurium, characterized in that, include: Apt-T complex probe, D chain, TS chain, crRNA, Cas12a protein, Mg 2+ The Apt-T composite probe is obtained by hybridization of the aptamer Apt and the T chain; the D chain and TS chain have a hairpin structure; the nucleotide sequences of the aptamer Apt, T chain, D chain, TS chain and crRNA are as described in SEQ ID NO:1-5; the 44th position of the TS chain is a ribonucleotide site; the sequence of the reporter probe FQ is 5'-TTATT-3', with a fluorescent group attached to one end and a quenching group attached to the other end.
2. A method for preparing a biosensor as described in claim 1, characterized in that, Includes the following steps: (1) The aptamer Apt and T chain were thermally denatured and then naturally cooled to obtain the Apt-T composite probe; (2) The D-chain or TS-chain is thermally denatured and then cooled on ice to obtain the hairpin structure D-chain or TS-chain respectively; (3) Combine Apt-T complex probe, D chain, TS chain, crRNA, Cas12a protein, and Mg 2+ The biosensor was obtained by mixing the report probe FQ in solution.
3. A kit for detecting Salmonella typhimurium comprising the biosensor as described in claim 1.
4. The reagent kit according to claim 3, characterized in that, The kit also includes a ribonuclease inhibitor.
5. A method for detecting Salmonella typhimurium using the biosensor as described in claim 1 or the kit as described in claim 3 or 4, characterized in that, Includes the following steps: (1) Mix the test solution or control solution with each component of the biosensor and incubate to obtain an incubation solution; (2) Select appropriate fluorescence detection conditions based on the fluorescent group of the report probe FQ, and detect the fluorescence intensity.
6. The method according to claim 5, characterized in that the control solution is a blank negative control and / or a series of positive controls.
7. The method according to claim 5, characterized in that a ribonuclease inhibitor is added for co-incubation in step (1).
Citation Information
Patent Citations
Application of DNAzyme activated CRISPR / Cas12a system to detection of salmonella
CN118256507A
Rapid detection method for salmonella typhimurium in water
CN118600062A