A primer probe combination for detecting bifidobacterium animalis ssp and application thereof

Abstract

The application discloses a primer probe combination for detecting animal bifidobacterium sub-species and application thereof, and belongs to the technical field of biology. The primer probe combination comprises a primer probe combination for detecting animal bifidobacterium lactis sub-species and a primer probe combination for detecting animal bifidobacterium animalis sub-species. The application provides a primer probe combination for animal bifidobacterium sub-species, which can be used for single-plex PCR detection and double-plex PCR detection, can be used for accurately detecting animal bifidobacterium lactis sub-species and animal bifidobacterium animalis sub-species, realizes development of animal bifidobacterium sub-species resources and identification of authenticity of products containing animal bifidobacterium, and provides a more convenient method for detecting animal bifidobacterium sub-species.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a primer-probe combination for detecting animal subspecies of Bifidobacterium and its application. Background Technology

[0002] Bifidobacteria, as important probiotics in the human gut, play a crucial role in maintaining intestinal microecological balance, promoting digestion and absorption, and enhancing the body's immunity. Animal Bifidobacteria comprises two subspecies: *Bifidobacterium animalis* subsp. *animalis* and *Bifidobacterium animalis* subsp. *lactis*. Although they belong to the same genus, they differ in biological characteristics, ecological distribution, and function. For example, the optimal growth temperature for *Bifidobacterium animalis* subsp. *animalis* is 39-41℃; it cannot grow in environments exposed to air and CO2, nor in milk or milk-containing culture media. In contrast, the optimal growth temperature for *Bifidobacterium animalis* subsp. *lactis* is 39-42℃; it can grow under 10% oxygen conditions and in milk or milk-containing culture media. In practical applications, *Bifidobacterium animalis* subsp. lactis is commonly used in dairy product fermentation and milk beverage production. For example, *Bifidobacterium animalis* subsp. lactis BLa80, which was officially included in the "List of Strains that can be Used in Infant Foods" on July 2, 2025, has been clinically proven to significantly improve the treatment effect of diarrhea, shorten the course of the disease, and rapidly improve stool form. *Bifidobacterium animalis* subsp. also has unique application value in related fields.

[0003] Accurate detection and differentiation of these two subspecies are crucial for studying the structure of the gut microbiota, evaluating the quality and efficacy of probiotic products, conducting related disease prevention and treatment, and developing probiotic strain resources. In the food industry, identifying the specific subspecies of Bifidobacterium animalis contained in a product helps ensure consistency in product quality and efficacy. In pharmaceutical research and development, developing corresponding microecological preparations based on the characteristics of different subspecies can improve therapeutic effects. However, current detection technologies for Bifidobacterium animalis and Bifidobacterium lactis have many shortcomings. Traditional detection methods, such as morphological observation and physiological and biochemical identification, are cumbersome, time-consuming, and have low accuracy. Morphologically, both subspecies of Bifidobacterium animalis are Gram-positive, non-spore-forming, irregular rod-shaped anaerobic bacteria, making accurate differentiation difficult based on morphology alone. Although their physiological and biochemical characteristics differ, the detection process requires multiple experiments, is complex, and is easily affected by environmental factors. For example, in carbohydrate fermentation experiments, the fermentation products and their extent may deviate under different culture conditions, affecting the judgment results.

[0004] Molecular biology detection techniques, such as conventional PCR, while possessing high sensitivity, lack the specificity of probe-based fluorescent PCR methods, and the amplified products require electrophoresis detection, making the process cumbersome. Furthermore, most existing detection methods can only detect a single subspecies, failing to provide rapid and accurate multiplex detection of both *Bifidobacterium animalis* subspecies *Animal* and *Bifidobacterium lactis*, thus failing to meet the demands of high-efficiency, high-throughput detection in practical applications. For example, in large-scale probiotic product quality screening or gut microbiota studies, detecting only one subspecies at a time is inefficient and increases detection costs and time. Therefore, developing a primer-probe combination capable of accurately, rapidly, and efficiently detecting both *Bifidobacterium animalis* subspecies *Animal* and *Bifidobacterium lactis*, and supporting both single-species and multiplex detection, is of significant practical importance. Summary of the Invention

[0005] The purpose of this invention is to provide a primer-probe combination for detecting *Bifidobacterium animalis* subspecies and its application, thereby addressing the problems existing in the prior art. This invention provides a primer-probe combination for *Bifidobacterium animalis* subspecies that can be used for both singleton and doubleton PCR detection, enabling accurate detection of *Bifidobacterium animalis* subsp. lactis and subsp. animalis, and facilitating the authentication of products containing *Bifidobacterium animalis*. This provides a more convenient method for detecting *Bifidobacterium animalis* subspecies.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a primer-probe combination for detecting Bifidobacterium animalis subspecies, the primer-probe combination including a primer-probe combination for detecting Bifidobacterium animalis subsp. lactis and a primer-probe combination for detecting Bifidobacterium animalis subspecies.

[0008] The primer-probe combination for detecting Bifidobacterium lactis subsp. animalis consists of an upstream primer as shown in SEQ ID NO.1, a downstream primer as shown in SEQ ID NO.2, and a probe as shown in SEQ ID NO.3;

[0009] The primer-probe combination for detecting Bifidobacterium animalis subspecies consists of an upstream primer as shown in SEQ ID NO.5, a downstream primer as shown in SEQ ID NO.6, and a probe as shown in SEQ ID NO.7.

[0010] The present invention also provides the application of the above primer-probe combination in the preparation of a single detection kit for Bifidobacterium animalis subspecies, wherein the Bifidobacterium animalis subspecies includes Bifidobacterium lactis subspecies and Bifidobacterium animalis subspecies.

[0011] The present invention also provides a single detection kit for Bifidobacterium animalis subspecies, wherein the single detection kit contains the above-mentioned primer-probe combination.

[0012] This invention also provides a single-detection method for non-diagnostic Bifidobacterium subspecies in animals, comprising the following steps:

[0013] Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the above-mentioned single detection kit.

[0014] If the sample to be tested is detected using a primer-probe combination of Bifidobacterium animalis subsp. lactis and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium animalis subsp. lactis is present in the sample to be tested; if the sample to be tested is detected using a primer-probe combination of Bifidobacterium animalis subsp. lactis and no amplification curve is observed, or the Ct value is ≥30, then it is determined that Bifidobacterium animalis subsp. lactis is not detected in the sample to be tested.

[0015] If the sample to be tested is detected using a primer-probe combination of Bifidobacterium animalis subsp. animalis and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium animalis subsp. animalis is present in the sample to be tested; if the sample to be tested is detected using a primer-probe combination of Bifidobacterium animalis subsp. animalis and no amplification curve is observed, or the Ct value is ≥30, then it is determined that Bifidobacterium animalis subsp. animalis is not detected in the sample to be tested.

[0016] If the sample to be tested has an amplification curve, but 25 < Ct value < 30, it is determined to be an uncertain sample and needs to be retested.

[0017] Optionally, the reaction system for the fluorescent PCR detection is: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL of probe, 1 μL of DNA template, and ddH2O to bring the total to 20 μL.

[0018] The reaction conditions for the fluorescence PCR detection were: hot start at 95℃ for 10 min; denaturation at 95℃ for 10 s; annealing / extension at 60℃ for 30 s, for a total of 35 cycles.

[0019] The present invention also provides the application of the above primer-probe combination in the preparation of a dual detection kit for Bifidobacterium animalis subspecies, characterized in that the Bifidobacterium animalis subspecies includes Bifidobacterium lactis subspecies and Bifidobacterium animalis subspecies.

[0020] The probe for detecting Bifidobacterium lactis subsp. animalis is equipped with a FAM fluorescent group; the probe for detecting Bifidobacterium animalis subsp. animalis is equipped with a VIC fluorescent group.

[0021] The present invention also provides a dual detection kit for Bifidobacterium animalis subspecies, the dual detection kit comprising the above-mentioned primer-probe combination; and the probe for detecting Bifidobacterium animalis subsp. lactis is supplemented with a FAM fluorescent group; the probe for detecting Bifidobacterium animalis subsp. animalis is supplemented with a VIC fluorescent group.

[0022] This invention also provides a dual detection method for animal Bifidobacterium subspecies for non-diagnostic purposes, comprising the following steps:

[0023] Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the above-mentioned dual detection kit.

[0024] If the sample to be tested has an amplification curve in the FAM detection channel and the Ct value is ≤25, it is determined that Bifidobacterium animalis subsp. lactis is present in the sample to be tested; if the sample to be tested has an amplification curve in the VIC detection channel and the Ct value is ≤25, it is determined that Bifidobacterium animalis subsp. animalis is present in the sample to be tested; if the sample to be tested has an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value < 30, it is determined to be an uncertain sample and needs to be retested.

[0025] Optionally, the reaction system for the fluorescent PCR detection is: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL each of probes, 1 μL of DNA template, and ddH2O to bring the total to 20 μL.

[0026] The reaction conditions for the fluorescence PCR detection were: hot start at 95℃ for 10 min; denaturation at 95℃ for 10 s; annealing / extension at 60℃ for 30 s, for a total of 35 cycles.

[0027] The present invention also provides the application of the above-mentioned single detection kit or the above-mentioned dual detection kit in the identification of the authenticity of products containing Bifidobacterium animalis subspecies, wherein the Bifidobacterium animalis subspecies includes Bifidobacterium lactis subspecies and Bifidobacterium animalis subspecies.

[0028] The present invention discloses the following technical effects:

[0029] This invention identifies highly conserved and well-covered single-copy sequences by comparing the genomes of different subspecies of Bifidobacterium animalis. Specific primers and probes are designed using these single-copy sequences as target sequences, enabling the accurate identification of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis.

[0030] The primer-probe combination designed in this invention for *Bifidobacterium animalis* subsp. *lactamella* and *Bifidobacterium animalis* subsp. *animal* can be used for both singleton and duplex PCR detection, offering high flexibility and allowing for adjustments based on actual needs, thereby reducing detection costs. This primer-probe combination boasts advantages such as high sensitivity, strong specificity, and rapid detection, making it highly valuable for the development of *Bifidobacterium animalis* strain resources and the authentication of products containing *Bifidobacterium animalis*. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 Figure showing the results of the exclusivity verification of the primer-probe combination for Bifidobacterium lactis.

[0033] Figure 2 Figure showing the results of the exclusivity verification of the primer-probe combination for Bifidobacterium animalis subspecies;

[0034] Figure 3 Figure showing the inclusion validation results of the primer-probe combination for Bifidobacterium lactis subsp. animalis;

[0035] Figure 4 Figure showing the inclusion validation results of the primer-probe combination for Bifidobacterium animalis subspecies;

[0036] Figure 5 The sensitivity detection results of the primer-probe combination for Bifidobacterium lactis are shown in the figure.

[0037] Figure 6 The sensitivity detection results of the primer-probe combination for Bifidobacterium animalis subspecies;

[0038] Figure 7 The amplification efficiency detection results of the primer-probe combination for Bifidobacterium lactis are shown in the figure.

[0039] Figure 8 The standard curve for the primer-probe combination of Bifidobacterium animalis subsp. lactis shows an amplification efficiency of 98.3% and a slope of -3.364.

[0040] Figure 9 The amplification efficiency detection results of the primer-probe combination for Bifidobacterium animalis subspecies;

[0041] Figure 10The standard curve for the primer-probe combination of Bifidobacterium animalis subspecies is shown; its amplification efficiency is 94.5% and the slope is -3.461.

[0042] Figure 11 The graph shows the sensitivity detection results of Bifidobacterium animalis subsp. lactis in the double PCR detection of Bifidobacterium animalis.

[0043] Figure 12 The graph shows the sensitivity detection results of animal subspecies of Bifidobacterium animalis in the duplex PCR detection of Bifidobacterium animalis.

[0044] Figure 13 The figure shows the amplification efficiency of Bifidobacterium animalis subsp. lactis in the double PCR detection of Bifidobacterium animalis.

[0045] Figure 14 The standard curve for the double PCR detection of Bifidobacterium animalis subsp. lactis is shown; the amplification efficiency is 93.2% and the slope is -3.496.

[0046] Figure 15 The figure shows the amplification efficiency of animal subspecies of Bifidobacterium animalis in the duplex PCR detection of Bifidobacterium animalis.

[0047] Figure 16 The standard curve for the double PCR detection of Bifidobacterium animalis subspecies is shown; the amplification efficiency is 95.1% and the slope is -3.445. Detailed Implementation

[0048] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0049] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0050] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0051] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0052] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0053] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0054] Example 1: Design of Specific Primers and Probes

[0055] Based on the complete genome sequence of the target bacterial species, specific sequences were screened using multiple bioinformatics tools. First, the complete genome sequences of multiple strains of the target bacterial species and reference genome sequences of closely related bacterial species were downloaded from the NCBI database. Then, the complete genomes of multiple strains of the target bacterial species were aligned using Mauve software to extract conserved core blocks. To further screen for specific regions of the target bacterial species, a BLAST+local alignment method was used to compare the segmented core blocks with a database constructed from the genomes of non-target bacterial species. Strict filtering thresholds were set during the alignment process, retaining only single-copy fragments not appearing in non-target databases as candidate specific sequences. Finally, statistical analysis and coverage evaluation were performed on the candidate fragments to screen for specific sequences with high coverage. For each target bacterial species, 2-5 single-copy specific sequences with high coverage were selected as target sequences. Primers and probes were designed using Primer 3.0 software, and the specificity and amplification efficiency of the primers and probes were tested using a standard Bifidobacterium strain. The primer and probe screening results are shown below:

[0056] The specific primers and probes (5'-3') for Bifidobacterium animalis subsp. lactis are as follows:

[0057] Upstream primer B. animalis lactis-F: GGGCGAATAAGGCCATACG, SEQ ID NO.1;

[0058] Downstream primer B. animalis lactis-R: TTGTCGGGCACTGCAATGT, SEQ ID NO.2;

[0059] Fluorescent probe B. animalis lactis-P: TCATGCCGCACAGCCACTGC, SEQ ID NO.3.

[0060] The target sequences for primers and probes targeting *Bifidobacterium animalis* subsp. *lactum* are:

[0061] TTATCTGCCAGTATTCCTGGCGTTCCTCTTGGCTTCGCGTTCACGGCGTTTCGCCTCTTTTTCGGCCTTGTATCTGTCAGAGAGCTCGGCAACACCGTCGAGTGTATGTGGAAGACCATTCTTATCGAGCTCCTCCAGCAGTTGCGTTGTTACTCGCTCGAGTGATGATTCACGAGCCAGAAGCACGGCTTCAGAGTTGATACTTGAGAATGGGCGAATAAGGCCATACGGTGAGTCAATGCCGCACAGCCACTGCCACATTGCAGTGCCCGACAGATAGCGGTAACGAAAATTCTTGAGATCGGCGTTCTCCTGAGTCACTCCGCTCACCTCGAACGTACGCCATTCGTCTTTACTGATAGTCGAACGCGTGATGCAGATTGCTGCCTCCACTCTCTGATTCGAAGCACGTTTACGGCCCGTAATCTCCTTCATGCGTTGACGTAAACTCCTCAATTCATTGGGGAACGACGATGAATTGGTCGTGTTCTCTTGTGACTTGAGTTCAATCACATAGACCGCTCCATCTCTGGTCGCGGTCAAATCACCCGTATCAATAGCGTTTTCGGCAATGCTGGCAATCAACTCCTGCCAACGGGTACCCATTGCCGTCTCTTCGCTTGAAGATTCGACTGCGTGGAAAGCCTCACGCGCATAGTCTTCAGCGGTTTCAATACCACGCAGAGCATAAATTGCAAAATCCTTGCCCAGCAAACGCTCATAGGTCATTGAGGAGCTTCCCGTGCCATCGTAAAAAGCGATTCGACTCTGAATGTAGGCATTTAGAATGGAGCGGGCGCTTTCTCTACGTGCTTCTTCCTCGGCTGCGCTGTCGTAAATTCTCACTTGATCTTCCATATGGATTAACCGTAGTGTGCGTATCCTGCATATGCAAATCTTTATGAGACTGTGTAATGTCTGTCGCAGGATTTCAGGCTGAAATGCGTATTTCAT,SEQ ID NO.4。

[0062] The animal subspecies-specific primers and probes (5'-3') for Bifidobacterium animalis are as follows:

[0063] Upstream primer B. animalis animalis-F: GTGAAAGACACTTGGCGATATGAC, SEQ ID NO.5;

[0064] Downstream primer B. animalis animalis-R: CACGAATACTTCGGCAAGCA, SEQ ID NO.6;

[0065] Fluorescent probe B. animalis animalis-P: ATGGCATCGCCGAAAATCGCC, SEQ ID NO.7;

[0066] The target sequences for primers and probes targeting the animal subspecies of Bifidobacterium animalis are:

[0067] , SEQ ID NO.8.

[0068] Example 2 Construction of a singlet fluorescent PCR reaction system

[0069] Extract DNA from the sample to be tested (using a bacterial genomic DNA extraction kit or other recognized extraction methods with equivalent efficacy) and store at -20°C for later use.

[0070] The total volume of the fluorescent PCR reaction system was 20 μL: 10 μL of 2×PCR Mix, 1 μL each of forward and reverse primers (10 pmol / μL), 0.5 μL each of probe (10 pmol / μL), 1 μL of sample DNA template, and ddH2O to make up the volume.

[0071] The fluorescent PCR reaction conditions were: 95℃ for 10 min hot start; 95℃ for 10 s denaturation; 60℃ for 30 s annealing / extension, for a total of 35 cycles.

[0072] Result interpretation: If the sample to be tested shows an amplification curve when detected with a primer probe of a certain Bifidobacterium and the Ct value is ≤25, then the Bifidobacterium species is detected in the sample to be tested; if the sample to be tested does not show an amplification curve when detected with a primer probe of a certain Bifidobacterium and the Ct value is ≥30, then the Bifidobacterium species is not detected in the sample to be tested; if the sample to be tested shows an amplification curve when detected with a primer probe of a certain Bifidobacterium and 25 < Ct < 30, then it is considered an indeterminate sample and needs to be retested.

[0073] Example 3: Establishment of a single-color fluorescent PCR detection kit

[0074] This quantitative real-time PCR detection kit for rapid identification of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis includes: 2×PCR Mix, upstream and downstream primers and probes for Bifidobacterium animalis subsp. lactis (concentration 100 pmol / μL), upstream and downstream primers and probes for Bifidobacterium animalis subsp. animalis (concentration 100 pmol / μL), positive control, negative control, instructions, and the kit itself.

[0075] The positive controls mentioned above were mixtures of plasmids containing amplified fragments prepared in equal proportions, with corresponding Ct values ​​ranging from 18 to 21. The plasmid for *Bifidobacterium animalis* subsp. *lactamella* was obtained by cloning the 64 bp fragment sequence (positions 212-275 of SEQ ID NO. 4) corresponding to the synthetic *Bifidobacterium animalis* subsp. *lactamella* primers and probes into the pGM-T vector; the plasmid for *Bifidobacterium animalis* subsp. *animal* was obtained by cloning the 72 bp fragment sequence (positions 58-129 of SEQ ID NO. 8) corresponding to the synthetic *Bifidobacterium animalis* subsp. *animal* primers and probes into the pGM-T vector.

[0076] The negative control mentioned above is Escherichia coli genomic DNA.

[0077] Example 4: Exclusivity Verification of Single-Fluorescence PCR Detection System

[0078] To verify the exclusivity of the fluorescent PCR detection system for the two types of Bifidobacteria constructed in this invention, the genomic DNA of the standard strains shown in Table 1 was used as the PCR reaction template to verify the exclusivity of the fluorescent PCR detection system.

[0079] Table 1. Information on standard strains used for exclusion verification.

[0080]

[0081] The primers and probes for *Bifidobacterium animalis* subsp. *lactamella* and *Bifidobacterium animalis* subsp. *animal* from the kit in Example 3 were used to detect the 33 strains listed in Table 1. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2. The results of the exclusion verification for each strain are as follows: Figure 1 and Figure 2 As shown, where, Figure 1 It is Bifidobacterium animalis subsp. lactis. Figure 2 The strain is *Bifidobacterium animalis* subspecies. It is evident that only the target strain exhibits an amplification curve; non-target strains, the negative control, and the blank control (water) show no amplification curve or have a Ct value ≥30. This result indicates that the fluorescent PCR detection system of this invention has excellent exclusivity.

[0082] Example 5: Inclusivity Validation of Single-Fluorescence PCR Detection System

[0083] To verify the inclusiveness of the two fluorescent PCR detection systems for Bifidobacteria constructed in this invention, the genomic DNA of the standard strains and industrial production strains shown in Table 2 were used as PCR reaction templates to verify the inclusiveness of the fluorescent PCR detection systems.

[0084] Table 2. Information on standard strains used for inclusion validation.

[0085]

[0086] The strains listed in Table 2 were detected using primers and probes from the kit in Example 3 for *Bifidobacterium animalis* subsp. *lactamella* and *Bifidobacterium animalis* subsp. *animal*, respectively. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2. The inclusion verification results for each strain are as follows: Figure 3 and Figure 4 As shown, where, Figure 3 It is Bifidobacterium animalis subsp. lactis. Figure 4 The target strain is *Bifidobacterium animalis*. All strains of the corresponding target species showed amplification curves, while non-target species, negative controls, and blank controls (water) showed no amplification curves or Ct values ​​≥30. This result indicates that the fluorescent PCR detection system of this invention has excellent compatibility.

[0087] Example 6 Sensitivity Detection of Single-Fluorescence PCR Detection System

[0088] Genomic DNA from *Bifidobacterium animalis* subsp. *lactamella* and *Bifidobacterium animalis* subsp. *animal* was collected, and its concentration was determined using Nanodrop. The DNA was then serially diluted 10-fold, and 1.0 × 10⁻⁶ DNA samples were collected. 0 -1.0×10 -7 DNA at a concentration of ng / μL was used as a PCR template, and the assay was performed using the kit in Example 3 and the method in Example 2.

[0089] The results are as follows Figure 5 and Figure 6 As shown in Tables 3 and 4, the minimum detection concentration of this kit for Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis is 0.01 ng / μL.

[0090] Table 3. Ct values ​​of primer-probe combinations for Bifidobacterium animalis subsp. lactis

[0091]

[0092] Table 4. Ct values ​​of primer-probe combinations for Bifidobacterium animalis subspecies

[0093]

[0094] Example 7: Detection of amplification efficiency in a single-color fluorescent PCR detection system

[0095] Genomic DNA from *Bifidobacterium animalis* subsp. *lactamella* and *Bifidobacterium animalis* subsp. *animal* was collected and serially diluted 10-fold. The PCR reaction system and conditions were the same as in Example 2, with each gradient repeated three times. The detection results are shown below. Figure 7 and Figure 9 The standard curve constructed based on the average Ct value is as follows: Figure 8 and Figure 10 As shown, the slopes of the standard curves for the two sets of primers and probes are -3.364 and -3.461 for *Bifidobacterium animalis* subsp. *lactum*, respectively, corresponding to amplification efficiencies of 98.3% and 94.5%. The correlation coefficient R0 is also shown. 2 All values ​​were greater than 0.99. This indicates that, combined with the standard curve of the standard, the kit and method of the present invention can achieve the quantitative detection of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis.

[0096] Example 8: Detection of real samples

[0097] Five probiotic solid beverage products purchased from Taobao and JD.com were used as test subjects. Primers and probes of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis from the kit in Example 3 were used for detection. The DNA extraction process, PCR reaction system and reaction conditions were the same as in Example 2.

[0098] Given that the products tested all contained Bifidobacterium animalis subsp. lactis, two samples were selected from the five samples to artificially prepare samples containing Bifidobacterium animalis subsp. animalis by adding 2 μL of genomic DNA of the standard strain of Bifidobacterium animalis to 8 μL of sample DNA.

[0099] The results are shown in Table 5. The detection rate of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis in real samples by this kit can reach 100%.

[0100] Table 5. Test results of real samples

[0101]

[0102] Example 9: Establishment of a Dual-Fluorescence PCR Detection Kit

[0103] This fluorescent PCR detection kit for rapid identification of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis includes: 2×PCR Mix, upstream and downstream primers and probes for Bifidobacterium animalis subsp. lactis (concentration 100 pmol / μL), upstream and downstream primers and probes for Bifidobacterium animalis subsp. animalis (concentration 100 pmol / μL), positive control, negative control, instructions, and the kit itself.

[0104] The probe for *Bifidobacterium animalis* subsp. *lactam* has a FAM fluorescent group at its 5' end; the probe for *Bifidobacterium animalis* subsp. *animal* has a VIC fluorescent group at its 5' end. Positive and negative controls are the same as in Example 3.

[0105] Example 10 Construction of a dual PCR fluorescent PCR reaction system

[0106] Extract DNA from the sample to be tested (using a bacterial genomic DNA extraction kit or other recognized extraction methods with equivalent efficacy) and store at -20°C for later use.

[0107] The total volume of the fluorescent PCR reaction system was 20 μL: 10 μL of 2×PCR Mix, 1 μL each of forward and reverse primers (10 pmol / μL), 0.5 μL each of probe (10 pmol / μL), 1 μL of sample DNA template, and ddH2O to make up the volume.

[0108] The fluorescent PCR reaction conditions were: 95℃ for 10 min hot start; 95℃ for 10 s denaturation; 60℃ for 30 s annealing / extension, for a total of 35 cycles.

[0109] Result interpretation: If the sample to be tested has an amplification curve in the FAM detection channel and the Ct value is ≤25, then it is determined that Bifidobacterium animalis subsp. lactis is detected in the sample to be tested; if the sample to be tested has an amplification curve in the VIC detection channel and the Ct value is ≤25, then it is determined that Bifidobacterium animalis subsp. animalis is detected in the sample to be tested; if the sample to be tested has an amplification curve in the corresponding fluorescence detection channel when detected by a primer probe of a certain Bifidobacterium, but 25 < Ct value < 30, then it is determined to be an uncertain sample and the sample needs to be retested.

[0110] Example 11 Sensitivity Validation of Dual-Fluorescence PCR Detection System

[0111] Genomic DNA from *Bifidobacterium animalis* subsp. *lactamella* and subsp. *animal* was analyzed for concentration using Nanodrop. The DNA concentration was then adjusted to 2 ng / μL with water, and the samples were mixed in equal proportions to prepare a mixed sample with a template concentration of 1 ng / μL for both *Bifidobacterium animalis* subsp. *lactamella* and subsp. *animal*. The mixed sample was then serially diluted 10-fold, and 1.0 × 10⁻⁶ samples were collected. 0 -1.0×10 -4 DNA at a concentration of ng / μL was used as a PCR template, and the assay was performed using the kit of Example 9 and the method of Example 10.

[0112] The results are shown in Table 6. Figure 11 , Figure 12 As shown, the minimum detectable concentration of this kit for Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis is 0.01 ng / μL.

[0113] Table 6. Ct values ​​of the dual PCR detection system

[0114]

[0115] Example 12 Validation of amplification efficiency in a dual-fluorescence PCR detection system

[0116] Genomic DNA from *Bifidobacterium animalis* subsp. *lactamella* and *Bifidobacterium animalis* subsp. *animal* was mixed in equal proportions to prepare a mixed sample, which was then serially diluted 10-fold. The PCR reaction system and conditions were the same as in Example 10, with each gradient repeated in triplicate. The detection results are shown below. Figure 13 and Figure 15 The standard curve constructed based on the average Ct value is as follows: Figure 14 and Figure 16 As shown, the slopes of the standard curves for the two sets of primers and probes are -3.496 and -3.445 for *Bifidobacterium animalis* subsp. *lactum*, respectively, corresponding to amplification efficiencies of 93.2% and 95.1%. The correlation coefficient R0 is also shown. 2 All values ​​were greater than 0.99. This indicates that the kit and method of the present invention can achieve the quantitative detection of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis.

[0117] Example 13 Detection of real samples

[0118] Five probiotic solid beverage products purchased from Taobao and JD.com were used as test subjects. The primers and probes of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis from the kit in Example 9 were used for detection. The DNA extraction process, PCR reaction system and reaction conditions were the same as in Example 10.

[0119] Given that the products tested all contained Bifidobacterium animalis subsp. lactis, two samples were selected from the five samples to artificially prepare samples containing Bifidobacterium animalis subsp. animalis by adding 2 μL of genomic DNA of the standard strain of Bifidobacterium animalis to 8 μL of sample DNA.

[0120] The results are shown in Table 7. The detection rate of Bifidobacterium animalis subsp. lactis and Bifidobacterium animalis subsp. animalis in real samples by this kit can reach 100%.

[0121] Table 7. Test results of real samples

[0122]

[0123] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer probe combination for detecting Bifidobacterium animalis ssp. in an animal, characterized by, The primer probe combination comprises a primer probe combination for detecting Bifidobacterium animalis lactis and a primer probe combination for detecting Bifidobacterium animalis animalis; The primer probe combination for detecting Bifidobacterium animalis lactis comprises an upstream primer shown as SEQ ID NO. 1, a downstream primer shown as SEQ ID NO. 2, and a probe shown as SEQ ID NO. 3; The primer probe combination for detecting Bifidobacterium animalis animalis comprises an upstream primer shown as SEQ ID NO. 5, a downstream primer shown as SEQ ID NO. 6, and a probe shown as SEQ ID NO.

7.

2. Use of the primer probe combination according to claim 1 for the manufacture of a singleplex test kit for animal Bifidobacterium subsp., characterized in that, The Bifidobacterium animalis subspecies comprises Bifidobacterium animalis lactis and Bifidobacterium animalis animalis.

3. A singleplex test kit for animal Bifidobacterium subspecies, characterized by, The single detection kit comprises the primer probe combination of claim 1.

4. A method for the single detection of Bifidobacterium animalis subsp. lactis for non-diagnostic purposes, characterized in that, The method comprises the following steps: Extracting genomic DNA of the sample to be detected, using the genomic DNA as a template, and performing fluorescent PCR detection by using the single detection kit of claim 3; If the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis lactis, there is an amplification curve, and the Ct value is less than or equal to 25, it is determined that Bifidobacterium animalis lactis exists in the sample to be detected; if the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis lactis, there is no amplification curve, or the Ct value is greater than or equal to 30, it is determined that Bifidobacterium animalis lactis does not exist in the sample to be detected; If the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis animalis, there is an amplification curve, and the Ct value is less than or equal to 25, it is determined that Bifidobacterium animalis animalis exists in the sample to be detected; if the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis animalis, there is no amplification curve, or the Ct value is greater than or equal to 30, it is determined that Bifidobacterium animalis animalis does not exist in the sample to be detected; If the sample to be detected has an amplification curve, but the Ct value is between 25 and 30, it is determined that the sample is uncertain and needs to be retested.

5. The singleplex assay of claim 4, wherein, The reaction system of the fluorescent PCR detection is as follows: 2x PCR Mix 10 μL, 1 μL of each of the upstream and downstream primers, 0.5 μL of the probe, 1 μL of the DNA template, and ddH2O to make up to 20 μL; The reaction conditions of the fluorescent PCR detection are as follows: 95℃ for 10 min for hot start; 95℃ for 10 s for denaturation; 60℃ for 30 s for annealing and extension, for a total of 35 cycles.

6. Use of the primer probe combination according to claim 1 for the preparation of a duplex test kit for animal Bifidobacterium subsp., characterized in that, The Bifidobacterium animalis subspecies comprises Bifidobacterium animalis lactis and Bifidobacterium animalis animalis. The probe for detecting Bifidobacterium animalis lactis is added with a FAM fluorescent group; and the probe for detecting Bifidobacterium animalis animalis is added with a VIC fluorescent group.

7. A duplex test kit for Bifidobacterium animalis ssp, which comprises, The double detection kit comprises the primer probe combination of claim 1; the probe for detecting Bifidobacterium animalis lactis is added with a FAM fluorescent group; and the probe for detecting Bifidobacterium animalis animalis is added with a VIC fluorescent group.

8. A method for the dual detection of Bifidobacterium animalis subsp. lactis for non-diagnostic purposes, characterized in that, The method comprises the following steps: Extracting genomic DNA of the sample to be detected, using the genomic DNA as a template, and performing fluorescent PCR detection by using the double detection kit of claim 7; If the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis lactis, there is an amplification curve, and the Ct value is less than or equal to 25, it is determined that Bifidobacterium animalis lactis exists in the sample to be detected; if the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis lactis, there is no amplification curve, or the Ct value is greater than or equal to 30, it is determined that Bifidobacterium animalis lactis does not exist in the sample to be detected; If the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis animalis, there is an amplification curve, and the Ct value is less than or equal to 25, it is determined that Bifidobacterium animalis animalis exists in the sample to be detected; if the sample to be detected is detected by using the primer probe combination for detecting Bifidobacterium animalis animalis, there is no amplification curve, or the Ct value is greater than or equal to 30, it is determined that Bifidobacterium animalis animalis does not exist in the sample to be detected; If the sample to be detected has an amplification curve, but the Ct value is between 25 and 30, it is determined that the sample is uncertain and needs to be retested. If the sample to be tested has an amplification curve in the FAM detection channel, and the Ct value is ≤25, it is determined that there is Bifidobacterium animalis lactis in the sample to be tested; if the sample to be tested has an amplification curve in the VIC detection channel, and the Ct value is ≤25, it is determined that there is Bifidobacterium animalis animalis in the sample to be tested; if the sample to be tested has an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value < 30, it is determined as an uncertain sample, and the sample needs to be retested.

9. The dual detection method of claim 8, wherein, The reaction system of the fluorescent PCR detection is: 2x PCR Mix 10 μL, 1 μL of each of the upstream and downstream primers, 0.5 μL of each of the probes, 1 μL of the DNA template, and ddH2O is supplemented to 20 μL; The reaction conditions of the fluorescent PCR detection are: 95℃ 10min hot start; 95℃ denaturation 10s; 60℃ annealing / extension 30s, a total of 35 cycles.

10. Use of the single assay kit according to claim 3 or the dual assay kit according to claim 7 for the authentication of products containing animal bifidobacterium subspecies, characterized in that, The Bifidobacterium animalis subspecies includes Bifidobacterium animalis lactis and Bifidobacterium animalis animalis.

Images