Primer probe group, kit and method for field early-stage rapid detection of southern corn rust disease

Abstract

The invention discloses a primer probe group, a kit and a method for field early-stage rapid detection of southern corn rust. Aiming at early detection of pathogenic bacteria puccinia polypoda of southern corn rust, primer design and screening, reaction system and condition optimization and specificity and sensitivity analysis are carried out, and a field detection method is established. The primer probe set developed by the invention and the established rapid detection method for the southern corn rust disease have the advantages of strong specificity, high sensitivity, simplicity in operation and the like, and can provide effective technical support for early diagnosis and early warning of diseases.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant disease detection, and particularly relates to a primer probe set, a kit and a method for early and rapid detection of corn southern rust in a field. BACKGROUND

[0002] At present, the research on corn southern rust at home and abroad mainly focuses on the occurrence regularity of the disease, the identification of the pathogenic fungus, the biological characteristics and the genetic disease resistance. The molecular detection technology for the corn southern rust pathogenic fungus Puccinia polysora still mainly uses traditional methods, mainly including conventional PCR, TaqMan qPCR and the like. Although these traditional methods have certain guarantee in detection accuracy, they have the following shortcomings in actual application:

[0003] 1. unable to realize field full-process operation: in the prior art, although isothermal amplification means is introduced to improve the detection speed, product reading still relies on agarose gel electrophoresis apparatus and imaging equipment. Such equipment is bulky, expensive and complex to operate, and needs to be used in a laboratory environment, and does not have the feasibility of independently completing detection in a field environment; in most basic and even provincial plant protection stations or farmer environments in China, such experimental equipment and professional operators are lacking, and the actual demand for "on-site instant interpretation" cannot be met;

[0004] 2. risk of non-specific amplification: most of the primers used at present are designed in the ITS region, which is a universal barcode for fungi and has high conservation among related fungi, and is easy to cause non-specific amplification. Especially under the background of complex infection of multiple pathogenic fungi in field samples, false detection is easy to occur;

[0005] 3. insufficient early diagnosis capability: traditional methods are difficult to realize rapid and accurate early diagnosis of the disease, and often lead to missed best prevention opportunities;

[0006] 4. lack of portability: the detection process is complex and tedious, and is not suitable for use in non-laboratory environments such as fields;

[0007] 5. high cost and time-consuming: the equipment demand is high, the detection cost is expensive and time-consuming, which limits its application in large-scale disease detection.

[0008] Based on the above problems, it is urgent to develop an efficient, portable and cost-controllable rapid detection technology for corn southern rust to meet the needs of early diagnosis and field real-time monitoring of the disease, and to provide technical support for precise prevention and control. SUMMARY

[0009] In view of the above deficiencies of the prior art, the purpose of the present application is to provide a primer probe set, a kit and a method for early and rapid detection of corn southern rust in the field. The present application successfully develops a set of portable early and rapid detection kit and method for corn southern rust, and for the first time realizes real-time detection in the field. Through bioinformatics analysis, the present application screens the specific region of O-mannosyltransferase gene of corn southern rust, designs and synthesizes amplification primers according to the region, and establishes a corn southern rust detection system based on multi-enzyme constant temperature nucleic acid rapid amplification technology.

[0010] The first purpose of the present application is to provide a corn southern rust detection primer probe set, which comprises an upstream primer F12, a downstream primer R11 and a probe, the nucleotide sequence of the upstream primer F12 is shown as SEQ ID NO. 3, the nucleotide sequence of the downstream primer R11 is shown as SEQ ID NO. 6, and the nucleotide sequence of the probe is shown as SEQ ID NO. 10, wherein the base T at the 31st position is modified with a FAM fluorescent group, a tetrahydrofuran THF is introduced as a debasing site between the base G at the 32nd position and the base T at the 33rd position, the base T at the 33rd position is modified with a BHQ1 quenching group, and the 3' end is blocked with a C3 Spacer.

[0011] Compared with the existing primer based on the ITS region, the present application designs an amplification detection system based on the specific structure of a functional gene for the first time, takes the species-specific region of O-mannosyltransferase gene in Puccinia polysora, the pathogenic bacterium of corn southern rust, as a target, designs specific primers, and establishes a field rapid detection system with high specificity and functional correlation. The present application breaks through the specific segment in the functional correlation gene, and significantly improves the accuracy and stability of detection.

[0012] The second purpose of the present application is to provide a corn southern rust detection kit, which comprises the primer probe set and DNA constant temperature rapid amplification reagent.

[0013] The third purpose of the present application is to provide a corn southern rust early and rapid detection kit in the field, which comprises the corn southern rust detection kit and DNA type lysis solution. The kit is truly suitable for the first line in the field and is easy to operate.

[0014] Preferably, the corn southern rust detection kit contains all components of the DNA constant temperature rapid amplification kit: Abuffer, B buffer, freeze-dried powder reagent, and positive control template and positive control primer probe MIX used as a control, and the primer probe set; the DNA constant temperature rapid amplification kit is a fluorescent DNA constant temperature rapid amplification kit, which is purchased from Amp Future Biotechnology Co., Ltd., and the item number is WLE8202KIT.

[0015] Preferably, all components of the corn southern rust detection kit are prepared in an amount of 50 μL amplification reaction system for one detection, as a detection reagent tube in which a dry powder reagent and a buffer microsphere are loaded in a PCR tube; the upstream primer F12 is 20 pmol, the downstream primer R11 is 20 pmol, and the probe is 6 pmol in the detection reagent tube; the corn southern rust detection kit contains a plurality of detection reagent tubes.

[0016] Preferably, the DNA-type lysis solution is DNA-type rapid nucleic acid release agent-II, which is purchased from Amp Future Biotechnology Co., Ltd., and the item number is WLD8201-ES.

[0017] A fourth object of the present application is to provide a corn southern rust field early rapid detection method, comprising the following steps:

[0018] S1. Take 2-3 pieces of small leaf pieces with a size of 1 cm*1 cm from about 15-20 cm from the leaf tip of the lower leaf of the corn plant to be detected in tube 1, grind the sample with a grinding rod for 1 min, mix well, and place at room temperature for 10 min for lysis to obtain a lysis product; the tube 1 is a 1.5 mL centrifuge tube containing 500 μL of DNA-type lysis solution;

[0019] S2. Use a 50 μL micropipette to take 50 μL of the lysis product and add it to tube 2 for mixing and dilution; use a 50 μL micropipette to take 50 μL of the diluted lysis product and add it to the detection reagent tube, mix well, and then spin the liquid to the bottom of the tube to obtain a reaction tube; the tube 2 is a 1.5 mL centrifuge tube containing 450 μL of sterile water;

[0020] S3. Place the reaction tube in a digital constant temperature detector, set the temperature constant to 40℃, start running, and amplify for 4 min, at which time the reaction tube is taken out, mixed, the liquid is spun to the bottom of the tube, and the reaction tube is placed back in the digital constant temperature detector for continued amplification for 16 min, the program ends, and the instrument displays the corresponding numerical value of the well position;

[0021] S4. Interpret the numerical value displayed by the instrument: if the numerical value displayed by the instrument is between 00-03, the result is negative, indicating that the detected sample does not contain the nucleic acid of the corn southern rust pathogen P. polyspora; if the numerical value displayed by the instrument is between 04-99, the result is positive, indicating that the detected sample contains the nucleic acid of the corn southern rust pathogen P. polyspora.

[0022] Preferably, the digital constant temperature detector is purchased from Amp Future Biotechnology Co., Ltd., and the item number is WL-PS-8C.

[0023] A fifth object of the present application is to provide the use of the corn southern rust detection primer probe set, the corn southern rust detection kit and the corn southern rust field early rapid detection kit in the detection and prevention and control of corn southern rust.

[0024] The present application has the following advantages:

[0025] (1) The present application can achieve efficient field rapid detection of corn southern rust, providing scientific basis for molecular identification and early warning of the disease, and assisting precision prevention and control.

[0026] (2) The present application constructs a pathogen detection technology system which is simple to operate, high in sensitivity, low in cost and easy to popularize, providing technical support for the monitoring, prediction and prevention and control of corn southern rust, and has high application value.

[0027] (3) The present application first realizes nucleic acid detection at the field head, and the result can be observed in 20-30 min, so that the monitoring of corn southern rust is earlier and more sensitive. The kit of the present application can detect corn southern rust infection of corn leaves 7 days before the appearance of symptoms in field tests. At present, there is no early field rapid detection product for corn southern rust at home and abroad. The successful development of the kit can help to carry out more precise prevention and control of corn southern rust in production.

[0028] (4) The method of the present application is simple to operate, does not require expensive professional instruments and equipment, is easier to operate than professional experimental instruments, is not limited by the detection scene, can be directly tested in the field, has strong practicality, and is easier to popularize and detect at the grassroots level. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is the sequence alignment result of O-mannosylation and its core enzyme PMT mannose transferase encoding gene; wherein, A is a schematic diagram of the O-mannosylation modification process of protein in yeast; B and C are respectively the sequence alignment results of PMT1 and PMT2 mannose transferase encoding genes (FUNA_006985 and FUNB_002470) of P. polyspora and homologous genes in common other pathogenic fungi of corn.

[0030] Figure 2 is the sequence conservation analysis result of the target gene PMT1; wherein, A shows the verification of the sequence conservation of PMT1 gene in more than one hundred P. polyspora strains; B shows that no site variation is found in the PMT1 target region in all detected strains, indicating that the region has high conservation.

[0031] Figure 3 It is shown that the target fragments verified by more than one hundred P. polyspora are covered by short read sequences and have no structural variation.

[0032] Figure 4A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0033] Figure 5 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0034] Figure 6 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0035] Figure 7 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0036] Figure 8 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0037] Figure 9 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0038] Figure 10 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli.

[0039] Figure 11 A is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia multiformis; B is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia recondita; C is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia sorghi; D is the specificity verification of the screened primer pair F11-R11, F12-R11, F13-R11 and F14-R11 for amplifying Puccinia zanthoxyli. DETAILED DESCRIPTION

[0040] The following examples are further illustrations of the present application and are not intended to limit the present application in any way.

[0041] Example 1

[0042] I. Screening and determining specificity of target gene

[0043] O-mannosylation is an important post-translational modification of proteins widely found in fungi, and the PMT family, as its core enzymes, is not only structurally conserved but also closely related to the pathogenicity of pathogens. Figure 1 (A in the original text). Our previous studies have shown that the 5' ends of the PMT1 (FUNA_006985) and PMT2 (FUNB_002470) genes in the P. polysora genome contain approximately 600 bp more unique sequence regions than their homologs in other maize pathogenic fungi. Figure 1 The regions B and C in the gene exhibit strong species specificity. By comparing the genomes of multiple related pathogenic fungi and performing a series of primer screenings, we finally identified a specific region of the PMT1 gene as the detection target. Experiments showed that this site, while possessing high specificity, is also stably expressed in crude field samples and is easily amplified, making it suitable for developing rapid field diagnostic technologies, especially showing significant advantages in the detection of pathogens in the latent stage.

[0044] Based on bioinformatics analysis, a highly conserved gene sequence (a specific target fragment on the PMT1 gene, whose nucleotide sequence is shown in SEQ ID NO.1) was screened from over one hundred *P. multifiliis* rust strains collected nationwide. Simultaneously, it was ensured that this sequence is highly specific for other major maize diseases (such as common rust and small leaf spot), meaning it is not present in the pathogens of other diseases. Combining the requirements of conservation and specificity, primers for rapid detection were further optimized and designed.

[0045] (1) Conservatism

[0046] To verify that the target fragment on the PMT1 gene used for rapid detection is highly conserved among various strains of *Rust hygroscopicus*, we first compared the target fragment. Figure 2 In section A), the area within the red box represents the target fragment. The first exon is conserved, and the results show that this sequence has no SNPs or Indel variations. Figure 2 In the example B), the two indels marked with a short blue line have very low MAF values ​​(0.02), indicating that this gene may not have any variation within the population. Furthermore, genome alignment and depth of coverage analysis were performed on all strains collected from across the country. Figure 3 More than 100 strains of *Russula multipendicularis* were presented; the results showed that the target fragment of all strains was covered by short read sequences, indicating no structural variation; this further confirmed the conservation of the target fragment sequence.

[0047] (2) High specificity

[0048] The target fragment on PMT1 gene for rapid detection also has high specificity in corn disease pathogen. By comparing 12 different diseases, the results (Table 1) show that the pathogen genome of other main corn diseases does not contain this sequence except corn southern rust, so the target fragment sequence has high specificity.

[0049] Table 1 Specificity comparison results of target fragment sequence on PMT1 gene

[0050]

[0051]

[0052] II. Design and optimization of primers

[0053] (1) Primer screening

[0054] According to the target fragment sequence of the specific gene PMT1 gene, 16 pairs of primers were designed and synthesized, and the DNA of corn southern rust pathogen Puccinia multiformis was used as a template for qPCR detection verification, and relatively optimal primers were preliminarily screened; Specifically, different upstream primers F11, F12, F13, F14 were combined with downstream primers R11, R12, R13, R14 respectively for qPCR verification. Among them, the primer sequences are as follows:

[0055] F11: GACTTCAAACTCGTATCAAGATTCGCTCGATG (SEQ ID NO. 2);

[0056] F12: CAAGATTCGCTCGATGATCATCTCAATCGATC (SEQ ID NO. 3);

[0057] F13: CTCAATCGATCTCAACTAGACCCCATTCGATC (SEQ ID NO. 4);

[0058] F14: GTAGACCAAGGGGATCGACCACTAGGACCATC (SEQ ID NO. 5);

[0059] R11: GATTGGATGGATCGATGATGGAGAGTGAACTG (SEQ ID NO. 6);

[0060] R12: GTGGTGGTGATGAGTTGAGGATTGGATGGATCG (SEQ ID NO. 7);

[0061] R13: GATGAGTTGATGGATCGAGAGAGCTGAGTG (SEQ ID NO. 8);

[0062] R14: CTGTTGAGGTAAGAAGTGGCGGATGAGTTGATG (SEQ ID NO. 9);

[0063] Probe: GGTGATGATTGAAGTGAGTTGGAAGGGTGATGTGATCATTTGAATCTG (SEQ ID NO. 10), wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran (THF) is introduced between the 32nd base G and the 33rd base T as a debasification site (the enzyme cutting recognition site of endonuclease IV), the 33rd base T is modified with a BHQ1 quenching group, and the 3' end is blocked with a C3 spacer. That is, the probe sequence can also be represented as GGTGATGATTGAAGTGAGTTGGAAGGGTGA[FAM-dT]G[THF][BHQ1-dT]GATCATTTGAATCTG-[3' C3 spacer].

[0064] The first group of detection (A) in Table 1 is to use the upstream primer F11 to amplify with four different downstream primers R11, R12, R13 and R14 respectively, and the detection results show that the primer pair F11-R11 has the earliest peak and the highest peak value. The second group of detection (B) in Table 1 is to use the upstream primer F12 to amplify with four different downstream primers R11, R12, R13 and R14 respectively, and the detection results show that the primer pair F12-R11 has the earliest peak and the highest peak value. The third group of detection (C) in Table 1 is to use the upstream primer F13 to amplify with four different downstream primers R11, R12, R13 and R14 respectively, and the detection results show that the primer pair F13-R11 has the earliest peak and the highest peak value. The last group of detection (D) in Table 1 is to use the upstream primer F14 to amplify with four different downstream primers R11, R12, R13 and R14 respectively, and the detection results show that the primer pair F14-R11 has the earliest peak and the highest peak value. According to the qPCR results, the CT values of the primer pairs F11-R11, F12-R11, F13-R11 and F14-R11 are compared. The results show that the primer pairs F11-R11 and F12-R11 have the earliest peak and the lowest CT value (A and B in Table 1) compared with other primer combinations, so the primer pairs F11-R11 and F12-R11 are relatively better and are used as candidate primers for subsequent tests. Figure 4 Figure 4 Figure 4 Figure 4 Figure 4

[0065] ​​​​​The foregoing qPCR detection, the specific detection reaction system is: A buffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, DNA template 5μL, ddH2O 8.5μL, B buffer 2.5μL, total volume 50μL. Before the detection reaction, the kit (DNA constant temperature rapid amplification kit (fluorescence type), purchased from Amp Future Biotechnology Co., Ltd., website: https: / / www.tech-up.cn / 1089.html, article number: WLE8202KIT, the kit consists of: A buffer, B buffer, freeze-dried powder reagent and positive control template and positive control primer probe MIX used as a control) liquid components are taken out, melted at room temperature, shaken and mixed, and the above-mentioned reagents are added to the dry powder tube in the kit in turn. Finally, the B buffer in the kit is added to the inside of the cover of the reaction tube, and after being covered, it is inverted 8-10 times for mixing. After mixing, the reaction liquid is spun (or quickly centrifuged) to the bottom of the tube, and then the reaction tube is immediately placed in a PCR instrument. The detection reaction condition program is set as: constant temperature 39℃; collect fluorescence signal every 30s; reaction time 20min; the PCR instrument selects “none” at passivereference and quencher.

[0066] (2) Verification of primer specificity

[0067] The two pairs of better primers F11-R11 and F12-R11 selected from the primer preliminary screening are continued to be verified for specificity, and the DNA of the corn common rust, small spot, stem rot / ear rot pathogen and the corn southern rust pathogen Puccinia polysora is used as a template for qPCR amplification. The qPCR results Figure 5 ) show that the two pairs of primers only have peak values when the template is Puccinia polysora DNA, and no peak values are present for other pathogen DNAs, indicating that the two pairs of primers selected have specificity for Puccinia polysora compared with the corn common rust, small spot, stem rot / ear rot pathogen. The qPCR reaction system is: A buffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, DNA template 5μL, ddH2O 8.5μL, B buffer 2.5μL, total volume 50μL; wherein the DNA template is the corresponding specific verification pathogen DNA.

[0068] (3) Verification of primer sensitivity

[0069] First, a synthetic plasmid containing the PMT1 gene target fragment is constructed using a vector, and the specific steps are as follows:

[0070] Using DNA from *Pseudomonas aeruginosa*, the pathogen of southern maize rust, as a template, PCR amplification was performed using upstream primer F: GACCTCGAGGGGGGGCCCAGACCAAGGGGATCGACCAC (SEQ ID NO.11) and downstream primer R: CTCCTCGCCCTTGCTCACCATTGGATTCGAGACCACCACCGA (SEQ ID NO.12). The amplified product was obtained. After gel electrophoresis, the amplified fragment was recovered and its concentration was measured. The sequence of this amplified fragment is shown in SEQ ID NO.13. This fragment was inserted into the linearized pYBA1143(C-HA) vector for recombination, yielding a recombinant product. This recombinant product was transformed into competent *E. coli* cells, subjected to resistance selection and culture, and then plasmid was extracted and its concentration was measured to obtain a synthetic plasmid containing the PMT1 gene target fragment for later use.

[0071] Using the synthetic plasmid containing the PMT1 gene target fragment prepared above as a template, six concentration gradients of the plasmid were prepared (100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL). Different concentrations of plasmid were used as templates, with three replicates for each concentration, and qPCR amplification was performed using different primers. First, qPCR amplification of the above six different concentrations of *Rust hygroscopicus* plasmids was performed using primer pair F11-R11; the test results (…) Figure 6 A) indicates that the lowest detection sensitivity of F11-R11 is 1 fg / μL. Next, qPCR amplification was performed on the above six different concentrations of *Rust hygroscopicus* plasmids using primer pair F12-R11; the results ( Figure 6 B) indicates that the lowest detection sensitivity of F12-R11 is 10 fg / μL. This shows that both primer pairs selected for the initial screening have high sensitivity to *Russula multifiliis*. Although F11-R11 can detect lower concentrations, its high sensitivity may lead to relatively poor repeatability and peak performance in CT values. F12-R11 has slightly lower sensitivity than F11-R11, but F12-R11 has better repeatability and more stable peak performance in CT values. Therefore, considering all factors, F12-R11 is superior to F11-R11. The qPCR reaction system consisted of: 29.4 μL of buffer A, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 0.6 μL of probe (10 μM), 5 μL of plasmid template, 8.5 μL of ddH2O, and 2.5 μL of buffer B, for a total volume of 50 μL. Two different primer pairs were used for qPCR amplification, and the gradient CT values ​​and peak changes were compared.

[0072] III. Validation of the testing system

[0073] 1. Validation of the indoor testing system

[0074] 1.1 Sample sensitivity verification

[0075] DNA from maize leaf samples inoculated with *Symplocos rubrum* for 1-10 days was used directly as a template, with each sample tested in triplicate. The sensitivity of primer pairs F11-R11 and F12-R11 was validated. First, detection was performed using primer pair F11-R11. Figure 7 The results (A) showed that qPCR began to show peak values ​​and CT values ​​when the template was maize leaf sample DNA inoculated with *Russula multiflora* on the third day, indicating that this primer pair could detect *Russula multiflora* on the third day after infection of maize leaves. Then, primer F12-R11 was used for detection. Figure 7 (B) The results showed that qPCR began to show peak values ​​and CT values ​​when the template was maize leaf samples inoculated with *Russula multifiliis* on the second day. This indicates that primer pair F12-R11 can detect *Russula multifiliis* on the second day after infection of maize leaves. Sample sensitivity verification results showed that F12-R11 had a lower CT value, better repeatability, and could detect *Russula multifiliis* earlier. Therefore, based on the primer sensitivity test results, F12-R11 was determined as the optimal primer pair and used as the primer pair for kit development.

[0076] The DNA preparation method for corn leaf samples is as follows: Select 10 Zhengdan 958 corn seedlings at the 2-3 leaf stage per pot, wash the seedlings (gently stroke the leaves 2-3 times with your fingers) and set aside. Collect fresh urediniospores of *Styrax styracifolium*, prepare a spore suspension with an aqueous solution containing Tween-80, and then prepare the spore suspension (concentration 2×10⁻⁶). 5 The spores (per mL) were evenly sprayed onto corn leaves. The inoculated corn seedlings were then placed in an incubator (conditions: temperature 26℃, relative humidity 70%), covered with a black bag, and cultured in the dark for 24 hours. After 24 hours, the bag was removed, and normal cultivation resumed. The first sampling was performed 24 hours after inoculation, followed by sampling every day for a total of 10 days. Samples were photographed daily and promptly stored at -80℃. DNA was extracted from the collected samples using the CTAB method and stored at -20℃ for later use.

[0077] To facilitate rapid field testing of maize leaf samples, the lysis buffer used in sample DNA extraction was screened and optimized.

[0078] 1.2 Screening of lysis buffers

[0079] 1.2.1 Test of the amount of lysis buffer added

[0080] To clarify the impact of the amount of lysis buffer added on the detection effect and obtain the best detection results, primer pair F12-R11 was used to detect the amount of three different lysis buffers added: DNA lysis buffer, TBS lysis buffer, and RNA lysis buffer.

[0081] First, the amount of DNA lysis buffer added was tested. Figure 8 In step A), two gradients of 60 and 100 μL were set, with each treatment repeated twice. qPCR results showed that DNA lysis buffer eluted earlier and produced a higher peak value when 60 μL was added. Next, the amount of TBS lysis buffer added was tested (…). Figure 8 The qPCR results showed that the peak value of TBS lysis buffer was higher when 60 μL was added (B in the formula), with three gradients: 60 μL, 100 μL, and 120 μL, and each treatment was repeated twice. The final test was conducted on the amount of RNA lysis buffer added (B in the formula). Figure 8 In step C), three gradients were set: 100, 300, and 500 μL, with each treatment repeated three times. RNA lysis buffer showed earlier and higher peak values ​​with 100 μL. The results indicated that DNA and TBS lysis buffers performed better with 60 μL, so 60 μL was added for subsequent assays. RNA lysis buffer performed better with 100 μL, therefore 100 μL was added for subsequent assays.

[0082] Specific sample preparation methods and reaction conditions: Three small pieces of corn leaves (approximately 1cm x 1cm in size) inoculated with *Symplocos rubrum* on the third day after inoculation were added to 1.5mL centrifuge tubes with the corresponding volumes of lysis buffer and ground until the leaf tissue was broken up. Lysis was then performed. The lysis conditions and times for different lysis buffers were as follows: DNA lysis buffer was reacted at room temperature for 5 min, RNA lysis buffer at 40℃ for 10 min, and TBS lysis buffer at 65℃ for 15 min. 5μL of the supernatant was used as a template for qPCR amplification. The DNA lysis buffer was a rapid nucleic acid release agent (DNA type)-II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES; the RNA lysis buffer was a rapid nucleic acid release agent (RNA type), purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLR8203. The TBS lysis buffer formulation was: 100mL Tris-HCl (pH 8.0), 20mL EDTA, 74.5g KCl, diluted to 1L with water.

[0083] 1.2.2 Selection of final pyrolysis solution

[0084] To select the most effective and convenient lysis buffer, primer pair F12-R11 was used to further test and compare the effects of three lysis buffers, thereby screening for the optimal lysis buffer. Test results ( Figure 9) shows that the peak value of DNA type lysis solution is higher than that of TBS lysis solution and RNA type lysis solution, and the CT value of DNA type lysis solution is the lowest, indicating that the DNA type lysis solution is better, so the DNA type lysis solution is finally determined as the lysis solution for rapid detection of corn southern rust.

[0085] Specific operation method and reaction condition: take the fifth day of inoculated Puccinia sorghi corn leaves (about 1cm*1cm size of 3 pieces of leaf small pieces) in 1.5mL centrifuge tube, add corresponding volume of lysis solution (among them, add 60μL of DNA type lysis solution, add 60μL of TBS lysis solution, add 100μL of RNA type lysis solution) for grinding, grind until the leaf tissue is broken, and then lysis; the lysis conditions and time of different lysis solutions are as follows: DNA type lysis solution under normal temperature for 5min, RNA type lysis solution under 40℃ for 10min, TBS lysis solution under 65℃ for 15min; take 5μL supernatant as the DNA template for amplification of qPCR, and each treatment is repeated twice.

[0086] 1.2.3 Comparison of qPCR results and digital constant temperature detector results

[0087] qPCR instrument is expensive, and the operator needs to have certain experimental operation basis, and can only be detected in the room, and the use occasion is limited; digital constant temperature instrument is simple and flexible, easy to operate, and can be directly taken to the field for detection with a small mobile power supply.

[0088] In order to verify whether the results of the two amplification methods are consistent, we use the same primer pair F12-R11 and the same leaf sample to detect, and then compare the detection results.

[0089] Template preparation method: take the second to fifth day of inoculated Puccinia sorghi corn leaves (about 1cm*1cm size of 3 pieces of leaf small pieces) in 1.5mL centrifuge tube, add 60μL DNA type lysis solution, react under normal temperature for 5min, take 5μL supernatant as template for test. First, use the extraction method of DNA type lysis solution to extract the DNA of leaf sample inoculated with Puccinia sorghi as template for amplification in qPCR instrument (A in Figure 10 The qPCR amplification result shows that when the template is the DNA of the third day of corn leaf sample inoculated with Puccinia sorghi, the peak value and CT value appear, indicating that Puccinia sorghi can be amplified at the third day.

[0090] Secondly, the DNA of the corn leaf samples inoculated with P. polyspora was extracted as a template for amplification in a digital constant temperature instrument. The digital constant temperature detector was powered on, the prepared eight-row samples were put in, the heating button (constant temperature 40°C) was pressed, and the detection value was obtained after 20 min. The digital constant temperature detector was purchased from: Amp Future Biotechnology Co., Ltd., item number: WL-PS-8C. Results Figure 10 B) in the table is: S1: the template is inoculated for 1d, and the detection value is 0; S2: the template is inoculated for 2d, and the detection value is 0; S3: the template is inoculated for 3d, and the detection value is 6; S4: the template is inoculated for 4d, and the detection value is 12; S5: the template is inoculated for 5d, and the detection value is 13; S6: the template is the DNA of the field disease sample, and the detection value is 33; S7: the template is P. polyspora inoculated for 10 days, and the detection value is 36; S8: the template is the negative control without inoculation, and the detection value is 0.

[0091] The digital constant temperature instrument amplification result shows that P. polyspora, the pathogen of corn southern rust, can be amplified at the third day of inoculation. The comparison of the detection results shows that the qPCR result is consistent with the digital constant temperature instrument detection result, which indicates that the digital constant temperature instrument can be used for field detection.

[0092] 2. Verification of field detection system

[0093] Due to the large difference between laboratory conditions and field conditions, further field detection verification is carried out on the basis of indoor detection.

[0094] The previous detection of leaves is the laboratory inoculation of leaves, the fungus source is clean without other bacterial pollution, and the corn seedlings are small and the leaves are more tender. The field detection conditions are complex, there are other interference factors on the leaves, and the detection is for corn leaves at the heading stage, and the leaves grow more maturely, so the detection time will be slightly later than the laboratory detection. However, P. polyspora invades the leaves for 6-7 days of incubation period, and during the incubation period, there is no any disease symptom on the leaves, which is difficult to be found by naked eye. It is proved by field detection that the method optimized in this embodiment can detect the pathogen before the leaves are diseased during the incubation period of the pathogen, which can guide the field primary disease prevention and control.

[0095] 2.1 Determine the sampling position

[0096] Thirty corn leaf samples were taken from the field, the distance from the leaf tip to the diseased part was measured and averaged to determine the sampling position as a 1cm*1cm corn leaf piece 15-20cm away from the leaf tip.

[0097] 2.2 Test the grinding time and lysis time detection process

[0098] The digital constant temperature instrument is used to detect the field sample, and 2-3 pieces of corn leaves (about 15-20 cm from the leaf tip, 1 cm*1 cm corn leaf small pieces) are taken in a 1.5 mL centrifuge tube containing 500 μL DNA type lysis solution (field corn leaves are usually more mature, so the volume of lysis solution is adjusted, and the volumes of 60 μL, 100 μL, 300 μL, 500 μL, 800 μL are compared, and it is found that 500 μL has the best effect, so 500 μL DNA type lysis solution is used in the subsequent experiment). The grinding time and standing lysis time are tested, and each treatment is repeated three times. According to the test results of grinding time and lysis time (Table 2, Table 3), it is shown that the effect of grinding for 1 min is better than that of grinding for 2 min and 3 min, and the effect of lysis for 10 min is better than that of lysis for 3 min and 5 min, that is, the best result is obtained when lysis for 10 min.

[0099] Table 2 Test results of grinding time

[0100]

[0101] Table 3 Test results of lysis time

[0102]

[0103] 2.3 Reaction template addition amount test

[0104] The corn leaf samples inoculated with Puccinia sorghi for 1-8 days in the laboratory are detected, and each treatment is repeated three times. The digital constant temperature detector detects that the detection value of the sample inoculated for 1-3 days is 0, and the detection value is detected from the fourth day.

[0105] According to the test results (Table 4), the detection value of the sample inoculated with Puccinia sorghi for 4-8 days is higher than that of the sample inoculated with 10 μL when the sample template addition amount is 5 μL; it is shown that the effect of adding 5 μL of reaction template is better than that of adding 10 μL, so the template addition amount in the detection reaction system is determined to be 5 μL.

[0106] Table 4 Test results of reaction template addition amount

[0107]

[0108] 2.4 Establishment of field monitoring specific operation method

[0109] (I) Material preparation

[0110] 1.1.5 mL centrifuge tube, 50 μL pipette, grinding rod, field detection reagent, DNA type lysate, sterile water, digital constant temperature detector, mobile power supply, PCR tube rack, scissors, etc. 2 1.5 mL centrifuge tubes and 2 50 μL pipettes are required for each sample. The field detection reagent contains all components of the DNA constant temperature rapid amplification kit (fluorescent type) (produced by Amp Future Biotechnology Co., Ltd., product number: WLE8202KIT): A buffer, B buffer, freeze-dried reagent (and positive control template and positive control primer probe MIX used as a control), and primers F12, R11 and probes. Each PCR tube contains all components of the above field detection reagent for one detection (50 μL of amplification reaction system), and a dry reagent and a buffer microsphere are placed in the tube as a detection reagent tube. In the 50 μL amplification reaction system, the primer F12 is 20 pmol, the primer R11 is 20 pmol, and the probe is 6 pmol. The digital constant temperature detector used is purchased from Amp Future Biotechnology Co., Ltd., product number: WL-PS-8C.

[0111] 2. Add 500 μL of DNA lysate (DNA lysate is a rapid nucleic acid release agent (DNA type)-II type, purchased from Amp Future Biotechnology Co., Ltd., product number: WLD8201-ES) to the 1.5 mL centrifuge tube as tube 1; add 450 μL of sterile water to the 1.5 mL centrifuge tube as tube 2.

[0112] (II) Nucleic acid extraction

[0113] 1. Take the 3-4 leaves of the corn from the bottom, about 15-20 cm from the leaf tip, and take 2-3 small pieces of leaf with a size of 1 cm*1 cm in tube 1.

[0114] 2. Grind the sample with a grinding rod for 1 min. After the sample is crushed, mix well at room temperature for 10 min for lysis to obtain the lysis product.

[0115] (III) Amplification detection

[0116] 1. Use a 50 μL pipette to draw 50 μL of lysis product and add it to tube 2, and mix manually by covering the tube cap (i.e. dilute the lysis product by 10 times).

[0117] 2. Open the detection reagent tube cap, use a 50 μL pipette to draw 50 μL of diluted lysis product, and add it to the detection reagent tube.

[0118] 3. Cover the tube cap and immediately mix it up and down 8-10 times, then shake the liquid to the bottom of the tube to prepare the reaction tube.

[0119] 4. Open the cover of the digital constant temperature detector, place the reaction tube into the instrument, tighten the cover, press the heating button (constant temperature 40℃), and start by pressing the run key.

[0120] 5. Amplify for 4 min, and the instrument will emit a "ding-ding" prompt sound. At this time, open the cover of the instrument, take out the reaction tube, mix it up and down for 8-10 times again, shake the liquid to the bottom of the tube, and put it back into the digital constant temperature detector in the original order, and tighten the cover.

[0121] 6. Continue to amplify for 16 min, and the program will end. The instrument will display the corresponding numerical value of the hole site.

[0122] (Four) result interpretation

[0123] A large number of previous detection results show that false positive errors may occur due to the detection instrument detecting pathogenic bacteria through fluorescent groups, and 0-2 values may appear in negative processing. Based on the previous detection results and the test results of the amount of reaction template added, the minimum detection value is 3. In order to ensure the accuracy of the detection and avoid false positives, 0-3 is defined as negative, and 4-99 is defined as positive.

[0124] Therefore, the result interpretation method is as follows: if the instrument displays a value between 00-03, the result is negative, indicating that the sample does not contain the nucleic acid of the corn southern rust pathogen Puccinia polysora or the content is lower than the detection lower limit. If the instrument displays a value between 04-99, the result is positive, indicating that the sample contains the nucleic acid of the corn southern rust pathogen Puccinia polysora.

[0125] 2.5.1 Continuous monitoring of non-disease plots

[0126] The method established in 2.4 was used to detect the field samples of the experimental plots. The corn growth period of each plot was consistent, and it was at the tasseling stage. Random sampling and photographing were carried out every day for five different experimental plots. The monitoring results Figure 11 ) show that the corn southern rust pathogen Puccinia polysora was first detected on August 28, 2024, and the detection value gradually increased over time. On the seventh day of detecting Puccinia polysora (September 4, 2024), diseased corn leaves were observed in the field.

[0127] Figure 11 A in the table, ① test plot 1, ② test plot 2, ③ test plot 3, ④ test plot 4, ⑤ test plot 5, were in the incubation period on August 27, 2024 and before, and the corn leaves in the field did not appear disease spots, all were healthy leaves. Figure 11B, same as 1, 2, 3, 4, 5, the initial infection period is August 28, 2024, and no disease spots are observed on the corn leaves in the field, but the instrument begins to detect values. Figure 11 C in the test field begins to appear diseased leaves for the first time (September 4, 2024), and spore piles are observed on the corn leaves. Figure 11 D is the detection result, and the corn is not diseased on August 27, 2024, and no disease is detected; on August 28, the corn is not diseased, and the first detection result is detected, and the detection result value becomes larger and larger over time; by September 4, the first spore pile appears, and the corn officially becomes diseased in the field, indicating that the kit can detect corn southern rust pathogens about 7 days before the disease appears.

[0128] 2.5.2 Disease incidence investigation in the monitoring field

[0129] Three plots are set up in the field, each with a size of 7m*10m, and the susceptible corn variety Zhengdan 958 is planted, and three treatments are set up, namely (1) control plot: no pesticide treatment; (2) early prevention and control plot: immediately apply pesticides in the plot after detecting the rust; (3) conventional prevention and control plot: apply pesticides in the plot after the leaves begin to show symptoms.

[0130] When the corn southern rust pathogen is first detected, the early prevention and control plot begins to apply pesticides, and one week later, when the diseased corn leaves are clearly visible in the field, the conventional prevention and control plot begins to apply pesticides (the same pesticide and the same amount of pesticide are used in the early prevention and control plot and the conventional prevention and control plot, and both are conventional application methods). After applying pesticides, the five-point sampling method is used for disease incidence investigation. The test field disease incidence investigation results (Table 5) show that on September 21, 2024, September 28, and October 4, the disease control rate of the plot where the corn southern rust pathogen is detected and immediately applied pesticides (i.e. the early prevention and control plot) is 19%, 20.2%, and 22%; the disease incidence of the plot where the application of pesticides begins after the leaves begin to show symptoms (i.e. the conventional prevention and control plot) is 27.7%, 31.6%, and 34%; and the disease incidence of the plot where no pesticides are applied (i.e. the control plot) is 28.2%, 34.4%, and 41.1%. The investigation results show that the optimized detection method of the present embodiment can monitor the corn southern rust pathogen before the leaves show symptoms, and early prevention and control can reduce the incidence of corn southern rust.

[0131] Table 5 Disease incidence investigation results at different pesticide application times

[0132] Investigation time Incidence of control plot Incidence of early prevention and control plot Incidence of routine prevention and control plot September 21 28.2％ 19％ 27.7％ September 28 34.4％ 20.2％ 31.6％ October 4 41.1％ 22％ 34％

Claims

1. A primer and probe set for detecting southern rust in maize, characterized in that, The device includes an upstream primer F12, a downstream primer R11, and a probe. The nucleotide sequence of the upstream primer F12 is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer R11 is shown in SEQ ID NO.

6. The nucleotide sequence of the probe is shown in SEQ ID NO.10, wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran (THF) is introduced between the 32nd base G and the 33rd base T as a debasement site, the 33rd base T is modified with a BHQ1 quencher group, and the 3' end is blocked with a C3 spacer.

2. A test kit for detecting southern rust in maize, characterized in that, It includes the primer and probe set and DNA isothermal rapid amplification reagent as described in claim 1.

3. A rapid field detection kit for southern rust of maize, characterized in that, Includes the maize southern rust detection kit and DNA lysis buffer as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The maize southern rust detection kit contains all the components of the DNA isothermal rapid amplification kit: buffer A, buffer B, lyophilized powder reagent, and a positive control template and positive control primer probe MIX used as controls, as well as the primer probe set as described in claim 1; the DNA isothermal rapid amplification kit is a fluorescent DNA isothermal rapid amplification kit, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLE8202KIT.

5. The reagent kit according to claim 4, characterized in that, All components of the maize southern rust detection kit are prepared into a dry powder reagent and a buffer microsphere in a PCR tube according to the amount of 50 μL amplification reaction system for one detection, which is used as the detection reagent tube; in the detection reagent tube, the upstream primer F12 is 20 pmol, the downstream primer R11 is 20 pmol, and the probe is 6 pmol; the maize southern rust detection kit contains several detection reagent tubes.

6. The reagent kit according to claim 3, characterized in that, The DNA lysis buffer is a rapid nucleic acid release agent of DNA type II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES.

7. A rapid field detection method for early detection of southern rust in maize, characterized in that, Includes the following steps: S1. Take 2-3 small leaf pieces (1cm x 1cm) from the lower part of the leaf of the corn plant to be tested, about 15-20cm from the leaf tip, and place them in tube 1. Grind the sample with a grinding rod for 1 minute, mix well, and let it stand at room temperature for 10 minutes to lyse and obtain the lysate. Tube 1 is a 1.5mL centrifuge tube containing 500μL of DNA lysis buffer. S2. Using a 50μL quantitative pipette, take 50μL of the lysis product and add it to tube 2. Mix well to dilute. Using a 50μL quantitative pipette, take 50μL of the diluted lysis product and add it to the test reagent tube as described in claim 5. Mix well and then shake the liquid to the bottom of the tube to obtain a reaction tube. Tube 2 is a 1.5mL centrifuge tube containing 450μL of sterile water. S3. Place the reaction tube into the digital constant temperature detector, set the temperature to a constant 40℃, start the operation, amplify for 4 minutes, the instrument will emit a "beep" prompt, at this time take out the reaction tube, mix well, shake the liquid to the bottom of the tube, put it back into the digital constant temperature detector to continue amplification for 16 minutes, the program ends, the instrument displays the corresponding value of the well position. S4. Interpret the results based on the instrument display values: If the instrument display value is between 00 and 03, the result is negative, indicating that the sample does not contain the nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn; if the instrument display value is between 04 and 99, the result is positive, indicating that the sample contains the nucleic acid of *Rhizoctonia solani*, the pathogen of southern rust of corn.

8. The detection method according to claim 7, characterized in that, The DNA lysis buffer is a rapid nucleic acid release agent of DNA type II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES.

9. The detection method according to claim 7, characterized in that, The digital constant temperature detector was purchased from Anpu Future Biotechnology Co., Ltd., item number: WL-PS-8C.

10. The application of the maize southern rust detection primer and probe set according to claim 1, the maize southern rust detection kit according to claim 2, or the maize southern rust field early rapid detection kit according to any one of claims 3-6 in the detection and control of maize southern rust.

Images