Application of SNP (Single Nucleotide Polymorphism) molecular marker of rice grain cadmium content related gene FYCd1

Abstract

The invention relates to application of an SNP (Single Nucleotide Polymorphism) molecular marker of a rice grain cadmium content related gene FYCd1 in the field of nucleic acid detection. The method for identifying or assisting in identifying the cadmium content of the rice grains comprises the steps that the genotype of an SNP site in a rice genome to be detected is detected, the cadmium content of the rice grains is identified or assisting in identifying according to the genotype, the SNP site is an SNP site on a rice chromosome 1, the nucleotide type of the SNP site is A or G, and the SNP site is the 26th nucleotide of a sequence 4 in a sequence table. The grain cadmium content of the to-be-detected rice with the genotype of AA at the SNP site is higher than that of the to-be-detected rice with the genotype of GG at the SNP site. The identification method disclosed by the invention can be applied to breeding of low-cadmium rice varieties.

Description

TECHNICAL FIELD

[0001] The application relates to application of a SNP molecular marker of a rice grain cadmium content related gene FYCd1 in the field of nucleic acid detection. BACKGROUND

[0002] Excessive cadmium content in rice grains not only seriously endangers human health, but also causes kidney damage, osteoporosis, cardiovascular disease, reproductive and developmental disorders, and even induces cancer and nervous system diseases, especially for children and pregnant women. Meanwhile, excessive cadmium content inhibits the growth and development of rice, reduces yield and quality, and affects the economic benefits of farmers. More seriously, cadmium is difficult to degrade in soil and is easy to accumulate through the food chain, causing persistent pollution of soil and ecological environment and threatening the stability of the entire ecological system. Therefore, prevention and control of cadmium pollution in rice are crucial for guaranteeing food safety and ecological health.

[0003] As an important gene for regulating cadmium content in rice grains, the SNP molecular marker of the FYCd1 gene has important application value in rice breeding. By developing the SNP molecular marker closely linked to the FYCd1 gene, efficient molecular assisted selection of low-cadmium accumulation traits in rice varieties can be realized. In actual breeding process, genotype detection of parents and offspring by using these SNP markers can quickly and accurately screen plants carrying favorable alleles, thereby accelerating the breeding process of low-cadmium rice varieties. In addition, the SNP marker of FYCd1 can also be used for identification and genetic diversity analysis of germplasm resources, thereby providing strong technical support for prevention and control of cadmium pollution in rice and safe production. SUMMARY

[0004] The problem to be solved by the application is how to identify or assist in identifying cadmium content in rice grains.

[0005] To solve the above technical problems, the application first provides a method for identifying or assisting in identifying cadmium content in rice grains, comprising detecting the genotype of the SNP site in the genome of the rice to be tested, and identifying or assisting in identifying the cadmium content in the rice grains according to the genotype, wherein the genotype is AA or GG, the AA is a homozygous type of A at the SNP site, and the GG is a homozygous type of G at the SNP site.

[0006] The SNP site is the 26th nucleotide in sequence 4 in the sequence list. The nucleotide sequence of sequence 4 is as follows:

[0007] 5'-TGAAATGAGATATCACGTTCGCTGTrGATGCTATTCTCACGTTAATCGAAGAAAAAGAGAAAGAGAGCTCATG-3', in sequence 4, r represents a or g.

[0008] As an embodiment, the method for identifying or assisting in identifying the cadmium content of rice grains can comprise the following steps:

[0009] (1) Using the genomic DNA of the rice to be tested as a template, KASP molecular marker detection is performed using a primer composition; the primer composition is composed of primer A, primer B and primer C;

[0010] The primer A is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 1 in the sequence listing or a single-stranded DNA with a nucleotide sequence of positions 22-47 of SEQ ID NO: 1 in the sequence listing;

[0011] The primer B is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2 in the sequence listing or a single-stranded DNA with a nucleotide sequence of positions 22-44 of SEQ ID NO: 2 in the sequence listing;

[0012] The primer C is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3 in the sequence listing;

[0013] (2) After step (1) is completed, fluorescence detection is performed to determine the genotype of the SNP of the rice to be tested;

[0014] (3) According to the genotype result, the cadmium content of the grains of the rice to be tested is identified: the cadmium content of the rice to be tested with the genotype AA of the SNP site is higher than that of the rice to be tested with the genotype GG of the SNP site.

[0015] The present application also provides a method for breeding rice.

[0016] The method for breeding rice provided by the present application comprises detecting the genotype of the SNP site in the genome of the rice, and selecting the rice with the genotype GG of the SNP site as a parent for breeding, wherein the GG is a homozygous type of the SNP site being G.

[0017] As an embodiment, the method for breeding rice can comprise the following steps:

[0018] (1) Using the genomic DNA of the rice to be tested as a template, KASP molecular marker detection is performed using the above-mentioned primer composition;

[0019] (2) After step (1) is completed, fluorescence detection is performed to determine the genotype of the SNP site of the rice to be tested;

[0020] (3) Selecting the rice with the genotype GG for breeding of rice with low cadmium content of grains.

[0021] In the above method, the primer dissolving and preparation method can be: first, dilute the three primers into 100 mM with ddH2O respectively, then prepare the primer working solution according to the following: primer A 12 μL, primer B 12 μL, primer C 30 μL, ddH2O 46 μL, as the KASP marker primer working solution, and store at -20 DEG C for standby.

[0022] In the above method, the KASP reaction system can be: primer A 12 μL, primer B 12 μL, primer C 30 μL, ddH2O 46 μL.

[0023] In the above method, the KASP marker reaction procedure can be:

[0024] First step: 94 DEG C pre-denaturation for 15 min;

[0025] Second step: 94 DEG C for 20 s, 61 DEG C for 60 s, 94 DEG C for 20 s, 60.4 DEG C for 60 s, 94 DEG C for 20 s, 59.8 DEG C for 60 s, 94 DEG C for 20 s, 59.2 DEG C for 60 s, 94 DEG C for 20 s, 58.6 DEG C for 60 s, 94 DEG C for 20 s, 58 DEG C for 60 s, 94 DEG C for 20 s, 57.4 DEG C for 60 s, 94 DEG C for 20 s, 56.8 DEG C for 60 s, 94 DEG C for 20 s, 56.2 DEG C for 60 s, 94 DEG C for 20 s, 55.6 DEG C for 60 s;

[0026] Third step: 94 DEG C denaturation for 20 s, 55 DEG C annealing for 60 s, 5 cycles; if the typing is not obvious, increase 5 cycles for extension;

[0027] Fourth step: 94 DEG C for 20 s, annealing for 60 s at 57 DEG C, 26 cycles.

[0028] In the above method, the method for determining the genotype of the SNP of the to-be-tested rice can be: after the PCR reaction is completed, the fluorescence signal is converted into an analyzable numerical value by using a fluorescence signal reader (Omega) and a fluorescence detection system (Araya), and the fluorescence data of the reaction product is read. The terminal end fluorescence value is read for genotyping, and the fluorescence scanning result is graphically displayed by using an R software package, the A base type has FAM fluorescence and is distributed near the x axis; the G base type has HEX fluorescence and is distributed near the y axis; and the sample without signal detection is distributed near the origin.

[0029] The application of the above method in rice breeding also belongs to the protection scope of the present application.

[0030] The present application also provides an application of a substance for detecting the polymorphism or genotype of KASP in the genome of rice in any one of the following,

[0031] (1) identifying or assisting in identifying the cadmium content of rice grains;

[0032] (2) rice breeding;

[0033] (3) products for preparing, identifying or aiding in identifying the cadmium content of rice grains;

[0034] (4) products for rice breeding;

[0035] The SNP site is a site on chromosome 1 of rice, and the nucleotide species is A or G, which is the 26th nucleotide of SEQ ID NO: 4 in the sequence listing.

[0036] With the Chinese genome sequence of common rice as the reference genome, the SNP site is at 6987224bp of chromosome 1 of rice (specifically, the 26th nucleotide of SEQ ID NO: 4 in the sequence listing).

[0037] The application also provides products for detecting the polymorphism or genotype of the SNP site in the rice genome.

[0038] The products for detecting the polymorphism or genotype of the SNP site in the rice genome provided by the application contain the above-mentioned substances for detecting the polymorphism or genotype of the SNP site in the rice genome, and the products are any one of the following:

[0039] C1) products for detecting the single nucleotide polymorphism or genotype related to the cadmium content of rice grains;

[0040] C2) products for identifying or aiding in identifying the cadmium content of rice grains;

[0041] C3) products for rice breeding.

[0042] In the above-mentioned applications, methods and products, the substances can be reagents and / or instruments required for determining the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography and SNP chip. The SNP chip includes chips based on nucleic acid hybridization reaction, chips based on single-base extension reaction, chips based on allele-specific primer extension reaction, chips based on "one-step" reaction, chips based on primer ligation reaction, chips based on restriction enzyme reaction, chips based on protein DNA binding reaction, and chips based on fluorescence molecule DNA binding reaction.

[0043] Alternatively, the substances are the following D1), D2) or D3):

[0044] D1) the substances are primer compositions for amplifying a fragment of rice genome DNA containing the SNP site;

[0045] D2) the substances are PCR reagents containing the primer compositions of D1);

[0046] D3) the kit further comprises KASP Master Mix.

[0047] Optionally, the amplification can be PCR amplification. The primer composition consists of the primer A, the primer B and the primer C.

[0048] D3) the kit further comprises KASP Master Mix.

[0049] In the above-mentioned applications, methods and products, the primer composition can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32P; binding moieties such as biotin; hapten such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with a nucleic acid or protein sequence, as long as the sequence containing the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., the sequence is directly read). As the primer composition can be a primer composition consisting of a single-stranded DNA with a nucleotide sequence of positions 22-47 of SEQ ID NO: 1, a single-stranded DNA with a nucleotide sequence of positions 22-44 of SEQ ID NO: 2 and a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 3, the primer composition can also be a primer set of a single-stranded DNA as shown in SEQ ID NO: 1, a single-stranded DNA as shown in SEQ ID NO: 2 and a single-stranded DNA as shown in SEQ ID NO: 3. SEQ ID NO: 1 consists of 47 nucleotides, the first 21 nucleotides are a FAM linker sequence (as a label), and the 22nd-47th nucleotides are a specific sequence; SEQ ID NO: 2 consists of 44 nucleotides, the first 21 nucleotides are a HEX linker sequence (as a label), and the 22nd-44th nucleotides are a specific sequence.

[0050] The present application also provides a DNA molecule, the nucleotide sequence of which is shown in SEQ ID NO: 1 of the sequence listing.

[0051] The use of the above-mentioned DNA molecule also falls within the scope of protection of the present application. The use is specifically the use in any of the following:

[0052] (1) identifying or assisting in identifying the cadmium content of rice grains;

[0053] (2) rice breeding;

[0054] (3) preparing a product for identifying or assisting in identifying the cadmium content in rice grains;

[0055] (4) preparing a product for rice breeding.

[0056] Optionally, in the above-mentioned applications, the DNA molecule serves as a detection target.

[0057] The substance for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as a substance for detecting a single nucleotide polymorphism or genotype of another molecular marker related to the cadmium content in rice grains) to prepare a product for identifying rice varieties with low cadmium content in grains.

[0058] The present study provides an efficient and accurate method for screening rice varieties with low cadmium accumulation by developing a SNP molecular marker of FYCd1, which is of great significance for improving the safety of rice food and promoting the development of environmentally friendly agriculture. BRIEF DESCRIPTION OF DRAWINGS

[0059] Figure 1 Genotype identification of 60 rice germplasm materials by FYCd1 molecular marker. DETAILED DESCRIPTION

[0060] The present application will be further described in detail below with reference to the specific embodiments, and the examples given are only for illustrating the present application, but not for limiting the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.

[0061] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0062] In the quantitative experiments in the following examples, three repeated experiments were set up, and the results were averaged, unless otherwise specified.

[0063] The 360 ​​experimental materials described in the following examples are documented in: Huili Yan, et al. Variation of a major facilitator superfamily gene contributes to differential cadmium accumulation between rice subspecies. Nature Communications. 2019.10:2562. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention; it may not be used for any other purpose.

[0064] In the following examples, the experimental field was a typical cadmium-contaminated paddy field in my country, with a soil cadmium content of 0.41 mg / kg and a pH of 5.3.

[0065] In the following examples, 360 experimental samples and 60 validation samples were grown in 2021. The specific operating steps are as follows: When the germinated seeds reached a sprout length of 5 mm, they were sown in the field until they grew into seedlings. Two weeks later, the seedlings were transplanted with a row spacing of 25 cm; 8 seedlings were planted in each row with a plant spacing of 20 cm. After the rice matured, grain samples were collected. To avoid boundary effects, the two plants adjacent to the aisle were discarded, and the grains of the remaining plants were mixed together. The collected rice grain samples were sun-dried or placed in an oven at 60°C for 3 days. After the quality was constant, the rice was hulled using a rice huller, and the resulting brown rice samples were placed in 5 ml centrifuge tubes. The brown rice samples were then pulverized using a high-throughput silent tissue grinder for subsequent cadmium content determination.

[0066] In the following examples, the cadmium content of rice grains was determined using a single acid digestion method. The instrument used was a far-infrared temperature-controlled digestion furnace, and the container was a glass digestion tube. The specific steps are briefly described below:

[0067] (1) Sample weighing: Accurately weigh 0.2000g of crushed rice grain sample (accurate to 0.0001g) and put it into a glass digestion tube to avoid the powder sticking to the wall.

[0068] (2) Add acid: Add 1 ml of analytical grade nitric acid and digest overnight in a cold environment. (3) Digestion: Cover with a curved funnel and digest at 200°C for 6 hours until the digestion liquid is colorless and transparent or slightly yellow.

[0069] (3) Volume adjustment: Wash the digestion solution in the tube with distilled water, transfer the washing solution to a 15ml volume adjustment tube, and adjust the volume to 15ml.

[0070] (4) Filtration: After shaking, the liquid was filtered through a 0.45 μm aqueous filter membrane into 10 ml centrifuge tubes for analysis. Quality control: Two blank controls and three rice flour component analysis standard materials (national standard material, GBW100349, Steel Research Institute Nake Testing Technology Co., Ltd.) were set up for each batch digestion to ensure the accuracy and reliability of the cadmium content data of rice grains. All sample determinations were repeated three times. The cadmium content of rice grains was determined by inductively coupled plasma mass spectrometry. The results are shown in Table 1.

[0071] The following examples illustrate the genotypic analysis of FYCd1(1_6987224) from 360 rice MCC population materials. t-tests were used to compare the statistical differences in cadmium content in grains among different haplotypes. P-values ​​were calculated using Tukey's test. A P-value less than 0.05 was defined as statistically significant; a P-value less than 0.01 was defined as highly statistically significant.

[0072] Example 1: Discovery of SNP sites associated with cadmium content in rice grains

[0073] Using phenotypic and genotypic data of total cadmium content in grains from 360 rice MCC populations, a genome-wide association analysis (GWAS) identified a SNP locus, Chr1_6987224, associated with total cadmium content in rice grains, which was named FYCd1. This locus is located at position 6987224 on chromosome 1 of the Nipponbare rice genome sequence, and its nucleotide value is either A or G. The SNP locus has two genotypes: AA and GG. Genotype AA is homozygous for nucleotide A at the SNP locus, and genotype GG is homozygous for nucleotide G at the SNP locus.

[0074] Significant differences in grain cadmium content corresponding to different allelic genotypes of the screened SNP loci were analyzed. The results are as follows: Sequencing results of 360 germplasm resources are shown in Table 1. The high-cadmium genotype AA was found in 225 materials, with an average grain cadmium content of 0.531 mg / kg; the low-cadmium genotype GG was found in 135 materials, with an average grain cadmium content of 0.323 mg / kg. Statistical results indicate that the grain cadmium content of rice materials corresponding to AA was significantly higher than that of rice materials corresponding to GG (P<0.01). The SNP locus FYCd1 can be used as a molecular marker for identifying or assisting in the identification of grain cadmium content in different rice varieties (Table 2).

[0075] Table 1. Cadmium content in rice grains and FYCd1 genotypes of 360 rice varieties

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093] Table 2, Grain cadmium content of different genotypes of rice germplasm materials

[0094]

[0095] Example 2, Development of FYCd1 molecular marker identification primer set and establishment of identification method

[0096] 1. Design of KASP molecular marker primer set

[0097] The KASP molecular marker primer set for the upstream and downstream sequences of the excellent allelic variation site 1_6987224 was designed. The primer set of KASP marker was composed of two upstream specific primers (primer A and primer B) and one downstream universal primer (primer C) (Table 3).

[0098] Table 3, FYCd1 molecular marker primer sequence

[0099] Primer name Primer sequence (5'-3') Position in sequence listing Primer A GAAGGTGACCAAGTTCATGCTTGAAATGAGATATCACGTTCGCTGTA Sequence 1 Primer B GAAGGTCGGAGTCAACGGATTAATGAGATATCACGTTCGCTGTG Sequence 2 Primer C CATGAGCTCTCTTTCTCTTTTTCTTCGAT Sequence 3

[0100] Note: The underlined part represents the fluorescent label sequence. The 5' end of primer A is connected with 6-carboxyfluorescein (FAM) fluorescent label, and the 5' end of primer B is connected with hexachloro-6-methylfluorescein (HEX) fluorescent label.

[0101] The nucleotide of the SNP site amplified by the single-stranded DNA molecule represented by primer A and primer C is A, and the fluorescence signal of the FAM group can be read by an enzyme marker or a fluorescent quantitative PCR instrument; the nucleotide of the SNP site amplified by the single-stranded DNA molecule represented by primer B and primer C is G, and the fluorescence signal of the HEX group can be read by an enzyme marker or a fluorescent quantitative PCR instrument. The specific primer sequences are synthesized by Zhongyu Jinbi (Beijing) Biotechnology Co., Ltd.

[0102] 2. PCR amplification system and procedure of KASP marker

[0103] Rice genomic DNA was extracted by CTAB method and dissolved in 400 μL TE. The quality of the DNA was detected by 1% agarose gel electrophoresis. The extracted DNA was required to have no obvious impurities, clear bands and no degradation. After measuring the concentration of the DNA, it was uniformly diluted to 28.3 ng / μL. The diluted rice genomic DNA was used as a template for PCR amplification.

[0104] Preparation of KASP marker primer working solution: First, dilute the three primers to 100 mM with ddH2O, then prepare the primer working solution according to the following formula: primer A 12 μL, primer B 12 μL, primer C 30 μL, ddH2O 46 μL. Store at -20℃ for standby.

[0105] The PCR amplification system is: primer A 12 μL, primer B 12 μL, primer C 30 μL, ddH2O 46 μL.

[0106] The PCR reaction procedure is: first step: 94℃ pre-denaturation for 15 min;

[0107] Second step: 94℃ for 20 s, 61℃ for 60 s, 94℃ for 20 s, 60.4℃ for 60 s, 94℃ for 20 s, 59.8℃ for 60 s, 94℃ for 20 s, 59.2℃ for 60 s, 94℃ for 20 s, 58.6℃ for 60 s, 94℃ for 20 s, 58℃ for 60 s, 94℃ for 20 s, 57.4℃ for 60 s, 94℃ for 20 s, 56.8℃ for 60 s, 94℃ for 20 s, 56.2℃ for 60 s, 94℃ for 20 s, 55.6℃ for 60 s;

[0108] Third step: 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 5 cycles; if the typing is not obvious, increase 5 more cycles for extension;

[0109] Fourth step: 94℃ for 20 s, annealing at 57℃ for 60 s, 26 cycles.

[0110] The blank control (CK) without adding template DNA in the reaction system was set up at the same time, and 1 control was set up for each plate.

[0111] 3. Genotyping

[0112] After the completion of the PCR reaction, the fluorescence signal reading instrument (Omega) and the fluorescence detection system (Araya) were used to convert the fluorescence signal into analyzable numerical values for the fluorescence data reading of the reaction products. The fluorescence scanning results were graphically displayed using the R software package, the A base type was labeled with FAM fluorescence and distributed near the x-axis; the G base type was labeled with HEX fluorescence and distributed near the y-axis; and the samples without detection signal were distributed near the origin.

[0113] The FAM excitation wavelength was 485 nm, and the emission wavelength was 520 nm. The HEX excitation wavelength was 535 nm, and the emission wavelength was 556 nm. The system reference fluorescence ROX excitation wavelength was 575 nm, and the emission wavelength was 610 nm.

[0114] Example 3, Application of FYCd1 Molecular Marker in Identifying Cadmium Content in Rice

[0115] Rice to be tested: 60 different types of rice germplasm resources, specific information is shown in Table 4.

[0116] The rice to be tested was planted in a typical cadmium-polluted paddy field with a soil cadmium content of 0.41 mg / kg and a pH of 5.3. After the rice matured, the grain samples were collected for cadmium content detection, and the results are shown in Table 4.

[0117] Genomic DNA of each test material was extracted, and the above-mentioned FYCd1 molecular marker was used to detect the genotype of the rice to be tested, and the results are shown in Table 4. Figure 1 AA indicates that the SNP site FYCd1 of the rice material has a genotype of AA, GG indicates that the SNP site FYCd1 of the rice material has a genotype of GG, and NTC is a blank control without adding template DNA in the reaction system.

[0118] Table 4, Cadmium content of 60 varieties of rice grains and genotype of FYCd1 molecular marker

[0119]

[0120]

[0121]

[0122]

[0123] The results show that the genotypes of 30 materials are AA, and the genotypes of 30 materials are GG. The detection results of FYCd1 marker are consistent with the sequencing results, indicating that the KASP marker can accurately identify the genotypes of the grain cadmium content related gene FYCd1 in different rice germplasm resources (Table 4 and Figure 1 ).

[0124] The statistical results show (Table 5) that among the 60 rice germplasm resources, 30 materials have a genotype of AA, and the average grain cadmium content is 0.259 mg / kg; 30 materials have a genotype of GG, and the average grain cadmium content is 0.135 mg / kg. Significant analysis of the 60 verification materials shows that the grain cadmium content of the rice materials corresponding to the genotype AA is extremely significantly higher than that of the rice materials corresponding to the genotype GG (P < 0.001).

[0125] In summary, the SNP marker FYCd1 developed in the present application can accurately identify the genotype of the grain cadmium content related gene FYCd1 in rice germplasm resources, and can be applied to rice breeding, such as breeding low-cadmium rice varieties.

[0126] Table 5, correlation analysis of grain cadmium content and SNP site genotype of 60 varieties of rice

[0127]

[0128] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. A method for identifying or assisting in the identification of cadmium content in rice grains, characterized in that: This includes detecting the genotype of SNP sites in the genome of the rice to be tested, and identifying or assisting in the identification of cadmium content in rice grains based on the genotype. The SNP site is an SNP site on chromosome 1 of rice, and its nucleotide type is A or G, which is the 26th nucleotide of sequence 4 in the sequence listing.

2. The method according to claim 1, characterized in that: The genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP locus being A, and GG is the homozygous type of the SNP locus being G; the cadmium content in the grains of the tested rice with the genotype AA at the SNP locus is higher than that in the tested rice with the genotype GG at the SNP locus.

3. A method for rice breeding, characterized by: The method includes detecting the genotype of the SNP locus in claim 1 in the rice genome, selecting rice with the genotype AA at the SNP locus as a parent for breeding, wherein AA is a homozygous type of the SNP locus being A.

4. Application of substances for detecting SNP polymorphisms or genotypes in the rice genome in any of the following: (1) To identify or assist in the identification of cadmium content in rice grains; (2) Rice breeding; (3) Prepare products for identification or auxiliary identification of cadmium content in rice grains; (4) Prepare rice breeding products; The SNP site is an SNP site on rice chromosome 1, and its nucleotide type is A or G, which is the 26th nucleotide of sequence 4 in the sequence listing.

5. The application according to claim 4, characterized in that: The genotype of the SNP locus is AA or GG, where AA is the homozygous type of the SNP locus being A, and GG is the homozygous type of the SNP locus being G; the cadmium content in the grains of the tested rice with the genotype AA at the SNP locus is higher than that in the tested rice with the genotype GG at the SNP locus.

6. The application according to claim 4 or 5, characterized in that: The substance is either D1), D2), or D3): D1) The substance described is a primer composition for amplifying rice genomic DNA fragments including the SNP sites; D2) The substance described is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

7. The application according to claim 6, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-47 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-44 of sequence 2 in the sequence listing. The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

8. The primer composition described in claim 7.

9. A DNA molecule, characterized by: The nucleotide sequence of the DNA molecule is sequence 4 in the sequence listing.

10. The use of the DNA molecule of claim 9 in any of the following: (1) To identify or assist in the identification of cadmium content in rice grains; (2) Rice breeding; (3) Prepare products for identification or auxiliary identification of cadmium content in rice grains; (4) Prepare rice breeding products.

Images