Aspergillus cristatum and application thereof

Abstract

The invention discloses a strain of aspergillus cristatus and application thereof, the strain is named as aspergillus cristatus LH-4G, the preservation number is CGMCC No.41958, the preservation date is May 28, 2025, and the preservation unit is China General Microbiological Culture Collection Center (CGMCC). The Aspergillus cristatus strain is used for fermenting to prepare the post-fermented tea, so that infectious microbe pollution can be effectively avoided, the fermentation period is shortened, the material basis change similar to that of natural aging is realized in a relatively short time, and meanwhile, the quality of the post-fermented tea is controllable.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial fermentation, and particularly relates to a strain of Aspergillus coronatus and application thereof. BACKGROUND

[0002] Post-fermentation tea, also known as dark tea, including Liupao tea, Pu'er tea, green brick tea and Fuzhuan tea, is a traditional border and expatriate tea in China.

[0003] Post-fermentation tea is different from other five tea types (green tea, white tea, yellow tea, green tea and black tea). Microorganisms continue to exist in physiological activities during the production, aging and storage of post-fermentation tea. The quality of post-fermentation tea is significantly affected by microorganisms. Microorganisms can not only change the sensory quality of tea leaves (appearance of tea leaves, color of tea soup, and unique flavor and taste of tea leaves), but also affect the physicochemical properties of tea leaves. The preparation process of traditional post-fermentation tea is complex and time-consuming, and needs to go through a long aging stage of several years. During this period, tea leaves gradually form unique flavor and quality through the metabolic activity of microorganisms and a series of complex biochemical reactions under suitable environmental conditions such as temperature and humidity. However, due to the variety of microorganisms and the influence of environmental fluctuations on their activity, the metabolic process is difficult to accurately control, resulting in poor quality (sensory quality and physicochemical properties) of tea leaves during the aging process, which brings great challenges to quality control. SUMMARY

[0004] To solve the above technical problems, the purpose of the present application is to provide a strain of Aspergillus coronatus and its application, so as to shorten the fermentation period of post-fermentation tea and improve the quality of post-fermentation tea.

[0005] The present application provides a strain of Aspergillus coronatus, named Aspergillus coronatus (A. Aspergillus cristatus ) LH-4G, with a preservation number of CGMCC No. 41958, a preservation date of May 28, 2025, and a preservation unit of China General Microbiological Culture Collection Center.

[0006] The present application provides a microbial agent for preparing post-fermentation tea, which comprises the Aspergillus coronatus.

[0007] The present application provides the application of the Aspergillus coronatus in preparing post-fermentation tea.

[0008] The application provides application of the said Aspergillus corntus in preparation of post-fermented tea. The post-fermented tea prepared by fermentation of the Aspergillus corntus strain of the application has a fermentation time of not more than 28 days (tea red 3.282 mg / g, flavonoids 0.315 mg / g, antioxidant property 62.1 %, tea polyphenol 3.382 mg / g, amino acid 0.653 mg / g, soluble sugar 25.9 % and tea brown 9.244 mg / g), which is close to the level of natural aging for 4 years (tea red 2.77 mg / g, flavonoids 0.27 mg / g, antioxidant property 58.5 %, tea polyphenol 3.803 mg / g, amino acid 0.693 mg / g, soluble sugar 40.6 %, tea brown 7.91 mg / g), natural aging for 6 years (tea red 0.76 mg / g, flavonoids 0.297 mg / g, antioxidant property 65.1 %, tea polyphenol 3.603 mg / g, amino acid 0.64 mg / g, soluble sugar 21.7 %, tea brown 9.43 mg / g). In terms of sensory quality, the post-fermented tea prepared after fermentation of the Aspergillus corntus strain of the application shows similar quality characteristics to 4-year and 6-year naturally aged tea: the soup color changes from initial orange yellow to red thick and red brown; the aroma components are added with pleasant aged aroma, woody aroma and typical fungus flower aroma; in terms of biochemical components, with growth, metabolic activity and secretion of various extracellular enzymes of the Aspergillus corntus strain of the application, the changes of the contained substances in the post-fermented tea are promoted, the physicochemical components in the tea are degraded, polymerized and mutually transformed, thereby affecting the quality and active function of the post-fermented tea, and forming the unique quality of dark tea. The post-fermented tea prepared by fermentation of the Aspergillus corntus strain of the application can effectively avoid contamination of miscellaneous bacteria and shorten the fermentation period, realize similar material basis changes as natural aging in a relatively short time, and realize controllable quality of the post-fermented tea.

[0009] Preferably, the post-fermented tea comprises at least one of Liupao tea, Pu'er tea, green brick tea and Fuzhuan tea.

[0010] Preferably, the method for preparing the post-fermented tea comprises the following step: inoculating the Aspergillus corntus into rough tea for fermentation culture.

[0011] The term "rough tea" in the application refers to dry rough tea, i.e. without mixing with water.

[0012] Preferably, the Aspergillus corntus is inoculated into the rough tea for fermentation culture at an inoculation amount of 2.0x10 6 ~3.0x10 6 CFU / g of rough tea.

[0013] In the preparation of the post-fermented tea, the Aspergillus corntus is inoculated into the rough tea for fermentation culture at an inoculation amount of 2.0x10 6 ~3.0x10 6The inoculation amount of CFU / g of rough tea is inoculated into the rough tea for fermentation culture. Fermentation according to the inoculation amount in the range can optimize the synergistic effect of enzyme systems, accelerate the ripening process, and shorten the aging period. It can also build the dominant ecological niche of Aspergillus corntus, inhibit the pollution of miscellaneous bacteria, and ensure the controllability of the fermentation process. It can also promote the transformation of tea polyphenols and the synthesis of flavor substances, form characteristic aged aroma and mellow taste, improve the sensory quality of the finished tea, and have the dual benefits of quality improvement and efficiency increase.

[0014] Preferably, the Aspergillus corntus is inoculated into the rough tea by Aspergillus corntus activated bacteria liquid, and the concentration of the Aspergillus corntus activated bacteria liquid is (2.0 x 10 7 ~6 x 10 7 ) CFU / mL.

[0015] In the preparation of post-fermented tea, the concentration of the Aspergillus corntus activated bacteria liquid inoculated into the rough tea is (2.0 x 10 7 ~6 x 10 7 ) CFU / mL. Using the Aspergillus corntus activated bacteria liquid with this concentration range for fermentation can promote the rapid colonization of dominant Aspergillus corntus population, inhibit the pollution of miscellaneous bacteria, and ensure the stability of the microbial community during fermentation. It can also precisely regulate metabolic activity, accelerate the transformation of tea polyphenols and the synthesis of flavor substances, form characteristic aged aroma and mellow taste, and optimize the coordination of tea color and content, significantly improve the consistency of finished tea quality, and improve the controllability of the process.

[0016] Preferably, before fermentation culture, water is mixed with the rough tea, and the mass ratio of the water to the rough tea is 20-25%.

[0017] In the preparation of post-fermented tea, before fermentation culture, water is mixed with the rough tea, and the mass ratio of the water to the rough tea is controlled to be 20-25%. Controlling the fermentation moisture content in this range can build a suitable metabolic environment for Aspergillus corntus, promote the proliferation of dominant Aspergillus corntus population and efficient enzyme reaction, and accelerate the oxidation of tea polyphenols and the transformation of pigments. On the other hand, it can adjust the thermodynamic equilibrium of the stack, avoid local overheating or fermentation stagnation, and ensure the controllability of the fermentation process, thereby improving the uniformity of fermentation. The synergistic effect of the above two aspects improves the browning degree, mellow degree and aged aroma quality characteristics of the finished tea, and realizes the synergistic improvement of process stability and product palatability.

[0018] Preferably, the initial pH value of the fermentation culture is 5.5-6.5.

[0019] In the preparation of post-fermentation tea, the initial pH value of the fermentation culture is controlled to be 5.5-6.5, which can promote the rapid colonization and enzyme secretion of Aspergillus corntutus group, inhibit the risk of contamination of miscellaneous bacteria, accurately regulate the extracellular enzyme activity, optimize the key metabolic reaction rate of tea polyphenol oxidation and cellulose hydrolysis, and form a buffer system to maintain the stability of the fermentation process and avoid acidification out of control or metabolic arrest.

[0020] Preferably, the temperature of the fermentation culture is 25-28 DEG C.

[0021] In the preparation of post-fermentation tea, the temperature of the fermentation culture is controlled to be 25-28 DEG C, which can activate the metabolic activity of Aspergillus corntutus group, promote the synthesis and secretion of key enzymes such as polyphenol oxidase and cellulase, accelerate the conversion of tea polyphenol and cellulose hydrolysis, construct a thermodynamic equilibrium environment to inhibit the proliferation of miscellaneous bacteria and maintain the controllability of the fermentation process, regulate the accumulation rate of flavor precursor substances (such as soluble sugar and amino acid), significantly improve the fullness, aged aroma characteristics and color browning uniformity of the finished tea, and shorten the fermentation period, realizing the dual improvement of process efficiency and quality stability. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 It is a colony morphology diagram of Aspergillus corntutus.

[0023] Figure 2 It is a morphology diagram of Aspergillus corntutus under an optical microscope.

[0024] Figure 3 It is a DNA electrophoresis diagram of Aspergillus corntutus.

[0025] Figure 4 It is a phylogenetic tree diagram of Aspergillus corntutus.

[0026] Figure 5 It is a solid-state fermentation sample of Liupao tea fermented by Aspergillus corntutus at 7th day, 14th day, 21st day and 28th day, and the appearance, soup color and leaf bottom of Liupao tea naturally aged for 4 years and 6 years.

[0027] Figure 6 It is a standard curve diagram of glutamic acid.

[0028] Figure 7 It is a standard curve diagram of glucose.

[0029] Figure 8 It is a tea polyphenol content diagram of a solid-state fermentation sample of Liupao tea fermented by Aspergillus corntutus at 7th day, 14th day, 21st day and 28th day.

[0030] Figure 9Figure for flavonoids content of the solid-state fermentation sample of Liupu tea fermented by G. fimbriatum at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day.

[0031] Figure 10 Figure for amino acid content of the solid-state fermentation sample of Liupu tea fermented by G. fimbriatum at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day.

[0032] Figure 11 Figure for soluble sugar content of the solid-state fermentation sample of Liupu tea fermented by G. fimbriatum at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day.

[0033] Figure 12 Figure for the content of theaflavins, thearubigins and thearubigins of the solid-state fermentation sample of Liupu tea fermented by G. fimbriatum at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day.

[0034] Figure 13 Figure for DPPH free radical scavenging rate of the solid-state fermentation sample of Liupu tea fermented by G. fimbriatum at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day. DETAILED DESCRIPTION

[0035] In order to enable persons skilled in the art to better understand the technical solutions in the present application, the technical solutions of the present application will be clearly and completely described below in combination with the accompanying drawings of the embodiments and examples of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by persons skilled in the art without creative work should belong to the protection scope of the present application.

[0036] Embodiment 1 1. Preparation of potato dextrose agar (PDA) medium In the process of preparing the PDA medium, first, 200 g of potatoes are washed, peeled and cut into small pieces, added into 1000 mL of distilled water and boiled for 20-30 minutes until the potatoes become soft, then filtered with gauze or filter paper, the filtrate is retained and the residue is discarded, and distilled water is supplemented to 1000 mL. Next, 20 g of glucose and 15-20 g of agar are added into the potato extract, heated and continuously stirred until completely dissolved. Then, the prepared medium is divided into triangular flasks, sealed with cotton plugs and cow leather paper, placed into a high-pressure sterilization pot and sterilized at 121℃ for 20 minutes. After sterilization, the medium is cooled to 50-60℃ (warm to the touch but not hot to the hand), poured into culture dishes in a sterile operation table, about 15-20 mL per dish, and left to cool to solidification.

[0037] 2. Isolation and purification Weigh 10 g of Liupu tea (Qunqiu County group Liupu Maocha) test sample and cut into granules, transfer to a 250 mL sterile Erlenmeyer flask, add 90 mL sterile water, and place on a magnetic stirrer for 15 minutes to prepare 10 -1 times the initial bacterial suspension. In a sterile operating table, use stepwise dilution method to gradientize the bacterial suspension concentration: take 1 mL of 10 -1 times the liquid and inject it into a test tube containing 9 mL of sterile water and mix well, and continuously prepare 10 -2 to 10 -7 times serial dilutions in this way. Then, take 1 mL of each concentration gradient bacterial suspension and evenly spread it on the surface of potato dextrose agar (PDA) medium (3 parallel plates for each dilution), after completion, seal the culture dishes and place them in a 28°C incubator, and continue to culture for 7 days, observing and recording the colony growth characteristics, order of magnitude distribution and morphological differences of different dilution plates every day.

[0038] After the colonies grow, select colonies of different colors and shapes with a loop, pick the edge of the colony, and perform streak separation on fresh PDA plates. Place the streaked plates in a 28°C incubator for culture. Repeat the streak separation step several times until a single colony is obtained. Inoculate the purified colony into a new PDA plate, place it upside down, and store it in a 4°C refrigerator for subsequent experiments.

[0039] 3. Morphological characteristics Experimental method: Wipe the glass slide and cover glass with distilled water, dry and reserve, pick the mycelium of the strain onto the glass slide, add distilled water, cover with a cover glass, adjust the focus to clear, and observe the morphological characteristics of the mycelium under 400 to 1000 times magnification.

[0040] Results and analysis: Under the lens of the optical microscope ( Figure 2 ), the strain has rich branch and separation mycelium, with many branches in a net-like structure; the spores are round or oval, smooth in surface, and golden yellow or light yellow in color; the colony morphology is round or irregular, with a clear edge and small granular protrusions on the surface.

[0041] Inoculate the strain into PDA medium using the three-point method and grow for 7 days, as shown in Figure 1 (A is the front, a is the back), the strain colony is tight and relatively flat, round and velvety, with a golden yellow and green overall color, and a lighter color in the middle; the back of the colony is smooth and the color is the same as the front.

[0042] 4. Molecular biology identification 4.1 DNA extraction Single colonies isolated from Liupu tea were inoculated on fresh PDA medium and incubated at 28°C until the colonies matured. Subsequently, the colony surface was washed with sterile saline, spores were collected, and mycelium was scraped into a sterile collection tube. 2 mL of mycelial suspension was inoculated into PDA solid fermentation medium and incubated in a shaking incubator at 28°C and 200 rpm for 72 hours. After the incubation was completed, 1.5 mL centrifuge tubes were prepared, 50 μL of 50 mmol / L NaOH solution was added, and the mycelium was added to the centrifuge tube and ground with a sterile pipette to break the mycelium. The tube was sealed with a parafilm and placed in a microwave oven at 700 W for 120 seconds, and then immediately transferred to ice for rapid cooling. Centrifugation was performed at 12,000 rpm for 2 minutes, and 10 μL of supernatant was gently aspirated as a DNA template and stored at -20°C for later use.

[0043] 4.2 DNA electrophoresis detection Experimental method: 1 g of agarose powder and 100 mL of 0.5×TBE buffer were added to a conical flask, which was placed in a microwave oven to heat until the agarose was completely dissolved, forming a transparent and uniform solution. When the solution cooled to 50°C, 1.5 μL of GoldView™ DNA dye was added and thoroughly mixed. The mixture was poured into a gel plate and gently spread with a glass rod. After 30 minutes of standing, a 1.0% agarose gel was prepared. Then, the extracted DNA samples were added to the gel loading wells for electrophoresis separation. After electrophoresis, the results were observed by a gel imaging system. If the DNA band is clear and has no tailing phenomenon, it indicates that the DNA sample has high purity and sufficient quantity, and is suitable for subsequent PCR amplification experiments. Through the above steps, the quality of the DNA sample can be effectively evaluated, providing a reliable basis for subsequent experiments.

[0044] Results and analysis: The DNA electropherogram of the strain in this example (MARK between 1000 bp and 750 bp) is shown in Figure 3 As can be seen from Figure 3 , the DNA band in this example is clear and has no tailing phenomenon, indicating that the DNA sample has high purity and sufficient quantity, and is suitable for subsequent PCR amplification experiments.

[0045] 4.3 DNA sample PCR amplification Primers (purchased from Shanghai Lingyue Biological Technology Co., Ltd.): ITS1F: 5'-CTTGGTCATTTAGAGGAAGTAA-3'; ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0046] The PCR amplification reaction system is shown in Table 1 Table 1 PCR amplification reaction system

[0047] PCR amplification conditions are shown in Table 2 Table 2 PCR amplification conditions

[0048] 4.4 Verification and sequencing of PCR products Through 1.0% agarose gel electrophoresis and gel imaging system detection, a single DNA fragment with a size of less than 1000 bp was successfully obtained, which was preliminarily speculated to be the ITS (Internal Transcribed Spacer) sequence of the strain. The ITS sequence is a commonly used molecular marker in fungal classification and identification, which can effectively distinguish the species relationship of different strains due to its high inter-species variability and conservation. Subsequently, the PCR product was sent to Shengong Bioengineering (Guangzhou) Co., Ltd. for bidirectional sequencing, and the ITS rDNA sequence of the strain obtained by sequencing is shown as SEQ ID NO. 1. The measured ITS rDNA sequence of the strain was submitted to the NCBI database, BLAST analysis and comparison were performed, and the phylogenetic tree of the strain was constructed by using Mega11.0 software (Fig. 1) Figure 4 ), the similarity of the strain with Aspergillus cristatus reached 99.8%. Based on the morphological characteristics and the results of ITS rDNA sequence analysis, the strain was identified as Aspergillus coronatus (A. coronatus) Aspergillus cristatus ).

[0049] The ITS rDNA sequence (SEQ ID NO: 1) of the Aspergillus coronatus isolated in Example 1 is as follows: CTTTGGCAGTAGTTTATGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC The G. coronatum obtained in the above examples was sent to the China General Microbiological Culture Collection Center (address: No. 1, Beichen West Road, Hua-yuan District, Beijing) on May 28, 2025 for preservation, and was classified and named as: Aspergillus cristatus , and the preservation number was: CGMCC No. 41958.

[0050] Example 2 Growth analysis Experimental method: a sterile inoculation loop was used to pick the target colony, and a standard "three-line drawing method" was used to draw lines on a freshly prepared PDA plate. After drawing lines, the plate was inverted in a 28°C constant temperature incubator for culture. During the culture period, the growth condition of the colony was observed at regular time intervals every day, and the change of the colony diameter was estimated and recorded to evaluate the growth rate of the strain.

[0051] Results and analysis: the growth condition of G. coronatum is shown in Table 3 below.

[0052] Table 3 Growth condition of G. coronatum

[0053] From Table 3, the production of Aspergillus cristatus on PDA medium at 28°C, the first 2 days of growth, the mycelium is sparse, transparent or yellowish, close to the surface of the culture medium (creeping mycelium), and has not yet formed ascocarps; the third to fourth days, the mycelium grows vigorously, and a few ascocarps begin to appear in the central area, with yellow spots and yellowish edge mycelium; the fifth day, yellow-green spores appear, and the number of ascocarps increases, concentrated in the center; the sixth to seventh days, the culture medium locally turns yellow and brown, the ascocarps are densely covered in the center, and the whole culture medium turns yellow and brown, with aging mycelium. This growth process clearly presents the typical development process of Aspergillus cristatus from mycelial colonization, sporadic generation to metabolic aging.

[0054] Example 3 Preparation of Liupao tea by fermentation of Aspergillus cristatus (experimental group) S1. Preparation of bacterial suspension: select the Aspergillus candidus strain isolated in Example 1, and after the mature period of plate culture, add an appropriate amount of sterile physiological saline (0.85% NaCl) to the surface of the colony using sterile technique, and gently scrape the colony using a sterile coating rod to prepare a spore suspension. Transfer the obtained suspension to a sterile centrifuge tube and dilute it by 1:100. Then use a hemocytometer to count the spores, and the calculation formula is as follows: C = N x 5 x 10,000 x 100 Where C is the original bacterial liquid concentration (CFU / mL), N is the average number of spores under the unit field of view of the hemocytometer, 5 x 10 4 is the conversion factor of the hemocytometer, and 100 is the dilution multiple.

[0055] After calculation, the final concentration of Aspergillus candidus spore suspension is 1 x 10 7 CFU / mL. All operations are carried out in a biological safety cabinet under sterile conditions to prevent external contamination.

[0056] S2. Fermentation: weigh 30 g of Liupao tea and place it in a 250 mL triangular flask, sterilize at 121°C for 20 min, and cool for standby. Inoculate 6.0-9.0 mL of Aspergillus cristatus spore suspension with a concentration of 1 x 10 7 CFU / mL into the tea culture, adjust the moisture content (moisture content, water to tea mass ratio) to 25%, and the pH value to 5.5, and ferment in a 28°C incubator, shake the flask every 7 days during the fermentation, and take part of the tea for sensory quality evaluation and physicochemical property analysis, so that the tea sample is evenly fermented, and after 28 days, take out the sample, solidify it with microwave, and store it for standby. The experimental group sample is subjected to three repeated fermentations.

[0057] Preparation of the control group The preparation of the control group is the same as the above experimental groups except that the Aspergillus pilvorus suspension is replaced with an equal volume of sterile pure water (i.e. no Aspergillus pilvorus inoculation). The control group sample is fermented for 3 repetitions.

[0058] Example 4 Aging is an important link in the production process of Liupao tea and is also the last process to form the quality of Liupao tea. Based on the study of the key period of tea aging, it was found that the ingredient transformation in naturally aged tea for 4 years was initially stable, and the flavor substances in naturally aged tea for 6 years tended to mature, so the two years were selected for sensory quality evaluation and physicochemical property analysis to compare the characteristics of the aging stage.

[0059] Sensory quality analysis Experimental method: According to the evaluation method of black tea (loose tea) in GB / T 23776-2018 "Tea Sensory Evaluation Method", the sensory quality of naturally aged Liupao tea for 4 years and 6 years and Liupao tea fermented by Aspergillus pilvorus in Example 3 was evaluated. The sensory evaluation team consisted of 5 team members (2 men and 3 women) with professional tea evaluation qualifications, and the evaluation results were obtained using professional tea evaluation terminology.

[0060] Results and analysis: The solid-state fermentation samples of Liupao tea fermented by Aspergillus pilvorus in Example 3 at 4 time nodes, i.e. 7 days, 14 days, 21 days and 28 days, and the appearance, soup color and leaf bottom of naturally aged Liupao tea for 4 years and 6 years are shown in Table 1. Figure 5 The appearance of tea and the color of tea soup are one of the key characteristics that affect consumer acceptability and tea quality. The three pigments, i.e. theaflavins, thearubigins and theabrownins, have an important influence on the color, taste and leaf color of tea soup. As shown in Table 1, Aspergillus pilvorus inoculated solid-state fermentation can significantly improve the soup color, aroma and taste quality of Liupao tea at these 4 time nodes, and the color of tea and tea soup is deepened. The 4-year naturally aged tea soup is bright red-brown with high transparency, has a mild camphor aroma, a slight honey aroma, a smooth and sweet taste, and a long-lasting aftertaste. The 6-year naturally aged tea soup is deep red-brown to amber, has a strong oily feeling, a rich and mellow aroma, a medicinal aroma and a wood aroma, a faint incense aroma, a soft and smooth taste, a deep throat resonance, and a balance between sweetness and aging. Figure 5

[0061] ​Specifically, on the 7th day, the soup was orange and yellow, with a clear aroma of fungus flowers, a slightly astringent taste, and a slight sweetness; on the 14th day, the soup was orange and red, with a clear aroma of fungus flowers, a slight sweetness, a mellow taste, and an enhanced aftertaste; on the 21st day, the soup was red and brown, with a slight aroma of fungus flowers, a mellow and smooth taste, and a reduced astringent taste; and on the 28th day, the soup was dark brown, with a main aroma of fungus flowers and woody aroma, a mellow and sweet taste, and a clear aroma of fungus flowers. This shows that on the 28th day of fermentation, the tea soup color, aroma, and taste of the Liupu tea fermented by the A. crownii of Example 3 are close to the levels of the naturally aged Liupu tea for 4 years and 6 years.

[0062] Example 5 Physicochemical property analysis 1. Experimental method The tea polyphenols, flavonoids, amino acids, soluble sugars, tea pigments, and antioxidant activity of the Liupu tea fermented by the A. crownii of Example 3 on the 7th day, the 14th day, the 21st day, and the 28th day and the naturally aged Liupu tea for 4 years and 6 years were determined.

[0063] 1.1 Determination of tea polyphenol content 1.1.1 Preparation of sample The sample was ground and 0.2 g was taken into a 10 mL centrifuge tube, 5 mL of 70% methanol aqueous solution (70 °C) was added, and a glass rod was used to mix it very uniformly and wetly, then it was immediately immersed in a 70 °C hot water bath for 10 min (stir once in the middle), then it was allowed to cool to room temperature, poured into a centrifuge tube, and centrifuged at 3500 τ / min for 10 min. The upper liquid was poured into a 10 ml volumetric flask. The tea residue at the bottom was repeatedly extracted once more according to the above procedure, and the liquid was added to the first extraction liquid in the volumetric flask. Then 70% methanol aqueous solution was added to the mark, and shaken uniformly. Filtration was performed with a 0.45 μm filter membrane to obtain the mother liquor. 2 mL of the mother liquor was taken and placed in a 10 mL volumetric flask, and water was added to constant volume and shaken uniformly to obtain the sample solution.

[0064] 1.1.2 Determination of tea polyphenol content Preparation of phosphate buffer solution: 23.87 g of disodium hydrogen phosphate and 9.08 g of potassium dihydrogen phosphate were weighed and dissolved, respectively, and then transferred into 1 L volumetric flasks for constant volume. The two solutions were mixed to prepare a phosphate buffer solution with a pH of 7.5.

[0065] Preparation of ferrous tartrate solution: 0.1 g of ferrous sulfate heptahydrate and 0.5 g of potassium sodium tartrate tetrahydrate were weighed and mixed, dissolved with 50 ml of distilled water, and then transferred into a 100 ml volumetric flask for constant volume.

[0066] Accurately pipette 5 ml of each sample to be tested into a 25 ml volumetric flask. Then, add 4 ml of distilled water and 5 ml of ferrous tartrate solution to the flask. Dilute the mixture to the 25 ml mark with the buffer solution at pH 7.5, while setting the distilled water as the blank control group. Use a 1 cm cuvette to measure the absorbance (E) of each solution at 540 nm wavelength. Each experiment needs to be repeated three times in parallel. Calculate the content of tea polyphenols in the fermentation broth according to the following formula: Tea polyphenol content (mg / g) = (E x n x V) / m

[0067] E - absorbance of each solution measured at 540 nm wavelength n - dilution factor V - total volume of the mother liquor (mL) m - dry tea sample 1.2 Determination of flavonoid content Determination of flavonoid content - aluminum trichloride colorimetric method.

[0068] Accurately weigh 0.3 g of tea sample into a 50 mL volumetric flask. Add 30 mL of hot distilled water and shake gently to ensure the sample is fully soaked. Place the flask in a boiling water bath and heat for 45 minutes. Shake the sample every 10 minutes to ensure uniform heating and complete extraction. After the extraction is complete, remove the flask and cool it to room temperature. Filter the extract with filter paper and repeat the filtration three times to ensure the filtrate is clear and free of suspended particles. Transfer the filtrate to a 50 mL volumetric flask and dilute to the mark with distilled water. Shake well and set aside.

[0069] Accurately pipette 0.5 mL of the tea extract solution into a 10 mL volumetric flask. Add 1% aluminum trichloride solution to the flask and dilute to the 10 mL mark. Shake well to ensure complete mixing. Allow the solution to stand for 15 minutes to ensure complete reaction of the flavonoids with aluminum trichloride to form a yellow complex.

[0070] Use a 1 cm cuvette to measure the absorbance (A) of the sample solution at 420 nm wavelength. Use the 1% aluminum trichloride solution as a control and adjust the zero before measurement. Each sample needs to be measured three times in duplicate, and the average value is taken as the final absorbance value. Calculate the content of flavonoids in the tea extract solution using the following formula: Flavonoid content (mg / g) = (A x n x V) / m

[0071] A - absorbance of the sample solution measured at 420 nm wavelength V - total volume of the tea extract m - dry tea sample ​1.3 Determination of amino acid content Determination of amino acid content - ninhydrin colorimetry Preparation of glutamic acid standard curve: 100 mg of glutamic acid was accurately weighed and dissolved in 100 mL of distilled water to prepare a glutamic acid stock solution of 1 mg / mL. 0, 1.25 mL, 2.5 mL, 3.75 mL, 5 mL, 6.25 mL, and 7.5 mL of the glutamic acid stock solution were sequentially added to 25 mL volumetric flasks. Distilled water was added to the mark of 25 mL, and the mixture was shaken to obtain glutamic acid standard solutions with concentrations of 0, 50 μg / mL, 100 μg / mL, 150 μg / mL, 200 μg / mL, 250 μg / mL, and 300 μg / mL. 1 mL of each standard solution was accurately pipetted into a 25 mL volumetric flask, and 0.5 mL of phosphate buffer with a pH of 8.0 and 0.5 mL of 2% ninhydrin color reagent were added to each volumetric flask, which was shaken to mix. The mixture was heated in a boiling water bath for 15 minutes to complete the color reaction. After cooling to room temperature, distilled water was added to the mark of 25 mL, and the mixture was shaken to mix. The absorbance (A) of each standard solution was then measured at a wavelength of 570 nm using a 1 cm cuvette. The measurement was performed after zeroing with the 0 μg / mL standard solution (blank control). The standard curve was plotted with the glutamic acid concentration as the abscissa (μg / mL) and the absorbance as the ordinate (Fig. 1). Figure 6 The regression equation of the standard curve was y = 0.0936x + 0.0196, and the correlation coefficient was calculated to be 0.9999. .

[0072] Determination of amino acid content: The tea water ratio was 1:50 (w / v), and 0.5 mL of phosphate buffer with a pH of 8.0 and 0.5 mL of 2% ninhydrin color reagent were added, and the mixture was shaken to mix. After heating the mixture in a boiling water bath for 15 minutes to treat the sample, the absorbance (A) of the sample was measured according to the above method. Each sample was measured in triplicate, and the average value was taken. According to the absorbance value of the sample, the corresponding glutamic acid concentration (μg / mL) was found on the standard curve, and the amino acid content in the tea soup was calculated according to the following formula: Amino acid content (mg / mL) =

[0073] C - glutamic acid concentration (μg / mL) found from the standard curve V - total volume of the extract (mL) M - mass of the tea sample (g) 1.4 Determination of soluble sugar content Standard curve preparation: Accurately weigh 0.5 g of anhydrous glucose, then add distilled water until fully dissolved, and bring the volume to 500 ml to obtain a 1000 μg / mL glucose standard solution. Prepare working solutions of 0 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.6 mg / mL, 0.8 mg / mL, and 1.0 mg / mL using this glucose standard solution. Pipette 1 ml of each concentration of working solution into a centrifuge tube, add 4.0 mL of anthrone reagent, and mix well. Heat in a boiling water bath for 10 minutes, then cool to room temperature. Transfer the reaction solution to a separatory funnel, add 5.0 mL of ethyl acetate, and extract by shaking thoroughly. After standing and separating the layers, take the upper organic phase and measure the absorbance at a wavelength of 625 nm. Plot a standard curve with glucose concentration on the x-axis and absorbance on the y-axis. Figure 7 Through linear regression analysis, the regression equation for the standard curve was obtained as y = 2.98x + 0.0233, and the correlation coefficient was calculated. .

[0074] Determination of soluble sugar content: 0.01 g of tea leaves were placed in a mortar and ground with an appropriate amount of 80% ethanol until a homogeneous slurry was formed. The slurry was collected in a test tube, and the mortar was washed several times with a small amount of 80% ethanol. The resulting solution was poured into the test tube and then placed in an 80°C water bath for 30 minutes. After the liquid in the test tube cooled to room temperature, it was poured into a 10 ml graduated cylinder, and 80% ethanol was added to the 10 ml mark. The small tea leaves were filtered out to obtain a liquid containing the soluble sugars found in the Liubao tea sample, referred to as solution T. The absorbance of solution T was determined using a standard solution method.

[0075] Substitute the absorbance of solution T into the standard linear equation for glucose to calculate its soluble sugar concentration, and then calculate the soluble sugar content in the Liubao tea sample according to the formula: The formula is as follows: Soluble sugar content (%) = CV / W C – Glucose concentration (μg / mL) D – Sample extraction volume (mL) W – Sample weight (g) 1.5 Determination of tea pigment content Determination of tea pigments – Spectrophotometric colorimetric method Take 0.3 g of tea leaves into a 12.5 mL Erlenmeyer flask, add 12.5 mL of boiling water, and shake well. Heat in a boiling water bath for 10 min (shaking the flask once during the water bath), then remove and shake well. Filter while hot (do not wash the residue), and cool the filtrate to room temperature. Take 5 mL of the filtrate into a 10 mL separatory funnel, add 5 mL of ethyl acetate, shake for 5 min, and allow to separate into layers. The lower layer is taken as solution F, the middle emulsion layer is discarded, and the upper layer is taken as solution G.

[0076] Next, take 2 mL of solution G into a 25 mL volumetric flask and dilute to the mark with 95% ethanol to obtain solution A. In another separatory funnel of the same specifications, add 10 mL of 2.5% sodium bicarbonate aqueous solution, then add 4 mL of solution G, and shake for 5 minutes to allow the liquids to separate into layers. First, discard the lower layer, then pour the upper layer into an Erlenmeyer flask. Take 4 mL of the upper layer into a 25 mL volumetric flask and dilute to the mark with 95% ethanol to obtain solution C. In a 25 mL volumetric flask, add 2 mL each of solution F and saturated oxalic acid solution, then add 6 mL of distilled water and dilute to the mark with 95% ethanol to obtain solution D. In a separatory funnel of the same specifications, add 10 mL each of the test solution and n-butanol, then shake the separatory funnel by hand for 3 minutes to mix the two solutions thoroughly. After the solutions naturally separate into layers, take 2 mL each of the lower layer and saturated oxalic acid into a 25 mL volumetric flask, add 6 mL of distilled water, and dilute to the mark with 95% ethanol to obtain solution B.

[0077] Using 95% ethanol as a blank control, the absorbance of solutions A, B, C, and D was measured at a wavelength of 380 nm. After grinding the samples in a mortar, 3g (accurate to 0.001g) of the crushed sample was weighed using an analytical balance and placed into a pre-weighed round aluminum box, with three portions of each year's sample. The oven was preheated to 120℃, and the aluminum boxes were placed inside with the lids open. After drying for 2 hours, the aluminum boxes were removed with the lids closed and placed in a desiccator. Once cooled to room temperature, the boxes were weighed using an analytical balance, and the dry matter content and tea pigment content were calculated using the following formula: Dry matter percentage (%) = Weight of sample before drying / Weight of sample after drying Theaflavins (mg / g) C TFs =E c ×2.25×10 / Sample dry matter content Theabrownin (mg / g) C TBs =7.06×10×(2E A +2E D -E C -2E B ) / Sample dry matter content Thearubigin (mg / g) C TRs =2E B ×7.06×10 / Sample dry matter content 1.6 Determination of antioxidant activity Accurately weigh 0.3 g of tea sample into a 50 mL volumetric flask, add 30 mL of 50°C hot distilled water, and gently shake to ensure the sample is fully soaked. Place it in a boiling water bath for 45 minutes, shaking every 10 minutes to ensure uniform heating and complete extraction. After the extraction is complete, cool to room temperature, filter three times with filter paper to ensure the filtrate is clear and free of impurities. Transfer the filtrate to a 50 mL volumetric flask and dilute to the mark with distilled water, shake well and use as needed.

[0078] Accurately pipette 1.0 mL of the sample solution into a test tube, add 2.0 mL of 0.2 mmol / L DPPH (2,2-diphenyl-1-picrylhydrazyl) solution and 2.0 mL of methanol, shake well and avoid light for 15 minutes. Use distilled water as a blank control group, measure the absorbance at 517 nm using a UV-visible spectrophotometer, and record the absorbance of each group as A1 (sample) and A0 (blank). Set up 3 parallel experiments for each group, take the average value, and calculate the DPPH free radical scavenging rate: according to the formula, calculate the DPPH free radical scavenging capacity of the sample: DPPH free radical scavenging rate (%) = (1-A1 / A0) x 100% 2. Results and analysis Table 4 Physicochemical properties of naturally aged 4-year and 6-year Liupu tea

[0079] 2.1 Analysis of tea polyphenol determination results Tea polyphenols are a mixture of polyphenolic substances in tea leaves, and are the main representative substances in tea leaves. They are also one of the main sources of astringency in tea leaves. The content of tea polyphenols affects the formation of tea aroma and taste as well as the color of tea infusion. According to the test, the tea polyphenol content of naturally aged 4-year and 6-year tea was 3.803 mg / g and 3.603 mg / g, respectively. The tea polyphenol content of Liupu tea prepared by Aspergillus corntus fermentation at the 28th day of fermentation was 3.383 mg / g, which was similar to the values of 4-year (3.803 mg / g) and 6-year (3.603 mg / g) tea.

[0080] Figure 8 To use Aspergillus corntus to ferment Liupu tea at the 7th day, 14th day, 21st day, and 28th day, the tea polyphenol content chart of the solid-state fermentation sample is shown in Figure 8It can be seen that the tea polyphenol content of the solid-state fermentation sample of Liupao tea fermented by A. versicolor at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day was 3.541 mg / g, 4.037 mg / g, 4.233 mg / g and 3.383 mg / g, respectively. The tea polyphenol content of Liupao tea samples at different fermentation periods showed a trend of first increasing and then decreasing. The increase was because A. versicolor secreted cellulase, pectinase and other hydrolytic enzymes to decompose the cell wall and polysaccharide-polyphenol complex of tea, release the originally bound tea polyphenol (such as ester-type catechin or polyphenol combined with cellulose), and temporarily increase the detectable free polyphenol content. The decrease in the later period was due to the deep degradation of A. versicolor, which continuously utilized tea polyphenol as energy and decomposed it into , water or small molecule organic acid, resulting in irreversible decrease of content, or factors such as pH decrease (acid production by A. versicolor), hypoxic environment promoting non-enzymatic oxidation or chelation of polyphenols.

[0081] Therefore, the tea polyphenol content of Liupao tea prepared by fermentation with A. versicolor can reach the level of natural aging tea for 4 years or 6 years only after about 28 days of fermentation, which not only improves the soup color, aroma and taste of Liupao tea, but also greatly shortens the fermentation period.

[0082] 2.2 Analysis of determination results of flavonoid compounds Flavonoids are natural organic compounds existing in nature, have a soft astringent feeling, are an important influencing factor of tea quality, and are one of the contributors to the taste of tea, have good free radical scavenging ability, and are a kind of polyphenol with good antioxidant activity. The flavonoid content of natural aging tea for 4 years and 6 years was 0.27 mg / g and 0.297 mg / g, respectively. The flavonoid content of Liupao tea fermented by A. versicolor at the 21st day of fermentation was 0.315 mg / g, which was similar to that of natural aging tea for 4 years (0.27 mg / g) and 6 years (0.297 mg / g).

[0083] Figure 9 The flavonoid content chart of the solid-state fermentation sample of Liupao tea fermented by A. versicolor at the 4 time nodes of the 7th day, the 14th day, the 21st day and the 28th day is shown in the following figure: Figure 9It was found that the flavonoid content of Liubao tea fermented with Aspergillus cristatus at four time points (days 7, 14, 21, and 28) was 0.186 mg / g, 0.285 mg / g, 0.315 mg / g, and 0.304 mg / g, respectively. The flavonoid content in the tea samples showed an increasing trend with the increase in the fermentation cycle. This is because after the addition of Aspergillus cristatus, the fungus enters a rapid growth phase in the early stage of fermentation, with enhanced enzyme activity, resulting in the hydrolysis of a large amount of flavonoid glycosides into free flavonoids and the synthesis of new flavonoid derivatives. The growth rate slows down in the middle stage but still increases because some flavonoids are further oxidized or polymerized, while microbial metabolism continues to release new flavonoids. In the later stage, due to the reduction of substrate (such as tea polysaccharides), the microbial cells enter a period of decline, and metabolic activity decreases, thus stabilizing or slightly increasing.

[0084] Therefore, Liubao tea prepared by fermentation with Aspergillus cristatus only requires about 21 days of fermentation, and the content of flavonoids can reach the level of tea that has been naturally aged for 4 or 6 years. This not only improves the color, aroma and taste of Liubao tea, but also greatly shortens the fermentation cycle.

[0085] 2.3 Analysis of Amino Acid Determination Results Amino acids are important precursors for the formation of flavor and aroma in tea, and changes in their content directly affect the freshness and crispness of the tea. Tests showed that the amino acid content of naturally aged tea for 4 years and 6 years was 0.693 mg / g and 0.64 mg / g, respectively. Liubao tea prepared using Aspergillus cristatus fermentation had an amino acid content of 0.653 mg / g on the 28th day of fermentation, which is similar to the values ​​of naturally aged tea for 4 years (0.693 mg / g) and 6 years (0.64 mg / g).

[0086] Figure 10 The image shows the amino acid content of solid-state fermented Liubao tea samples at four time points: day 7, day 14, day 21, and day 28, fermented with Aspergillus cristatus. Figure 10 It was found that the amino acid content of solid-state fermented Liubao tea samples fermented with Aspergillus cristatus at four time points—day 7, day 14, day 21, and day 28—was 1.809 mg / g, 1.355 mg / g, 1.044 mg / g, and 0.653 mg / g, respectively. With prolonged fermentation time, the amino acid content in the tea samples at different fermentation stages showed a decreasing trend. This is partly because, after the addition of Aspergillus cristatus, the fungus utilizes the amino acids in the tea leaves as its nitrogen source during its growth and reproduction, resulting in a significant decrease in amino acid content. Furthermore, during the fermentation process of Liubao tea, changes in temperature and humidity cause amino acids to react with other polyphenols, generating pigments or undergoing Maillard reactions with sugars, further contributing to the decrease in amino acid content.

[0087] Therefore, the amino acid content of Liupu tea prepared by fermentation of Aspergillus corntus can be reduced to the level of 4-year and 6-year tea after about 28 days of fermentation, and the reduction of amino acid can not only generate more substances with rich and aged flavor (tea red, tea brown, etc.), forming the unique flavor of dark tea, but also greatly shorten the fermentation period.

[0088] 2.4 Analysis of the determination results of soluble sugar Soluble sugar is the main taste substance that presents sweet taste in tea soup, can alleviate the bitter taste of tea polyphenol substances and the stimulating effect of caffeine in tea soup, and is also an important precursor substance for forming tea aroma. The soluble sugar content of naturally aged 4-year and 6-year tea is 40.6% and 21.7%, respectively. The soluble sugar content of Liupu tea prepared by fermentation of Aspergillus corntus is 25.93% at the 28th day of fermentation, which is close to that of naturally aged 6-year tea (21.7%).

[0089] Figure 11 The soluble sugar content of the solid-state fermentation sample of Liupu tea prepared by fermentation of Aspergillus corntus at the 7th day, the 14th day, the 21st day and the 28th day is shown in the following figure: Figure 11 As can be seen from the figure, the soluble sugar content of the solid-state fermentation sample of Liupu tea prepared by fermentation of Aspergillus corntus at the 7th day, the 14th day, the 21st day and the 28th day is 34.01%, 42.39%, 28.56% and 25.93%, respectively. The soluble sugar content in Liupu tea samples at different fermentation periods shows a trend of first increasing and then decreasing. The increase in the early fermentation period is because Aspergillus corntus secretes hydrolytic enzymes such as cellulase and hemicellulase after being added, which decomposes insoluble polysaccharides (cellulose, pectin, etc.) in tea into soluble sugar. At the same time, pectin in tea cell wall is also dissolved in the wet heat environment and can be converted into soluble sugar. The decrease in the late fermentation period is because Aspergillus corntus metabolizes sugar as a carbon source, and sugar participates in Maillard reaction to generate flavor substances.

[0090] Therefore, the soluble sugar content of Liupu tea prepared by fermentation of Aspergillus corntus can reach the level of naturally aged 6-year tea after about 28 days of fermentation, which not only improves the color, aroma and taste of Liupu tea, but also greatly shortens the fermentation period.

[0091] 2.5 Analysis of the determination results of tea pigments Theaflavins (theaflavin, thearubigin, theabromine) are the main water-soluble oxidation products of polyphenols in dark tea, and are also important substances for the color and taste of tea soup. According to the test, the contents of theaflavins, thearubigin and theabromine in naturally aged Liupao tea for 4 years were 0.707 mg / g, 2.77 mg / g and 7.91 mg / g respectively, and the contents of theaflavins, thearubigin and theabromine in naturally aged Liupao tea for 6 years were 0.593 mg / g, 0.76 mg / g and 9.43 mg / g respectively. The thearubigin content of Liupao tea fermented by Aspergillus corntus was 3.282 (mg / g) at the 14th day of fermentation, and the theabromine content was 9.244 (mg / g) at the 28th day of fermentation, reaching the level of naturally aged tea for 4 years (thearubigin: 2.77 mg / g, theabromine: 7.91 mg / g) and 6 years (thearubigin: 0.76 mg / g, theabromine: 9.43 mg / g).

[0092] Figure 12 The theaflavins, thearubigin and theabromine contents of the solid-state fermentation samples of Liupao tea fermented by Aspergillus corntus at the 7th day, 14th day, 21st day and 28th day were plotted in a graph, as shown in Figure 12 As can be seen from the graph, the theaflavins contents of the solid-state fermentation samples of Liupao tea fermented by Aspergillus corntus at the 7th day, 14th day, 21st day and 28th day were 1.018 mg / g, 0.542 mg / g, 0.041 mg / g and 0.013 mg / g respectively; the thearubigin contents were 2.318 mg / g, 3.282 mg / g, 2.859 mg / g and 1.123 mg / g respectively; and the theabromine contents were 3.715 mg / g, 4.021 mg / g, 6.951 mg / g and 9.244 mg / g respectively. During the fermentation of Liupao tea, the theaflavins content gradually decreased because the extracellular enzymes (such as laccase and peroxidase) secreted by Aspergillus corntus further oxidized the theaflavins to thearubigin; the thearubigin content first increased and then decreased, the increase was mainly due to the conversion of theaflavins to thearubigin and the direct conversion of unoxidized catechins (such as EGCG) to thearubigin by microbial enzymes, and the decrease was mainly due to the further oxidation and polymerization of a part of thearubigin to theabromine; the theabromine content showed an upward trend, mainly because theabromine was the end product of theaflavins, thearubigin and catechins, and was stable in chemical properties and difficult to degrade, at the same time, Aspergillus corntus could synthesize theabromine-like substances through the polyketide synthase (PKS) pathway, and temperature and humidity could also accelerate the Maillard reaction to generate theabromine-like pigments.

[0093] Therefore, Liupao tea fermented by Aspergillus corntus only needs to be fermented for 14 days, and the thearubigin content can reach the level of naturally aged tea for 4 years and 6 years, and the theabromine content of naturally aged tea for 4 years and 6 years can be reached only by fermenting for 28 days, which not only improves the color, aroma and taste of Liupao tea, but also greatly shortens the fermentation period.

[0094] 2.6 Analysis of the results of the determination of antioxidant properties Antioxidant properties refer to the ability of active ingredients contained in tea to scavenge or inhibit free radicals (such as reactive oxygen species ROS, reactive nitrogen species RNS) and other oxidative factors, thereby protecting organisms from oxidative damage. Figure 13 The DPPH free radical scavenging rate of the solid-state fermentation sample of Liupao tea fermented by A. coronifera at the four time nodes of day 7, day 14, day 21 and day 28 is shown in the graph below. Figure 13 It can be seen that the DPPH free radical scavenging rate of the solid-state fermentation sample of Liupao tea fermented by A. coronifera at the four time nodes of day 7, day 14, day 21 and day 28 was 43.10%, 52.03%, 62.15% and 66.34%, respectively; and the DPPH free radical scavenging rate of tea naturally aged for 4 years and 6 years was 58.5% and 65.1%, respectively. The DPPH free radical scavenging rate of Liupao tea fermented by A. coronifera at day 21 was 62.15%, which was similar to that of tea naturally aged for 4 years (58.5%) and 6 years (65.1%).

[0095] The increase in DPPH free radical scavenging rate in the early stage was because tea polyphenols were strongly oxidized into theaflavins (TR) and theabrownins (TB), both of which have strong free radical scavenging capacity. The decrease in the later stage was because theabrownins were excessively polymerized into macromolecules, and some antioxidant active sites were covered, and at the same time, the Maillard reaction consumed reducing substances.

[0096] Therefore, Liupao tea prepared by fermentation with A. coronifera only needs to be fermented for 21 days, and the antioxidant activity can reach the level of tea aged for 4 years and 6 years, which not only improves the soup color, aroma and taste of Liupao tea, but also greatly shortens the fermentation period.

[0097] The above examples are only used to illustrate the technical solutions of the present application and not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. A strain of G. fimbriatum, characterized in that, The strain is named G. coronata LH-4G, and the preservation number is CGMCC No. 41958.

2. A bacterial agent for preparing a post-fermented tea, characterized in that, The microbial agent comprises the G. coronata according to claim 1.

3. Use of the G. coronata according to claim 1 in the preparation of post-fermented tea.

4. Use of Aspergillus awamori according to claim 3 for the preparation of a post- fermented tea, characterized in that, The post-fermented tea comprises at least one of Liupu tea, Pu'er tea, green brick tea, and Fuzhuan tea.

5. Use of Aspergillus awamori according to claim 3 for the preparation of a post-fermented tea, characterized in that, The method for preparing the post-fermented tea comprises the following steps: inoculating the G. coronata according to claim 1 into rough tea for fermentation culture.

6. Use of Aspergillus awamori according to claim 5 for the preparation of a post- fermented tea, characterized in that, The crown-shaped A. glaucus was inoculated at an inoculum of 2.0 x 10 6 ~3.0 x 10 6 CFU / g of paddy tea into the paddy tea for fermentation culture.

7. Use of the Conidiobolus coronatus according to claim 5 or 6 for the preparation of a post-fermented tea, characterized in that, The Aspergillus corallinus is inoculated into the hairy tea by an Aspergillus corallinus activated bacteria solution, the concentration of the Aspergillus corallinus activated bacteria solution is 2.0x10 7 6.0x10 7 CFU / mL.

8. Use of Aspergillus awamori according to claim 5 for the preparation of a post- fermented tea, characterized in that, Before the fermentation culture, water is mixed with the rough tea, and the mass ratio of the water to the rough tea is 20-25%.

9. Use of Aspergillus awamori according to claim 5 for the preparation of a post- fermented tea, characterized in that, The initial pH value of the fermentation culture is 5.5-6.

5.

10. Use of a strain of Conidiobolus coronatus according to claim 5, 8 or 9 for the preparation of a post-fermented tea, characterized in that, The temperature of the fermentation culture is 25-28℃.

Images