Eurotium amstelodami and application thereof

Abstract

The invention discloses Eurotium amstelodami, which is characterized in that the Eurotium amstelodami is named as Eurotium amstelodami LH-4C, the preservation number is CGMCC No.41959, the preservation date is May 28, 2025, and the preservation unit is China General Microbiological Culture Collection Center (CGMCC). According to the present invention, the eurotium amstelodami strain is adopted to ferment to prepare the dark tea, such that the bacterial contamination can be effectively avoided, the fermentation period can be shortened, the material basis change similar to the natural aging can be achieved within the relatively short time, and the quality of the dark tea can be controlled.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microbial fermentation, and particularly relates to a strain of Aspergillus amstelodami and application thereof. BACKGROUND

[0002] Black tea (such as Liupu tea, Pu'er tea, green brick tea, and Fuzhuan brick tea) belongs to post-fermented tea, and its unique quality is highly dependent on the continuous metabolic activities of environmental microorganisms during processing, aging, and storage. Unlike other teas that are sensitive to oxidation and humidity, black tea requires specific environmental conditions to achieve quality transformation through complex biochemical reactions driven by microorganisms. These microbial activities significantly affect the sensory quality (including appearance, liquor color, aroma, and taste) and chemical properties of black tea, and are the decisive factors of its quality characteristics.

[0003] However, the traditional black tea preparation process has significant shortcomings: on the one hand, the process is complex and time-consuming, usually requiring a natural aging period of several years to form specific flavors and qualities, resulting in low production efficiency; on the other hand, the aging process relies on a diverse microbial community whose activity is easily affected by environmental fluctuations (such as temperature and humidity), making it difficult to precisely control the metabolic processes and biochemical reactions triggered. The above factors result in poor quality stability of tea during the aging process, with issues such as poor sensory quality (such as aroma, taste, color) and large fluctuations in chemical properties, posing great challenges to standardized production and quality control of products. SUMMARY

[0004] To solve the above technical problems, the present application aims to provide a strain of Aspergillus amstelodami and its application to shorten the fermentation period of black tea while improving its quality.

[0005] The present application provides a strain of Aspergillus amstelodami, which is named Aspergillus amstelodami LH-4C, has a preservation number of CGMCC No. 41959, was preserved on May 28, 2025, and was preserved by the China General Microbiological Culture Collection Center.

[0006] The present application provides a microbial agent for preparing black tea, which comprises the Aspergillus amstelodami.

[0007] The present application provides the application of the Aspergillus amstelodami in the preparation of black tea.

[0008] The application provides application of the Amsterdam Emericella in preparation of black tea. The black tea fermented by the Amsterdam Emericella strain of the application can approach the level of tea naturally aged for 4 years (tea red 2.77 mg / g, flavonoids 0.27 mg / g, antioxidant property 58.5 %, tea polyphenol 3.803 mg / g, amino acid 0.693 mg / g, soluble sugar 40.6 %, tea brown 7.91 mg / g) or tea naturally aged for 6 years (tea red 0.76 mg / g, flavonoids 0.297 mg / g, antioxidant property 65.1 %, tea polyphenol 3.603 mg / g, amino acid 0.64 mg / g, soluble sugar 21.7 %, tea brown 9.43 mg / g) only after 28 days of fermentation (tea red 3.806 mg / g, flavonoids 0.255 mg / g, antioxidant property 71.9 %, tea polyphenol 3.275 mg / g, amino acid 1.081 mg / g, soluble sugar 27.93 % and tea brown 9.613 mg / g).

[0009] In terms of sensory quality, the black tea fermented by the Amsterdam Emericella strain of the application exhibits similar quality characteristics to 4-year or 6-year naturally aged tea: the soup color changes from initial orange yellow to red thick and red brown; the aroma components are additionally provided with pleasant aged aroma, woody aroma and typical mushroom flower aroma.

[0010] In terms of biochemical components, the growth, metabolic activity and secretion of various extracellular enzymes of the Amsterdam Emericella strain of the application can promote the change of the substances contained in the black tea, degrade, polymerize and mutually transform the physicochemical components in the tea leaves, and further affect the quality and active function of the black tea, so as to form the unique quality of the black tea.

[0011] The black tea fermented by the Amsterdam Emericella strain of the application can effectively avoid contamination of miscellaneous bacteria and shorten the fermentation period, and realize similar material basis change as natural aging in a relatively short time, and simultaneously realize controllable quality of the black tea.

[0012] Preferably, the black tea comprises at least one of Liupu tea, Fuzhuan tea, Pu'er tea and Qingzhuang tea.

[0013] Preferably, the method for preparing the black tea comprises the following step: inoculating the Amsterdam Emericella into rough tea for fermentation culture.

[0014] The term "rough tea" in the application refers to dry rough tea, i.e. not mixed with water.

[0015] Preferably, the Amsterdam Emericella is inoculated at 2.0x10 6 ~3.0x10 6The inoculation amount of CFU / g of rough tea is inoculated into the rough tea for fermentation culture.

[0016] In the preparation of dark tea, the Amsterdam Emericella is inoculated into the rough tea through the Amsterdam Emericella activated bacteria liquid, and the concentration of the Amsterdam Emericella activated bacteria liquid is controlled to be (2.0 x 10 6 ~ 3.0 x 10 6 The inoculation amount of CFU / g of rough tea is inoculated into the rough tea for fermentation culture, and fermentation is carried out according to the inoculation amount in the range, which can promote the rapid colonization of dominant Amsterdam Emericella, inhibit the reproduction of miscellaneous bacteria, ensure the stability of the fermentation system, accelerate biochemical reactions such as polyphenol oxidation and cellulose degradation, shorten the fermentation period, regulate enzyme activity, promote the conversion of flavor precursors, and improve the thickness and aged aroma quality of tea soup.

[0017] Preferably, the Amsterdam Emericella is inoculated into the rough tea through the Amsterdam Emericella activated bacteria liquid, and the concentration of the Amsterdam Emericella activated bacteria liquid is (2.0 x 10 7 ~ 6 x 10 7 ) CFU / mL.

[0018] In the preparation of dark tea, the Amsterdam Emericella is inoculated into the rough tea through the Amsterdam Emericella activated bacteria liquid, and the concentration of the Amsterdam Emericella activated bacteria liquid is controlled to be (2.0 x 10 7 ~ 6 x 10 7 ) CFU / mL, and fermentation is carried out using the Amsterdam Emericella activated bacteria liquid with the concentration in the range, which can promote the rapid colonization of dominant Amsterdam Emericella, inhibit the reproduction of miscellaneous bacteria, ensure the stability of the microbial community structure, accelerate enzyme secretion, balance the catalysis of tea polyphenol oxidation, polysaccharide degradation and protein hydrolysis, form a thick taste and unique flavor, regulate the dynamic balance of pile temperature and pH value, avoid local overheating or rancidity, improve fermentation uniformity, and ensure the consistency of the physicochemical indicators and sensory quality of the finished tea.

[0019] Preferably, before fermentation culture, water is mixed with the rough tea, and the mass ratio of the water to the rough tea is 20-25%.

[0020] In the preparation of dark tea, before fermentation culture, water is mixed with the rough tea, and the mass ratio of the water to the rough tea is controlled to be 20-25%, and the fermentation moisture content is controlled to be in the range, which can promote the growth and reproduction of Amsterdam Emericella and enzyme activity, accelerate the conversion of tea polyphenols and cellulose degradation, optimize the air permeability in the pile, avoid anaerobic environment caused by excessive water, reduce the production of undesirable flavors such as sour taste, and also adjust the stability of pile temperature to prevent local overheating or fermentation stagnation, so as to achieve a balance between efficient fermentation and quality formation.

[0021] Preferably, the initial pH value of the fermentation culture is 5.5-6.5.

[0022] This method controls the initial pH of fermentation culture to 5.5-6.5 during the preparation of dark tea. This provides a suitable growth environment for *Synthia serrata*, promoting its rapid proliferation and inhibiting other bacteria. It also regulates extracellular enzyme activity, accelerates the conversion of tea polyphenols and the degradation of cellulose, and improves fermentation efficiency. Furthermore, it maintains the acid-base balance within the pile, avoids excessive acidification that inhibits enzyme activity, ensures the stable formation of flavor substances, reduces the risk of spoilage, and guarantees product safety.

[0023] Preferably, the fermentation culture temperature is 25-28 ℃.

[0024] This method controls the fermentation temperature of black tea to 25-28 ℃. Fermentation within this temperature range can promote the active metabolism of *Synthia serrata*, accelerating key biochemical reactions such as tea polyphenol oxidation and protein hydrolysis; it can also maintain the optimal activity of enzymes, ensuring proper conversion of catechins and degradation of polysaccharides, resulting in a mellow taste and unique aged aroma; it can also inhibit the excessive growth of miscellaneous bacteria, reduce the risk of spoilage, ensure product safety, and achieve efficient and stable quality transformation. Attached Figure Description

[0025] Figure 1 This is a colony morphology diagram of *Isodon stenoptera*.

[0026] Figure 2 This is a morphological image of *Isodon stenoptera* under an optical microscope.

[0027] Figure 3 This is an electrophoresis image of DNA from *Isodon stenoptera*.

[0028] Figure 4 Phylogenetic tree diagram of *Isocystis Amsterdam*.

[0029] Figure 5 For Example 3, solid-state fermentation samples of Liubao tea fermented with *Isodon spp. Amsterdam* at four time points (day 7, day 14, day 21, and day 28) and Liubao tea naturally aged for 4 and 6 years were used, along with images of the appearance, liquor color, and leaf residue.

[0030] Figure 6 This is the standard curve for glutamic acid.

[0031] Figure 7 This is a standard curve for glucose.

[0032] Figure 8 The graph shows the polyphenol content of solid-state fermented Liubao tea at four time points: day 7, day 14, day 21, and day 28, fermented with *Synthia stenoptera*.

[0033] Figure 9The graph shows the flavonoid content of solid-state fermented Liubao tea at four time points: day 7, day 14, day 21, and day 28, fermented with *Synthia stenoptera*.

[0034] Figure 10 The image shows the amino acid content of solid-state fermented Liubao tea samples at four time points: day 7, day 14, day 21, and day 28, fermented with *Ispermum spp. Amsterdam*.

[0035] Figure 11 The graph shows the soluble sugar content of solid-state fermented Liubao tea at four time points: day 7, day 14, day 21, and day 28, using *Synthia stenoptera* fermentation.

[0036] Figure 12 The graph shows the content of theaflavins, thearubigins, and theabrownins in solid-state fermented Liubao tea at four time points: day 7, day 14, day 21, and day 28, fermented with *Ispermum spp. Amsterdam*.

[0037] Figure 13 The graph shows the DPPH free radical scavenging rate of solid-state fermented Liubao tea at four time points: day 7, day 14, day 21, and day 28, using *Synthia sacchariformis*. Detailed Implementation

[0038] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0039] Example 1 1. Preparation of Potato Dextrose Agar Solid (PDA) Medium In preparing PDA culture medium, firstly, wash, peel, and cut 200 g of potatoes into small pieces. Add them to 1000 mL of distilled water and boil for 20-30 minutes until the potatoes soften. Then filter the solution through gauze or filter paper, retaining the filtrate and discarding the residue. Add distilled water to bring the total volume to 1000 mL. Next, add 20 g of glucose and 15-20 g of agar to the potato extract, heat, and stir constantly until completely dissolved. Then, dispense the prepared culture medium into Erlenmeyer flasks, seal with cotton plugs and kraft paper, and autoclave at 121°C for 20 minutes. After sterilization, wait for the culture medium to cool to 50-60°C (warm but not hot to the touch). In a sterile environment, pour approximately 15-20 mL of the culture medium into petri dishes and allow to cool and solidify.

[0040] 2 Isolation and purification Weigh 10 g of Liubao tea (Qunli species Liubao raw tea in Cangwu County) test sample and cut into granules, transfer to a 250 mL sterile Erlenmeyer flask, add 90 mL sterile water, and place on a magnetic stirrer to prepare 10 -1 times the initial bacterial suspension. In a sterile operating table, the bacterial suspension was gradientized using a step-by-step dilution method: take 1 mL of 10 -1 times the liquid and inject it into a test tube containing 9 mL of sterile water and mix well, and continuously prepare 10 -2 to 10 -7 times serial dilutions in this way. Then, 1 mL of each concentration gradient bacterial suspension was taken and evenly spread on the surface of potato dextrose agar solid (PDA) medium (3 parallel plates for each dilution), after which the culture dishes were sealed and placed in a 28°C incubator for 7 days, during which time the colony growth characteristics, order of magnitude distribution, and morphological differences of the different dilutions were observed and recorded daily.

[0041] After the colonies grew, colonies with different colors and morphologies were selected and the edges of the colonies were picked up with a loop for streaking separation on fresh PDA plates. The streaked plates were incubated in a 28°C incubator. The streaking separation step was repeated multiple times until pure single colonies were obtained. The purified colonies were inoculated into new PDA plates, placed upside down, and stored in a 4°C refrigerator for subsequent experiments.

[0042] 3 Morphological characteristics Experimental method: The glass slide and cover glass were wiped with distilled water and dried for standby, the mycelium of the strain was picked onto the glass slide, distilled water was added dropwise, the cover glass was placed on top, the focus was adjusted to be clear, and the morphological characteristics of the mycelium were observed under a magnification of 400 to 1000 times.

[0043] Results and analysis: Under the lens of the optical microscope ( Figure 2 ), the mycelium had rich branches and septate mycelium, with many branches in a reticular structure; the spores were round or oval, smooth in surface, and golden yellow or light yellow in color; the colony morphology was round, with a clear edge and small granular protrusions on the surface.

[0044] The strain was inoculated on PDA medium using the three-point method and grown for 7 days, as shown in Figure 1 (B is the front, b is the back), the strain grew quickly on the PDA medium, with a round colony on the front, a light yellow center, a milk-white edge, a dense surface with a velvety texture, a radial expansion edge, and typical yellow-white radial ring characteristics. The back was a regular circle, with a deep yellow center, a milk-white edge, a dense surface with a velvety texture, and some colonies with yellow-white radial rings and weak radial expansion characteristics.

[0045] 4 Molecular biology identification 4.1 DNA extraction The single colony isolated from Liupu tea was inoculated on fresh PDA medium and incubated at 28°C until the colony matured. Then, the colony surface was washed with sterile normal saline, and spores were collected and mycelium was scraped into a sterile collection tube. 2 mL of mycelium suspension was inoculated into PDA solid fermentation medium and incubated in a shaking incubator at 28°C and 200 rpm for 72 hours. After the incubation was completed, 1.5 mL centrifuge tubes were added with 50 μL of 50 mmol / L NaOH solution, and the mycelium was added to the centrifuge tube and ground with a sterile pipette to break the mycelium. The tube was sealed with a sealing film and placed in a microwave oven at a power of 700 W for 120 seconds, and then immediately transferred to ice for rapid cooling. Centrifugation was performed at 12,000 rpm for 2 minutes, and 10 μL of supernatant was gently aspirated as a DNA template and stored at -20°C for later use.

[0046] 4.2 DNA electrophoresis detection Experimental method: 1 g of agarose powder and 100 mL of 0.5×TBE buffer were added to a conical flask, and the solution was heated in a microwave oven until the agarose was completely dissolved, forming a transparent and uniform solution. When the solution cooled to 50°C, 1.5 μL of GoldView™ DNA dye was added and thoroughly mixed. The mixed solution was poured into a gel plate and gently flattened with a glass rod. After standing for 30 minutes to allow the gel to completely solidify, a 1.0% agarose gel was prepared. Then, the extracted DNA sample was added to the gel loading well for electrophoresis separation. After electrophoresis, the results were observed by a gel imaging system. If the DNA band is clear and has no tailing phenomenon, it indicates that the DNA sample has high purity and sufficient quantity, and is suitable for subsequent PCR amplification experiments. Through the above steps, the quality of the DNA sample can be effectively evaluated, providing a reliable basis for subsequent experiments.

[0047] Results and analysis: The DNA electropherogram of the strain in this example (MARK between 1000 bp and 750 bp) is shown in Figure 3 As can be seen from Figure 3 , the DNA band in this example is clear and has no tailing phenomenon, indicating that the DNA sample has high purity and sufficient quantity, and is suitable for subsequent PCR amplification experiments.

[0048] 3.3 DNA sample PCR amplification Primer (purchased from Shanghai Lingyue Biological Technology Co., Ltd.): ITS1F: 5'-CTTGGTCATTTAGAGGAAGTAA-3'; ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0049] PCR amplification reaction system as shown in Table 1 Table 1 PCR amplification reaction system

[0050] PCR amplification conditions as shown in Table 2 Table 2 PCR amplification conditions

[0051] 4.4 Verification and sequencing of PCR product Through 1.0% agarose gel electrophoresis and gel imaging system detection, a single DNA fragment with a size of less than 1000 bp was successfully obtained, which was preliminarily speculated to be the ITS (Internal Transcribed Spacer) sequence of the strain. The ITS sequence is a commonly used molecular marker in fungal classification and identification, which can effectively distinguish the species relationship of different strains due to its high inter-species variability and conservation. Subsequently, the PCR product was sent to Shengong Bioengineering (Guangzhou) Co., Ltd. for bidirectional sequencing, and the ITS rDNA sequence of the strain obtained by sequencing is shown as SEQ ID NO. 1. The measured ITS rDNA sequence of the strain was submitted to the NCBI database, BLAST analysis and comparison were performed, and the phylogenetic tree of the strain was constructed by using Mega11.0 software (Fig. 1) Figure 4 ), the similarity of the strain with Aspergillus amstelodami reached 99%. Based on the morphological characteristics and the results of ITS rDNA sequence analysis, the strain was identified as E. amstelodami Aspergillus amstelodami ).

[0052] The ITS rDNA sequence (SEQ ID NO: 1) of the E. amstelodami isolated in Example 1 is as follows: CCTCTTTAGATGTTTTTCCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCT The Amsterdam Emericella obtained in the above examples was sent to the China General Microbiological Culture Collection Center (address: No. 1, Beichen West Road, Chaoyang District, Beijing) on May 28, 2025 for preservation, and was classified and named as: Aspergillus amstelodami , and the preservation number is: CGMCC No. 41959.

[0053] Example 2 Analysis of the growth of Amsterdam Emericella Experimental method: a sterile inoculation loop was used to pick the target colony, and a standard "three-line drawing method" was used to draw lines on a freshly prepared PDA plate. After drawing lines, the plate was inverted in a 28°C constant temperature incubator for culture. The growth condition of the colony was observed at regular intervals during the culture period, and the change of the colony diameter was estimated and recorded to evaluate the growth rate of the strain.

[0054] Results and analysis: the growth condition of Amsterdam Emericella is shown in the following table 3.

[0055] Table 3 Growth condition of Amsterdam Emericella

[0056] Table 3 shows the growth of *Ichthyophthirius medius* on PDA medium at 28 ℃. On days 1-2, white mycelia rapidly expanded into small, light yellow colonies, creeping along the surface of the medium without forming obvious spore structures. On days 3-4, the mycelia entered a vigorous growth phase, with colony diameters expanding to 1-2 cm. A bright yellow spore layer (the rudimentary form of cleistothecia) began to form in the central area, while the peripheral mycelia remained neat and velvety. On day 5, the spore layer covered the entire colony, deepening in color to dark brownish-yellow. The number of cleistothecia increased significantly and concentrated in the central area, becoming plump, and slight yellowing appeared in some parts of the medium. On days 6-7, the cleistothecia densely accumulated, the central area further darkened (brownish-black), the medium turned yellowish-brown overall (accumulation of metabolic products), the colonies dried, and the mycelia gradually aged and sank. This growth process reflects the typical life cycle of *Ichthyophthirius medius* from mycelial proliferation to spore maturation and eventual metabolic aging, and metabolic activity significantly affects the physicochemical properties of the medium (such as color). Meanwhile, the spores of *Isodon spp.* Amsterdam form early (color appears on the second day) and the colony spreads rapidly.

[0057] Example 3 Liubao tea was produced by fermentation with *Synthia stenoptera* (experimental group). Dark tea, a post-fermented tea, differs from the other five major tea categories in that bacteria and fungi continuously engage in physiological activities during its production, aging, and storage. For example, they can cause the tea leaves to develop golden-yellow granular "golden flowers" during fermentation, which not only alter the appearance of the tea leaves and the color of the tea liquor but also impart a unique flavor and taste, making dark tea "better with age." Hence the saying that dark tea is "suitable for long-term storage and becomes more fragrant with age." The following analysis uses Liubao tea, a type of dark tea, as an example to study and analyze the influence of the microbial strains described in this application on the fermentation of dark tea.

[0058] S1. Preparation of bacterial suspension: The *Arisaema Amsterdam* strain isolated in Example 1 was selected. After maturation on agar plates, an appropriate amount of sterile physiological saline (0.85% NaCl) was added to the surface of the colonies using aseptic techniques. The colonies were gently scraped off using a sterile spreader to prepare a spore suspension. The resulting suspension was transferred to sterile centrifuge tubes and diluted 1:100. Spores were then counted using a hemocytometer, calculated using the following formula: C = N × 5 × 10,000 × 100 Where C is the initial bacterial concentration (CFU / mL), and N is the average number of spores per unit field of view on the hemocytometer, 5 × 10⁻⁶. 4 100 represents the conversion factor for the hemocytometer, and 100 represents the dilution factor.

[0059] The final concentration obtained after calculation was 1×10⁻⁶. 7Amsterdam Emericella spore suspension at 1 x 105CFU / mL. All operations were carried out in a biological safety cabinet under sterile conditions to prevent exogenous contamination.

[0060] S2. Fermentation: 30 g of Liupao rough tea was weighed into a 250 mL flask, sterilized at 121 ℃ for 20 min, and cooled for standby. 6.0-9.0 mL of spore suspension at 1 x 105CFU / mL of Amsterdam Emericella was inoculated into the rough tea culture, and the fermentation moisture content (piling moisture content, the mass ratio of water to rough tea) was adjusted to 25%, pH 5.5, and fermented in a 28 ℃ incubator. During the fermentation, the flask was shaken every 7 days, and part of the tea was taken out for sensory quality evaluation and chemical property analysis to make the tea samples uniform. After 28 days, the tea samples were taken out, solidified by microwave, and stored for standby. The experimental group samples were fermented for 3 times. 7 Amsterdam Emericella spore suspension at 1 x 105CFU / mL was inoculated into the rough tea culture, and the fermentation moisture content (piling moisture content, the mass ratio of water to rough tea) was adjusted to 25%, pH 5.5, and fermented in a 28 ℃ incubator. During the fermentation, the flask was shaken every 7 days, and part of the tea was taken out for sensory quality evaluation and chemical property analysis to make the tea samples uniform. After 28 days, the tea samples were taken out, solidified by microwave, and stored for standby. The experimental group samples were fermented for 3 times.

[0061] Preparation of the control group The preparation of the control group was the same as the above experimental group except that the bacterial suspension was replaced with an equal volume of sterile pure water (i.e., without inoculation of Amsterdam Emericella). The control group samples were fermented for 3 times.

[0062] Example 4 Aging is an important link in the production process of Liupao tea and is also the last process to form the quality of Liupao tea. Based on the research on the key period of tea aging, it was found that the ingredient transformation in naturally aged tea for 4 years was initially stable, and the flavor substances in naturally aged tea for 6 years tended to be mature, so these two years were selected for sensory quality evaluation and chemical property analysis to compare the characteristics at different stages of aging.

[0063] Sensory quality analysis Experimental method: According to the evaluation method of black tea (loose tea) in GB / T 23776-2018 “Tea Sensory Evaluation Method”, the sensory quality of naturally aged Liupao tea for 4 years and 6 years and Liupao tea fermented by Amsterdam Emericella in Example 3 was evaluated. The sensory evaluation team consisted of 5 team members (2 men and 3 women) with professional tea evaluation qualifications, and the evaluation results were obtained using professional tea evaluation terms.

[0064] Results and analysis: The appearance, soup color and leaf bottom of the solid-state fermented tea samples of Example 3 at 4 time nodes of 7 days, 14 days, 21 days and 28 days and naturally aged Liupao tea for 4 years and 6 years were compared as shown in Table 1. Figure 5 The appearance of tea and the color of tea soup are one of the key features affecting consumer acceptability and tea quality. The three pigments of theabrownin, theaflavins and thearubigins have an important influence on the color, taste and leaf color of tea soup. Figure 5As shown, Amsterdam Emericella LH-4C inoculated solid state fermentation can significantly improve the soup color, aroma and taste quality of Liupu tea at these four time nodes, and the color of tea and tea soup is deepened. The tea soup of 4-year natural aging is bright red-brown, high transparency, with aged aroma plus camphorwood aroma, slightly sweet honey aroma, mellow and smooth taste, complete conversion of bitterness, long-lasting aftertaste; the tea soup of 6-year natural aging is deep red-brown to amber, strong oily feeling, with rich aged aroma, medicinal aroma and woody aroma, faint incense, soft and smooth taste, deep throat resonance, sweet and balanced with aged aroma.

[0065] Specifically, at the 7th day, the soup color is light orange yellow, with slight mildew aroma, slightly bitter taste, and weak fresh and crisp feeling; at the 14th day, the soup color is orange yellow to orange red, with obvious sweet aroma, weak mushroom aroma, enhanced sweet and smooth taste, and reduced bitterness; at the 21st day, the soup color is red-brown with yellow, with sweet aroma plus slight medicinal aroma, soft taste, but not as mellow as 4C; at the 28th day, the soup color is dark brown but lighter, with long-lasting sweet aroma, weak aged aroma, and outstanding sweet and smooth taste but insufficient aged aroma. Therefore, it is shown that at the 28th day of fermentation, the tea soup color, aroma and taste of Liupu tea fermented by Amsterdam Emericella in Example 3 are close to the level of 4-year and 6-year natural aging Liupu tea.

[0066] Chemical property analysis 1 Experimental method The tea polyphenols, flavonoids, amino acids, soluble sugars, tea pigments and antioxidant activity of the solid state fermentation samples of Liupu tea fermented by Amsterdam Emericella at the 7th day, 14th day, 21st day and 28th day in Example 3 and the 4-year and 6-year natural aging Liupu tea were determined respectively.

[0067] 1.1 Determination of tea polyphenol content 1.1.1 Preparation of sample Grind the sample and take 0.2 g into a 10 mL centrifuge tube, add 5 mL of 70% methanol aqueous solution (70 ℃), and mix it very uniformly and wetly using a glass rod, then immediately immerse it in a 70 ℃ hot water bath for 10 min (stir once in the middle), then let it cool to room temperature, pour into a centrifuge tube, and centrifuge at 3500τ / min for 10 min, pour the upper liquid into a 10 ml volumetric flask. Repeat the above steps to extract the tea leaf residue again, and add the liquid to the first extraction volumetric flask, then add 70% methanol aqueous solution to the mark, and shake uniformly, filter with a 0.45 μm filter membrane to obtain the mother liquor. Take 2 mL of the mother liquor into a 10 mL volumetric flask, add water to constant volume and shake well, which is the test solution.

[0068] 1.1.2 Determination of tea polyphenol content Preparation of phosphate buffer solution: Weigh 23.87 g of sodium phosphate dibasic and 9.08 g of potassium phosphate dibasic, dissolve them respectively and then pour them into 1 L volumetric flask, and then make up to volume. Then mix the two solutions to prepare phosphate buffer solution with pH 7.5.

[0069] Preparation of ferrous tartrate solution: Weigh 0.1 g of ferrous sulfate heptahydrate and 0.5 g of potassium sodium tartrate tetrahydrate, mix them, dissolve them in 50 ml of distilled water, and then pour them into a 100 ml volumetric flask and make up to volume.

[0070] Accurately take 5 ml of sample from each of the to-be-tested solutions and transfer it into a 25 ml volumetric flask. Then, add 4 ml of distilled water and 5 ml of ferrous tartrate solution into the volumetric flask. Use the buffer solution with pH 7.5 to make up to 25 ml scale line, and set the distilled water as blank control group. Use 1 cm optical path cuvette to measure the absorbance (E) of each solution at 540 nm wavelength. Each experiment needs to be repeated three times. Calculate the content of tea polyphenols in the fermentation broth according to the following formula: Content of tea polyphenols (mg / g) = (E x n x V) / m

[0071] E - absorbance of each solution measured at 540 nm wavelength n - dilution factor V - total volume of mother liquor (mL) m - dry tea sample 1.2 Determination of flavonoid content Determination of flavonoid content - aluminum chloride colorimetry.

[0072] Accurately weigh 0.3 g of tea sample and place it in a 50 mL volumetric flask. Add 30 mL of 50°C distilled water and shake gently to ensure the sample is fully soaked. Place the volumetric flask in a boiling water bath and heat for 45 minutes. Shake every 10 minutes during the heating process to ensure uniform heating and complete extraction. After the extraction is complete, remove the volumetric flask and cool it to room temperature. Filter the extract with filter paper and repeat the filtration three times to ensure the filtrate is clear and free of suspended solids. Transfer the filtrate to a 50 mL volumetric flask and make up to the scale line with distilled water, and shake well for later use.

[0073] Accurately take 0.5 mL of the above tea extract and place it in a 10 mL volumetric flask. Add 1% aluminum chloride (AlCl3) solution to the volumetric flask and make up to 10 mL scale line, and shake well. Let it stand for 15 minutes to allow the flavonoids to fully react with aluminum chloride to form a yellow complex.

[0074] ​The absorbance (A) of the sample solution was measured at 420 nm using a 1 cm cuvette. A 1% aluminum chloride solution was used as a control. Measurements were performed after zeroing the instrument. Each sample required three repeated measurements, and the average value was taken as the final absorbance value. The content of flavonoids in the tea extract was calculated using the following formula: Flavonoid content (mg / g) =

[0075] A—Measurement of absorbance of sample solution at a wavelength of 420 nm V – Total volume of tea soup m—Dried tea sample 1.3 Determination of amino acid content Determination of Amino Acid Content – ​​Ninhydrin Colorimetric Method Preparation of the amino acid standard curve: Accurately weigh 100 mg of glutamic acid and dissolve it in 100 mL of distilled water to prepare a 1 mg / mL glutamic acid stock solution. Add 0, 1.25 mL, 2.5 mL, 3.75 mL, 5 mL, 6.25 mL, and 7.5 mL of the glutamic acid stock solution sequentially to 25 mL volumetric flasks. Dilute to the 25 mL mark with distilled water and mix well to obtain glutamic acid standard solutions with concentrations of 0, 50 μg / mL, 100 μg / mL, 150 μg / mL, 200 μg / mL, 250 μg / mL, and 300 μg / mL. Accurately pipette 1 mL from each standard solution and add it to a 25 mL volumetric flask. Then add 0.5 mL of pH 8.0 phosphate buffer and 0.5 mL of 2% ninhydrin colorimetric reagent to each volumetric flask and mix well. Heat the mixture in a boiling water bath for 15 minutes to ensure complete colorimetric reaction. After removing the sample and cooling to room temperature, dilute to the 25 mL mark with distilled water and mix well. Then, using a 1 cm cuvette, measure the absorbance (A) of each standard solution at a wavelength of 570 nm. Zero the instrument with a 0 μg / mL standard solution (blank control) before measurement. Plot a standard curve with glutamate concentration on the x-axis (μg / mL) and absorbance on the y-axis. Figure 6 Through linear regression analysis, the regression equation for the standard curve was obtained as y = 0.0936x + 0.0196, and the correlation coefficient was calculated. .

[0076] Determination of amino acid content: tea water ratio 1:50 (w / v), add 0.5 mL pH 8.0 phosphate buffer and 0.5 mL 2% indantrione color developing agent, shake well. After heating the mixed solution in a boiling water bath for 15 minutes to treat the sample, the sample absorbance (A) is determined according to the above method. Each sample needs to be determined in triplicate, and the average value is taken. According to the absorbance value of the sample, the corresponding glutamic acid concentration (μg / mL) is found on the standard curve, and the following formula is used to calculate the amino acid content in the tea soup: Amino acid content (mg / mL) =

[0077] C - glutamic acid concentration (μg / mL) found from the standard curve V - total volume of the extract (mL) M - mass of tea sample (g) 1.4 Determination of soluble sugar content Standard curve preparation: accurately weigh 0.4 g of anhydrous glucose, then add distilled water to dissolve completely, and dilute to 500 ml to prepare a 1000 μg / mL glucose standard solution. Take the glucose standard solution to prepare glucose working solutions of 0 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.6 mg / mL, 0.8 mg / mL, and 1.0 mg / mL. Take 1 ml of each concentration of working solution into a centrifuge tube, add 4.0 mL of anthrone reagent, and mix well. Heat in a boiling water bath for 10 minutes, and cool to room temperature. Transfer the reaction solution to a separatory funnel, add 5.0 mL of ethyl acetate, and shake well to extract. After the layers are separated, take the upper organic phase, and measure the absorbance at 625 nm wavelength. Plot the standard curve (y = 2.98x + 0.0233) with glucose concentration as the abscissa and absorbance as the ordinate, and obtain the regression equation y = 2.98x + 0.0233 by linear regression analysis, and calculate the correlation coefficient Figure 7 .

[0078] Determination of soluble sugar content: take 0.01 grams of tea leaves and put them into a mortar, add an appropriate amount of 80% ethanol, and grind until a uniform slurry is formed. Collect the slurry into a test tube, and wash the mortar with a small amount of 80% ethanol several times. Pour the resulting solution into the test tube, and then perform a 80°C water bath for 30 minutes. After the temperature of the liquid in the test tube drops to room temperature, pour it into a 10 ml graduated cylinder, add 80% ethanol to the 10 ml mark, and filter the liquid to remove the small tea leaf debris. The resulting solution containing the soluble sugars in the Liupao tea sample is called solution T. The absorbance of solution T is detected using the standard solution method.

[0079] ​Substitute the absorbance of solution T into the standard linear equation of glucose to calculate the soluble sugar concentration, and then calculate the soluble sugar content in the Liupu tea sample according to the formula: The formula is as follows: Soluble sugar content (%) = CV / W C - Glucose concentration (μg / mL) D - Sample extraction liquid volume (mL) W - Sample weight (g) 1.5 Determination of tea pigment content Determination of tea pigment - spectrophotometric colorimetry Take 0.3 g of tea leaves in a 12.5 mL conical flask, add 12.5 mL of boiling water, shake well; boil in a water bath for 10 min (shake the flask once during the water bath period), remove and shake well; filter while hot (do not wash the residue with water), cool the filtrate to room temperature. Take 5 mL of the filtrate in a 10 mL separatory funnel, add 5 mL of ethyl acetate, shake for 5 min, let the liquid separate into layers, take the lower layer as solution F, discard the middle emulsion layer, and take the upper layer as solution G.

[0080] Next, take 2 mL of solution G in a 25 mL volumetric flask, and dilute to the calibration mark with 95% ethanol to obtain solution A. In another separatory funnel of the same size, add 10 mL of 2.5% sodium bicarbonate aqueous solution, then add 4 mL of solution G, shake for 5 min, and let the liquid separate into layers. First, remove the lower layer, then pour the upper layer into a triangular flask, take out 4 mL of the upper layer into a 25 mL volumetric flask, and dilute to the calibration mark with 95% ethanol to obtain solution C. In a 25 mL volumetric flask, add 2 mL of solution F and saturated oxalic acid solution, respectively, then add 6 mL of distilled water, and dilute to the calibration mark with 95% ethanol to obtain solution D. Then, in a separatory funnel of the same size, add 10 mL of the test solution and n-butanol, respectively, then shake the separatory funnel by hand for 3 min to mix the two solutions evenly. After the solution naturally separates into layers, take 2 mL of the lower layer and saturated oxalic acid into a 25 mL volumetric flask, add 6 mL of distilled water, and dilute to the calibration mark with 95% ethanol to obtain solution B.

[0081] Determine the absorbance of solutions A, B, C, and D at a wavelength of 380 nm with 95% ethanol as a blank. Grind the sample with a mortar, then weigh 3 g (accurate to 0.001 g) of the crushed sample with an analytical balance, and place it in a round aluminum box of known weight, with 3 replicates for each year's sample. Preheat the oven to 120°C, place the aluminum box in the oven with the lid open, and let it dry for 2 h. Then, close the lid and take it out, and place it in a desiccator until its temperature drops to room temperature. Weigh it with an analytical balance, and calculate the sample dry matter rate and tea pigment content according to the following formula: Dry matter rate (%) = sample weight before drying / sample weight after drying Theaflavins (mg / g) C TFs =E c ×2.25×10 / Sample dry matter content Theabrownin (mg / g) C TBs =7.06×10×(2E A +2E D -E C -2E B ) / Sample dry matter content Thearubigin (mg / g) C TRs =2E B ×7.06×10 / Sample dry matter content 1.6 Determination of antioxidant activity Accurately weigh 0.3 g of tea sample into a 50 mL volumetric flask, add 30 mL of 50 ℃ hot distilled water, and gently shake to fully moisten the sample. Extract in a boiling water bath for 45 min, shaking every 10 min to ensure uniform heating and complete extraction. After extraction, cool to room temperature and filter three times through filter paper to ensure the filtrate is clear and free of impurities. Transfer the filtrate to a 50 mL volumetric flask, dilute to the mark with distilled water, and shake well before use.

[0082] Accurately pipette 1.0 mL of the sample solution into a test tube, add 2.0 mL of 0.2 mmol / L LPPH (2,2-diphenyl-1-picrylhydrazyl) solution and 2.0 mL of methanol, shake to mix, and react in the dark for 15 min. Use distilled water as a blank control group. Measure the absorbance of each group at 517 nm using a UV-Vis spectrophotometer, and record them as A1 (sample) and A0 (blank), respectively. Perform three parallel experiments for each group, and take the average value to calculate the DPPH free radical scavenging rate. Calculate the DPPH free radical scavenging capacity of the sample according to the formula: DPPH free radical scavenging rate (%) = (1 - A1 / A0) × 100% 2 Results and Analysis Table 4 Chemical characteristics of Liubao tea aged naturally for 4 and 6 years

[0083] 2.1 Analysis of the results of tea polyphenol determination: Tea polyphenols is a mixture of polyphenols in tea, which is the main representative of tea and one of the main sources of astringency in tea. The content of tea polyphenols affects the formation of tea aroma and taste and tea color. The content of tea polyphenols in naturally aged tea for 4 years and 6 years is 3.803 mg / g and 3.603 mg / g respectively. The content of tea polyphenols in Liupu tea fermented by Amsterdam Emericella at the 28th day is 3.275 mg / g, which is similar to the values of naturally aged tea for 4 years (3.803 mg / g) and 6 years (3.603 mg / g).

[0084] Figure 8 The tea polyphenol content chart of solid-state fermentation samples of Liupu tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day is shown in the following figure: Figure 8 It can be seen that the tea polyphenol content of Liupu tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day is 3.91 mg / g, 4.16 mg / g, 4.08 mg / g and 3.275 mg / g respectively. The content of tea polyphenols in Liupu tea samples of different fermentation periods shows a trend of first rising and then falling. The rise is because the cellulase and pectinase secreted by Amsterdam Emericella hydrolyze the cell wall and polysaccharide-polyphenol complex in tea, releasing the originally bound tea polyphenols (such as ester-type catechins or polyphenols combined with cellulose), which temporarily increases the content of detectable free polyphenols. The decline in the later period is due to the deep degradation of Amsterdam Emericella, which continuously uses tea polyphenols as energy and completely decomposes them into , water or small molecular organic acids, resulting in irreversible decrease in content, or pH decrease (acid production by Amsterdam Emericella), hypoxic environment and other factors promoting non-enzymatic oxidation or chelation of polyphenols.

[0085] Therefore, the fermentation period of Liupu tea fermented by Amsterdam Emericella is only about 28 days, and the content of tea polyphenols can reach the level of naturally aged tea for 4 years and 6 years. This not only improves the color, aroma and taste of Liupu tea, but also greatly shortens the fermentation period.

[0086] 2.2 Analysis of determination results of flavonoids: Flavonoids are natural organic compounds in nature, with soft astringency, which is an important factor affecting the quality of tea, and one of the contributors to the taste of tea, with good free radical scavenging ability, and is a kind of polyphenol with good antioxidant activity. Through detection, the flavonoid content of natural aging 4 years and 6 years tea is 0.27 mg / g and 0.297 mg / g respectively. Amsterdam scattered capsule fermentation is used to prepare Liupu tea, and the flavonoid content of the fermentation sample at the 21st day is 0.276 mg / g, which is close to the values of natural aging 4 years (0.27 mg / g) and 6 years (0.297 mg / g) tea.

[0087] Figure 9 The flavonoid content chart of the solid-state fermentation sample of Liupu tea fermented by Amsterdam scattered capsule at the 7th day, the 14th day, the 21st day and the 28th day is shown in the following figure: Figure 9 It can be seen that the flavonoid content of the solid-state fermentation sample of Liupu tea fermented by Amsterdam scattered capsule at the 7th day, the 14th day, the 21st day and the 28th day is 0.206 mg / g, 0.255 mg / g, 0.276 mg / g and 0.283 mg / g respectively, and the flavonoid content in tea samples shows an upward trend with the increase of fermentation cycle days. This is because after the addition of Amsterdam scattered capsule, Amsterdam scattered capsule enters the rapid growth period in the early stage of fermentation, the enzyme activity is enhanced, a large amount of flavonoid glycosides is hydrolyzed into free flavonoids, and new flavonoid derivatives are synthesized. The increase in the middle period is due to the further oxidation or polymerization of part of the flavonoids, but the metabolism of microorganisms continues to release new flavonoids. In the later period, due to the decrease of substrate (such as tea polysaccharide), the bacteria enter the decline period, and the metabolic activity decreases, so it tends to be stable or slightly increased.

[0088] Therefore, the fermentation period of Liupu tea prepared by fermentation with Amsterdam scattered capsule is only about 21 days, and the flavonoid content can reach the level of natural aging 4 years and 6 years tea, which not only improves the soup color, aroma and taste of Liupu tea, but also greatly shortens the fermentation period.

[0089] 2.3 Analysis of the determination results of amino acids: Amino acids are important precursor substances for the formation of tea taste and aroma, and the increase and decrease of amino acid content has a direct impact on the formation of tea fresh taste. Through detection, the amino acid content of natural aging 4 years and 6 years tea is 0.693 mg / g and 0.64 mg / g respectively. Amsterdam scattered capsule fermentation is used to prepare Liupu tea, and the amino acid content at the 28th day of fermentation is 0.651 mg / g, which is close to the values of natural aging 4 years (0.693 mg / g) and 6 years (0.64 mg / g) tea.

[0090] Figure 10 The amino acid content chart of the solid-state fermentation samples of Liupao tea fermented by Amsterdam Emericella at the four time nodes of the 7th day, the 14th day, the 21st day and the 28th day is shown in the following table: Figure 10 It can be seen that the amino acid contents of the solid-state fermentation samples of Liupao tea fermented by Amsterdam Emericella at the four time nodes of the 7th day, the 14th day, the 21st day and the 28th day are 1.603 mg / g, 1.044 mg / g, 1.081 mg / g and 0.651 mg / g respectively. With the extension of fermentation time, the amino acid content in the tea samples of different fermentation periods of Liupao tea shows a downward trend. On the one hand, after the addition of Amsterdam Emericella, Amsterdam Emericella utilizes the amino acids in the tea as nitrogen source substances needed for its own growth and reproduction during the fermentation process, thereby causing a significant decrease in the amino acid content. On the other hand, due to the changes in temperature and humidity during the fermentation process of Liupao tea, the amino acids react with other polyphenolic substances to generate pigment substances or undergo Maillard reaction with sugar substances, thereby leading to a decrease in the amino acid content.

[0091] Therefore, the amino acid content of Liupao tea prepared by fermentation using Amsterdam Emericella can decrease to the level of 4-year and 6-year tea only after about 28 days of fermentation. The decrease in amino acid content not only generates more substances with rich and aged aroma (thebromine, theacrine, etc.) to form the unique flavor of dark tea, but also greatly shortens the fermentation period.

[0092] 2.4 Analysis of the determination results of soluble sugar: Soluble sugar is the main taste substance that presents sweetness in tea soup, can alleviate the bitter taste of tea polyphenols and the stimulating effect of caffeine in tea soup, and is also an important precursor substance for forming the aroma of tea leaves. It is detected that the soluble sugar contents of naturally aged 4-year and 6-year tea are 40.6% and 21.7% respectively. The soluble sugar contents of Liupao tea prepared by fermentation using Amsterdam Emericella at the 28th day of fermentation are 27.93%, which are close to the value of naturally aged 6-year tea (21.7%).

[0093] Figure 11 The soluble sugar content chart of the solid-state fermentation samples of Liupao tea fermented by Amsterdam Emericella at the four time nodes of the 7th day, the 14th day, the 21st day and the 28th day is shown in the following table: Figure 11It can be seen that the soluble sugar content of the solid-state fermentation sample of Liupao tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day was 31.21%, 41.31%, 32.12% and 27.93% respectively. The soluble sugar content in Liupao tea samples of different fermentation periods showed a trend of first increasing and then decreasing. The content increased in the early fermentation period because after the addition of Amsterdam Emericella, Amsterdam Emericella secreted cellulase, hemicellulase and other hydrolytic enzymes to decompose insoluble polysaccharides (cellulose, pectin, etc.) in tea into soluble sugars. Meanwhile, pectin in tea cell wall was also dissolved in a wet and hot environment and could be converted into soluble sugar. The content decreased in the later fermentation period because Amsterdam Emericella metabolized sugar as a carbon source, and sugar participated in Maillard reaction to generate flavor substances.

[0094] Therefore, the fermentation period of Liupao tea prepared by fermentation with Amsterdam Emericella can be shortened to about 28 days, and the soluble sugar content can reach the level of natural aging tea for 6 years. This not only improves the soup color, aroma and taste of Liupao tea, but also greatly shortens the fermentation period.

[0095] 2.5 Analysis of the determination results of tea pigments: Tea pigments (theaflavins, thearubigins and theabrownins) are the main water-soluble oxidation products of polyphenols in black tea and are also important substances for tea color and taste. The theaflavins, thearubigins and theabrownins contents of natural aging Liupao tea for 4 years were 0.707 mg / g, 2.77 mg / g and 7.91 mg / g respectively, and the theaflavins, thearubigins and theabrownins contents of natural aging Liupao tea for 6 years were 0.593 mg / g, 0.76 mg / g and 9.43 mg / g respectively. The thearubigin content of Liupao tea fermented by Amsterdam Emericella at the 14th day was 3.806 (mg / g), and the theabrownin content at the 28th day was 9.61 (mg / g), reaching the level of natural aging tea for 4 years (thearubigin: 2.77 mg / g, theabrownin: 7.91 mg / g) and 6 years (thearubigin: 0.76 mg / g, theabrownin: 9.43 mg / g).

[0096] Figure 12 The theaflavins, thearubigins and theabrownins contents of the solid-state fermentation sample of Liupao tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day are shown in the following figure: Figure 12It can be seen that the contents of theaflavins of the solid-state fermentation samples of Liupu tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day were 1.031 mg / g, 0.539 mg / g, 0.045 mg / g and 0.016 mg / g respectively; the contents of thearubigins were 2.022 mg / g, 3.806 mg / g, 1.763 mg / g and 1.407 mg / g respectively; and the contents of theabrownins were 4.14 mg / g, 6.10 mg / g, 9.02 mg / g and 9.61 mg / g respectively. During the fermentation of Liupu tea, the content of theaflavins gradually decreased because the extracellular enzymes (such as laccase and peroxidase) secreted by Amsterdam Emericella further oxidized theaflavins into thearubigins; the content of thearubigins first increased and then decreased, the increase was mainly due to the conversion of theaflavins into thearubigins and the direct conversion of unoxidized catechins (such as EGCG) into thearubigins by microbial enzymes, and the decrease was mainly due to the further oxidation and polymerization of a part of thearubigins into theabrownins; the content of theabrownins showed an increasing trend, which was mainly because theabrownins were the end products of theaflavins, thearubigins and catechins, and were stable in chemical properties and difficult to be degraded again. Meanwhile, Amsterdam Emericella could synthesize theabrownin-like substances through the polyketide synthase (PKS) pathway, and the temperature and humidity could also accelerate the Maillard reaction to generate theabrownin-like pigments.

[0097] Therefore, the fermentation of Liupu tea by Amsterdam Emericella only needs 14 days, and the content of thearubigins can reach the level of naturally aged tea for 4 years or 6 years. Theabrownins of naturally aged tea for 4 years or 6 years can be obtained only by fermenting for 28 days, which not only improves the soup color, aroma and taste of Liupu tea, but also greatly shortens the fermentation period.

[0098] 2.6 Analysis of the determination results of antioxidant properties: Antioxidant property refers to the ability of active ingredients contained in tea to scavenge or inhibit free radicals (such as reactive oxygen species ROS and reactive nitrogen species RNS) and other oxidative factors, thereby protecting the organism from oxidative damage. Figure 13 The DPPH free radical scavenging rate of the solid-state fermentation samples of Liupu tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day can be seen from the figure of DPPH free radical scavenging rate of the solid-state fermentation samples of Liupu tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day, Figure 13 It can be seen that the DPPH free radical scavenging rates of the solid-state fermentation samples of Liupu tea fermented by Amsterdam Emericella at the 7th day, the 14th day, the 21st day and the 28th day were 48.20%, 67.43%, 71.9% and 63.97% respectively; and the DPPH free radical scavenging rates of naturally aged tea for 4 years and 6 years were 58.5% and 65.1% respectively. The DPPH free radical scavenging rate of Liupu tea fermented by Amsterdam Emericella at the 28th day was 63.97%, which was close to the values of naturally aged tea for 4 years (58.5%) and 6 years (65.1%).

[0099] The DPPH radical scavenging rate continuously increases because flavonoid glycosides (such as quercetin-3-glucoside) are generated, the antioxidant activity is steadily enhanced, and volatile esters (such as phenethyl acetate) are synergistically generated to indirectly protect the active ingredients.

[0100] Therefore, the antioxidant activity of Liupu tea prepared by fermentation of Eurotium amstelodami can reach the level of tea aged for 4 or 6 years only after 21 days of fermentation, which not only improves the soup color, aroma and taste of Liupu tea, but also greatly shortens the fermentation period.

[0101] The above examples are only used to illustrate the technical solutions of the present application, but not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. An Aspergillus amstelodami strain characterized in that, named as Eurotium amstelodami LH-4C, and the preservation number is CGMCC No. 41959.

2. The inoculant for preparing black tea, characterized in that, The microbial agent comprises the Eurotium amstelodami as claimed in claim 1.

3. Use of the Eurotium amstelodami as claimed in claim 1 in the preparation of black tea.

4. Use of A. Amsterdamensis according to claim 3 for the preparation of black tea, characterized in that, The black tea comprises at least one of Liupu tea, Fuzhuan, Pu'er tea and Qingzhuang tea.

5. Use of A. amstelodami according to claim 3 for the preparation of black tea, characterized in that, The method for preparing the black tea comprises the following steps: inoculating the Eurotium amstelodami as claimed in claim 1 into rough tea for fermentation culture.

6. Use of A. Amsterdamensis according to claim 5 for the preparation of black tea, characterized in that, The said A. amstelodami was inoculated at an inoculum of 2.0 x 10 6 ~3.0 x 10 6 CFU / g of pique tea was inoculated into pique tea for fermentation culture.

7. Use of A. Amsterdamensis according to claim 5 or 6 for the preparation of a black tea, characterized in that, The E. amstelodami is inoculated into the hair tea by an E. amstelodami activated bacteria solution, a concentration of the E. amstelodami activated bacteria solution is 2.0×10 7 ~6×10 7 CFU / mL.

8. Use of A. Amsterdamensis according to claim 5 for the preparation of black tea, characterized in that, Before the fermentation culture, water is mixed with the rough tea, and the mass ratio of the water to the rough tea is 1:4-1:

5.

9. Use of A. Amsterdamensis according to claim 5 for the preparation of black tea, characterized in that, The initial pH value of the fermentation culture is 5.5-6.

5.

10. Use of A. Amsterdamensis according to claim 5, 8 or 9 for the preparation of a black tea, characterized in that, The temperature of the fermentation culture is 25-28℃.

Images