Aspergillus schermangii and application thereof
By introducing Aspergillus chevallis CGMCC No.42131 strain and utilizing multiple carbon sources for metabolism, the problem of monotonous flavor in dairy products and soy sauce fermentation was solved, achieving flavor diversity and improved nutritional value.
Patent Information
- Application Number
- CN202511406953.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-09-29
AI Technical Summary
Existing lactic acid bacteria strains produce fermentation products with a single flavor profile and lack complex flavor layers in dairy products and soy sauce fermentation, resulting in product homogenization and making it difficult to create a distinctive and memorable flavor profile.
A novel strain of Aspergillus chevalieri (CGMCC No. 42131) was used to metabolize the bacteria using multiple carbon sources, generating a variety of flavor compounds and improving the fermentation effect.
The application of Aspergillus chewasser has increased the flavor diversity of fermented dairy products and soy sauce, and enhanced the nutritional value and sensory experience of the products.
Smart Images

Figure CN120905041A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microorganisms, in particular to a strain of Aspergillus sydowi and its application. BACKGROUND
[0002] In the field of dairy product processing, lactic acid bacteria are often used to produce fermented dairy products such as yogurt and cheese. Lactic acid bacteria as the main starter for fermentation of dairy products have long occupied an important share of the global dairy product consumption market. However, the lactic acid bacteria strains currently used for large-scale production are mainly concentrated in a few classic strains such as Lactobacillus bulgaricus and Streptococcus thermophilus. These strains have been used in industry for decades and have advantages such as strong fermentation stability and controllable cost. However, their metabolic pathways are highly clear and the composition of flavor substances in their fermentation products tends to be fixed. Specifically, the flavor is mainly single lactic acid fermentation, supplemented by a small amount of added sugar or essence to form a sweet taste and fruit aroma, lacking the complex flavor levels produced by strain-specific metabolism. There are similar problems in the field of soy sauce fermentation.
[0003] Therefore, it is of great technical breakthrough value and industrial application prospect to develop a new strain that can be used for fermentation of dairy products or soy sauce. SUMMARY
[0004] The purpose of the present application is to overcome the above-mentioned problems existing in the prior art and provide a strain of Aspergillus sydowi and its application.
[0005] To achieve the above-mentioned purpose, the present application provides in a first aspect a strain of Aspergillus sydowi (Aspergillus sydowi) having a deposit number of CGMCC No.42131. Aspergillus chevalieri The present application provides in a second aspect a composition for preparing soy sauce koji, wherein the composition comprises koji material and the Aspergillus sydowi of the first aspect.
[0006] The present application provides in a third aspect a method for preparing soy sauce koji, wherein the method comprises inoculating the Aspergillus sydowi of the first aspect into koji material for culture, or inoculating the composition of the second aspect for culture.
[0007] The present application provides in a fourth aspect a method for brewing soy sauce, wherein the method comprises inoculating the soy sauce koji prepared by the method of the third aspect into soybean raw materials for fermentation.
[0008] The present application provides in a fifth aspect a method for fermenting yogurt or cheese, wherein the method comprises inoculating the Aspergillus sydowi of the first aspect into dairy product raw materials for dairy product fermentation.
[0009] The present application provides in a fifth aspect a method for fermenting yogurt or cheese, wherein the method comprises inoculating the Aspergillus sydowi of the first aspect into dairy product raw materials for dairy product fermentation.
[0010] The sixth aspect of the present application provides the use of the Aspergillus chevalieri according to the first aspect in the production of soy sauce, yogurt or cheese.
[0011] By the technical solution, the Aspergillus chevalieri with the preservation number of CGMCC No.42131 can be used for fermentation to prepare soy sauce or dairy products, and can improve the fermentation effect of the soy sauce or dairy products.
[0012] Biological preservation The strain provided by the present application is named Aspergillus chevalieri Aspergillus chevalieri , and was preserved in the China General Microbiological Culture Collection Center (CGMCC) on July 16, 2025, with the preservation number of CGMCC No.42131 and the preservation address of No.3, Beichen West Road, Yard 1, Chaoyang District, Beijing. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 is a colony morphology chart of the CCNH109 provided by the present application on a culture medium plate; Figure 2 is a microscopic morphology chart of the CCNH109 provided by the present application. DETAILED DESCRIPTION
[0014] The endpoints of the ranges and any values claimed herein are not to be construed as strictly limiting the exact range or value. Ranges can be expressed as from about one particular value to about another; however, when such a range is broader than about 10% of either of the preceding values, the broader range is often expressly recited. The ranges and / or individual values include and contemplate their entireties. For values which are less than one, one unit is considered to be 0.0001, 0.001, 0.01 or 0.1 as appropriate. For fractions, one unit is typically considered to be 1 / 64, 1 / 32, 1 / 16, 1 / 8, 1 / 4, 1 / 2 or 2 / 3 as appropriate. For percentages, one unit is typically considered to be 1%, 5%, 10%, 25%, 50%, 75%, 90%, 95% or 99% as appropriate. These are only examples of what is specifically contemplated by this application and are not intended to limit the application in any way.
[0015] The inventors of the present application isolated a strain of Aspergillus sydowii CCNH109 in the brewing process of Baijiu (Chinese liquor), and accidentally found that the Aspergillus sydowii CCNH109 has the performance of fermenting soy sauce or dairy products. Moreover, the Aspergillus sydowii CCNH109 provided in the present application can grow and metabolize with Tween 80, N-acetyl-beta-D-glucosamine, N-acetyl-beta-D-mannosamine, ribitol, aprin, D-arabinose, L-arabinose, D-arabitol, arbutin, D-cellobiose, dextrin, erythritol, D-fructose, D-galactose, gentiobiose, D-gluconic acid, D-glucosamine, alpha-D-glucose, alpha-D-glucose-1-phosphate, glycerol, glycogen, m-inositol, maltose, maltotriose, D-mannitol, D-lyxose, D-melibiose, alpha-methyl-D-galactoside, beta-methyl-D-galactoside, beta-methyl-D-glucoside, 6-O-D-glucopyranosyl-D-fructopyranose, D-psicose, D-raffinose, L-rhamnose, D-ribose, salicin, sedoheptulose, D-sorbitol, L-sorbitol, turanose, xylitol, D-xylose, gamma-aminobutyric acid, bromosuccinic acid, fumaric acid, D-methyl lactate, L-lactic acid, P-hydroxyphenylacetic acid, malic acid, succinamic acid, succinic acid, methyl succinate, methyl acyl-L-glutamic acid, L-aspartic acid, L-glutamic acid, glycolyl-L-glutamic acid, ornithine, sucrose, alpha-D-lactose, proline, pyroglutamic acid, L-serine, 2-aminoethanol, and L-alanine as carbon sources. Compared with conventional Aspergillus sydowii, the Aspergillus sydowii CCNH109 unexpectedly has the ability to utilize D-melibiose and cellobiose, so that the fermentation system is increased with fruit flavors such as higher alcohols (isopentanol, isobutanol, etc.), ethyl acetate, and acetaldehyde (green apple flavor). That is, the Aspergillus sydowii CCNH109 provided in the present application has a wide carbon source utilization spectrum and can generate various metabolic products, can effectively decompose complex sugars, produce more flavor substances, and improve the nutritional value of food.
[0016] Based on the above finding, the present application provides an Aspergillus sydowii in a first aspect Aspergillus chevalieri , and the preservation number of the Aspergillus sydowii is CGMCC No.42131.
[0017] In the present application, the "Aspergillus sydowii CCNH109", "strain CCNH109", and "CCNH109" all refer to the Aspergillus sydowii with the preservation number of CGMCC No.42131.
[0018] The present application provides a composition for preparing soy sauce koji in a second aspect, and the composition comprises koji material and the Aspergillus sydowii in the first aspect.
[0019] Preferably, the content of A. chevalieri is 0.1-1 wt% of the dry weight of the koji.
[0020] Preferably, the koji comprises bran and water.
[0021] The third aspect of the present application provides a method for preparing soy sauce koji, which comprises culturing the A. chevalieri of the first aspect in a koji, or culturing the composition of the second aspect.
[0022] Preferably, the temperature of the culturing is 25-35℃.
[0023] Preferably, the humidity of the culturing is 80-90%.
[0024] Preferably, the culturing time is 48-96 h.
[0025] According to the present application, the koji can be sterilized before culturing, and the sterilization method can be a method commonly used in the art, which is not described herein.
[0026] According to the present application, the koji can also be steamed before culturing, and according to a specific embodiment of the present application, the steaming method comprises steaming the koji at a temperature of 115-130℃ for 15-25 min.
[0027] The fourth aspect of the present application provides a method for brewing soy sauce, wherein the method comprises inoculating the soy sauce koji prepared by the method of the third aspect into soybean raw materials for fermentation.
[0028] The soybean raw materials can be prepared according to a method commonly used in the art, and according to some specific embodiments of the present application, the preparation method of the soybean raw materials comprises adding salt and water into the soybeans after soaking and steaming, wherein the amount of salt (sodium chloride) is 0.1-0.3 g and the amount of water is 1-3 g per 1 g of soybeans.
[0029] Preferably, the fermentation is carried out in the presence of salt, which can be a salt commonly used in the art, and according to a specific embodiment of the present application, the salt is sodium chloride.
[0030] Preferably, the temperature of the fermentation is 35-50℃.
[0031] Preferably, the fermentation time is 15-35 days.
[0032] According to the present application, the fermentation product can also be post-treated after fermentation, and the post-treatment method can be a method commonly used in the art, and according to a specific embodiment of the present application, the post-treatment method comprises adding brine into the fermentation product and heating.
[0033] The Aspergillus serrulata CCNH109 provided by this invention can be applied to fermented foods such as sauces (fermented broad bean paste, soybean paste, and wheat paste), fermented black beans, natto, fermented bean curd, and miso to enhance the flavor of fermented products.
[0034] The fifth aspect of the present invention provides a method for fermenting yogurt or cheese, the method comprising: inoculating the Aspergillus cheovalis described in the first aspect into dairy product raw materials for dairy product fermentation.
[0035] According to the present invention, the method for fermenting dairy products further includes: adding a compound bacteria to the dairy product raw materials, wherein the compound bacteria can be strains commonly used in fermented dairy products, and according to the present invention, the lactic acid bacteria can be *Lactobacillus plantarum* (…). Lactobacillus plantarum ), Lactococcus lactis ( Lactococcus lactis ) and Leuconostoc membranaceus ( Leuconostoc mesenteroides At least one of the following.
[0036] Preferably, the ratio of the number of viable bacteria of the compound bacteria to that of Aspergillus chevallaris CCNH109 (or the ratio of the number of viable bacteria to the number of spores) is 1:(0.5-2).
[0037] Preferably, the fermentation temperature is 35-45℃.
[0038] Preferably, the fermentation time is 1-50 h.
[0039] The sixth aspect of the present invention provides the use of Aspergillus chewasserus as described in the first aspect in the production of soy sauce, yogurt or cheese.
[0040] The present invention will be described in detail below through examples. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.
[0041] Reference strain: Aspergillus cheivae, CICC41680, purchased from China Industrial Microbial Culture Collection Center; Coronavirus ( Eurotium cristatum ), CGMCC No. 19604, recorded in CN113249233A; Shanghai-brewed 3.042 Aspergillus oryzae ( Aspergillus oryzae CICC2339 was purchased from the China Industrial Microbial Culture Collection Center.
[0042] Example 1 The inventors of this invention isolated a bacterial strain from a sample of fermented baijiu (Chinese liquor) and named it CCNH109. Figure 1 and Figure 2CCNH109 is a morphological chart, the colony is smooth with radial grooves, medium brown in the middle, light yellow around, with a silky texture, and is relatively thin. The Bt2a sequence of CCNH109 is shown as SEQ ID NO. 1, which has a similarity of 99.27% with the Bt2a sequence of A. chevaliet. Aspergillus chevalieri The morphology and Bt2a sequence prove that CCNH109 is A. chevaliet.
[0043] SEQ ID NO. 1: TGTCCGCTTTTAATAGAGTCAGATTGGGTGATATACTAACAGTATCACAGGCAGACTATCTCCGGCGAGCACGGTCTCGACGGCTCTGGTGTGTAAGTACAGTCGGGTCTCCGAGATGGACGCGTATCGGATATGGATATCTAAATGGATTGCAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGTTTGCCTAATTCATTCGTGTCTGTGTGGGAAACAGTTCTGACAGTGACAGGCCTCCAACAACAAATATGTCCCCCGTGCCGTCCTCGTCGACCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCGTCCCGATAACTTCGTTTTCGGTCAGTCCGGTGCCGGTAACAACTGGGCCAA Example 2 CCNH109 was cultured in a malt extract medium at 28°C to produce spores, and a spore suspension was prepared in a level II biological safety cabinet. The FF-IF inoculum was adjusted to 100% T (T is the turbidity value) on a turbidimeter, a cotton swab was soaked in clean inoculum, and the spores were adhered to the surface of the plate by rolling the cotton swab on the plate. The upper dry wall of the inoculum was repeatedly smeared with the cotton swab to disperse the spores, and then a uniform spore suspension was prepared by flushing down with the inoculum. The concentration of the bacterial suspension was accurately adjusted to 75% T with a deviation of 2% up and down. The prepared bacterial suspension was quickly poured into a V-shaped tank, and the bacterial suspension was inoculated onto the FF plate (100 μL per well) using a pipette. The identification plate was placed in a 28°C incubator for 4 days. After the incubation was completed, the results were detected using the MicrologTM 3 software in the BIOLOG instrument.
[0044] The results showed that CCNH109 could utilize Tween 80, N-acetyl-β-D-glucosamine, N-acetamide-β-D-mannitol, ribitol, apricotyl, D-arabinose, L-arabinose, D-arabinol, arbutin, D-cellobiose, dextrin, erythritol, D-fructose, D-galactose, gentiobiose, D-gluconic acid, D-glucosamine, α-D-glucose, α-D-glucose-1-phosphoside, glycerol, glycogen, m-cellulose alcohol, maltose, maltotriose, D-mannitol, D-mannose, D-mercaptotriose, α-methyl-D-galactoside, β-methyl-D-galactoside, β-methyl-D-glucosinolate, 6-OD-glucopyranoyl-D-fructofuranose, D-allulose, D-melatotriose, L-rhamnose, D-ribose, salicin, and sedum. Heptanal polysaccharides, D-sorbitol, L-sorbitol, mesobiose, xylitol, D-xylose, γ-aminobutyric acid, bromosuccinic acid, fumaric acid, D-methyl lactate, L-lactic acid, P-hydroxyphenylacetic acid, malic acid, succinic acid, succinic acid, methyl succinate, methyl methyl succinate, methyl acyl-L-glutamic acid, L-aspartic acid, L-glutamic acid, glycyl-L-glutamic acid, ornithine, sucrose, α-D-lactose, proline, pyroglutamic acid, L-serine, 2-aminoethanol, and L-alanine are used as carbon sources for growth and metabolism. However, CICC41584, mentioned in "Identification and Optimization of Culture Conditions of a Strain of *Cynotrophomonas* in Baijiu Daqu," cannot utilize D-melanotriose and cellobiose. The CCNH109 of this invention has a broad carbon source utilization spectrum and can generate a variety of metabolites. It can effectively decompose complex sugars, produce more flavor substances, increase the proportion of digestible sugars, and improve the nutritional value of food. The D-minotriose and cellobiose in it can add higher alcohols such as isoamyl alcohol and isobutanol to the fermentation system, as well as fruit flavors such as ethyl acetate and acetaldehyde (green apple flavor).
[0045] Example 3 CCNH109 was inoculated onto sterile wheat bran with a moisture content of 70 wt%, and the inoculation was repeated every 12 hours for 5 days. The spores were then dried at 35℃ to obtain spore powder, and the spore count was determined to be 10⁻⁶. 9 per g.
[0046] Preparation of soy sauce koji: Wheat bran with 45 wt% moisture content was steamed at 121℃ for 20 min, cooled to 30℃, and inoculated with CCNH109 spore powder at a rate of 0.3 wt%. The koji was cultured at 30℃ for 72 h, with the koji being turned once a day. After cultivation, it was dried at low temperature to obtain soy sauce koji. A control group inoculated with *Aspergillus oryzae* strain 3.042 was also included.
[0047] Lipase activity: 1 μmol of fatty acid produced per minute per gram of koji at 37 °C and pH 7.5 is defined as one enzyme unit. Lipase catalyzes the hydrolysis of oil ester into fatty acid, and the content of fatty acid is determined by copper soap method.
[0048] Glucosidase activity: 1 nmol of p-nitrophenol produced per minute per gram of koji at 37 °C and pH 5.0 is defined as one enzyme unit. α-Glucosidase decomposes p-nitrophenyl-α-D-glucopyranoside into p-nitrophenol, and β-glucosidase decomposes p-nitrophenyl-β-D-glucopyranoside into p-nitrophenol, which has a maximum absorption peak at 400 nm.
[0049] Amylase activity: The amount of enzyme required to produce 1 mg of reducing sugar from the catalytic hydrolysis of α-1,4-glucosidic bond in starch per minute per gram of koji at 4 °C and pH 5.2 is defined as one enzyme unit. Reducing sugar reduces 3,5-dinitrosalicylic acid to generate a brown-red substance. α-Amylase is not resistant to acid, and β-amylase is not resistant to heat. According to the above characteristics, the activity of another amylase can be determined after being inactivated at 70 °C for 15 min. The absorbance at 540 nm is detected.
[0050] Pectinase activity: 1 mg of galacturonic acid produced per hour per gram of koji at 50 °C and pH 3.5 is defined as one enzyme unit. Pectinase hydrolyzes pectin to generate galacturonic acid, which has a reducing aldehyde group and reacts with DNS reagent to generate a red-brown substance. The absorbance at 540 nm is detected by an enzyme marker or a visible spectrophotometer.
[0051] Ferulic acid esterase activity: 1 nmol of p-nitrophenol produced per minute per gram of koji at 40 °C and pH 6.0 is defined as one enzyme unit. Ferulic acid esterase catalyzes the decomposition of the substrate p-nitrophenyl ferulate to generate p-nitrophenol, which has a maximum absorption peak at 405 nm.
[0052] Tannase activity: The amount of enzyme required to hydrolyze 0.01 μmol of the substrate propyl gallate per minute per gram of koji at 40 °C and pH 5.0 is defined as one enzyme unit. The antioxidant propyl gallate is used as the substrate for tannase enzymatic reaction, and the absorbance at 270 nm is detected before and after the reaction.
[0053] Cellulase activity: The amount of enzyme required to produce 1 μg of reducing sugar from the catalytic hydrolysis of carboxymethylcellulose sodium per minute per gram of koji at 37 °C and pH 5.5 is defined as one enzyme unit. Anthrone colorimetry is used to determine the content of reducing sugar produced by the catalytic degradation of carboxymethylcellulose sodium by cellulase, and the absorbance at 620 nm is detected.
[0054] Glutaminase activity: 1 nmol of ammonia produced per minute per gram of koji at 37°C and pH 7.0 is defined as one enzyme activity unit. Glutaminase catalyzes the hydrolysis of glutamine into L-glutamic acid and ammonia, and the rate of increase in ammonia is detected by using the Nessler reagent to detect the absorbance at 420 nm.
[0055] Aminopeptidase activity: The aminopeptidase level in a sample is determined by using a double antibody sandwich method. A microplate is coated with a purified aminopeptidase antibody to form a solid-phase antibody. The koji is added to the microplate coated with the monoclonal antibody, and then combined with a HRP-labeled aminopeptidase antibody to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB is added to develop color. The TMB is converted into blue under the catalysis of HRP enzyme, and then into final yellow under the action of acid. The color intensity is positively correlated with the aminopeptidase in the sample. The absorbance at 450 nm is detected.
[0056] Protease activity: 1 nmol of tyrosine produced per minute per gram of koji at 30°C and neutral pH (pH 7.0) is defined as one enzyme activity unit. Protease hydrolyzes casein to produce tyrosine, which can reduce phosphomolybdic acid to form tungsten blue. Tungsten blue has a characteristic absorption peak at 680 nm.
[0057] Saccharifying enzyme activity: 1 mg of glucose produced per minute per gram of koji at 40°C and pH 4.6 is defined as one enzyme activity unit. Saccharifying enzyme hydrolyzes soluble starch to produce glucose, which forms a red-brown compound with 3,5-dinitrosalicylic acid. The color intensity of the reaction solution is positively correlated with the amount of glucose within a certain range.
[0058] The standard curve of the concentration of the decomposition product of the substrate related to the enzyme activity described above versus the absorbance value is established to determine the enzyme activity of the strain to be tested. The enzyme activity unit is nmol / (min x g of koji), and the results are shown in Table 1.
[0059] The enzyme activity of Aspergillus oryzae SHUJIAN 3.042 is taken as the reference (activity of 1), and the relative enzyme activity of CCNH109 indicates the enzyme activity multiple of SHUJIAN 3.042.
[0060] Table 1
[0061] After soaking and cooking soybeans, a low-salt solid-state fermentation process was adopted: NaCl aqueous solution (salt content 13.5wt%) was added, and the soybeans were soaked and cooked at a salt water weight ratio of 1:1.7. The mixture was placed in a constant temperature incubator, and the fermentation temperature was controlled within 40-55℃ for 25 days. The matured soy sauce mash was then placed in earthenware jars, and salt water (salt content 13.5wt%) was added in two batches for soaking and oil extraction. The mixture was then heated at 85±5℃ for 10 minutes to obtain the finished soy sauce. Finally, the characteristic chemical components were measured and sensory evaluation was performed.
[0062] The total acid content was determined according to GB12456—2021 "Determination of Total Acidity in Food"; The amino acid nitrogen content was determined according to GB5009.235—2016 (Determination of Amino Acid Nitrogen in Food); The total nitrogen content was determined according to the method for total nitrogen in GB5009.5—2016 "Determination of Protein in Food". The glutamic acid content was determined using a fully automated amino acid analyzer.
[0063] The results are shown in Table 2.
[0064] Table 2
[0065] The soy sauce brewed with CCNH109 is comparable to that brewed with Huniang 3.042 in terms of total acidity, amino acid nitrogen, total nitrogen, glutamic acid, and sensory evaluation. However, it has a higher total acidity than Huniang 3.042 and a better ester aroma.
[0066] Example 4 (a) Fermented Yogurt Fresh milk was treated at 90℃ for 15 min and inoculated with CCNH109 and the first compound lactic acid bacteria (Lactobacillus plantarum). Lactobacillus plantarum (CGMCC No. 15013, described in CN109423467A), the inoculation live bacteria / spore count was 10. 5 The mixture was stirred evenly at 42℃ for 4 h, with the fermentation time determined based on the curd state. After fermentation, the mixture was stored at 4℃ for 24 h to obtain the compound group. A control group without CCNH109 inoculant was set up. Sensory evaluation showed that, compared to the control group, the compound group enhanced the ester aroma, grassy aroma, and umami flavor of the yogurt. The 1-octen-3-ol content in the compound group, measured using headspace solid-phase microextraction-gas chromatography-mass spectrometry, reached 398 mg / kg, an increase of 895% compared to the control group. The physical properties of the compound group and the control group were tested, and the results are shown in Table 3.
[0067] Acidity test method: refer to GB 5009.239-2016 "Determination of food acidity of food safety national standard"; Yoghurt viscosity, stringiness, hardness test method: refer to Wu Xueyan. Correlation between sensory evaluation and texture of yoghurt [J]. China dairy industry, 2015, 43(10): 52-54. Method for evaluating yoghurt texture.
[0068] Table 3
[0069] (II) Fermented cheese Fresh whole milk was treated at 73℃ for 30 min, and after natural cooling, inoculated with second compound lactic acid bacteria (30 mg / L, FloraDanica starter, purchased from Kopenhagen, recorded in doi.org / 10.3389 / fnut.2021.649611), CCNH109 (10 5 Spores / mL), fermented at 32℃ for 1 h, then added rennet (addition amount was 0.1 g / L), 1.5 h later, the curd was cut into hazelnut size, stirred at 32℃ for 20 min, and then CCNH109 spores and curd were added into the mold (diameter 11 cm, height 11 cm) according to the following procedure: evenly spread 10 5 Spores-100 mL curd was added-uniformly spread 10 5 Spores-100 mL curd was added, and the above steps were repeated until the mold was filled. The fermentation temperature was 20℃, and the cheese was placed at 12 h without pressure, then the whey was removed, and then the cheese was salted at 20℃ for 24 h. Dried at 14℃, 70% humidity for 24 h, pierced, matured at 28℃ for 5 d, matured at 14℃ for 14 d, matured at 4℃ for 14 d, and the relative humidity was 85%. At the same time, a control group without adding CCNH109 inoculant was set. Sensory evaluation showed that compared with the control group, the compound group improved the grassy aroma, butter aroma and umami of the cheese. The content of 1-octen-3-ol in the compound group measured by headspace solid phase microextraction-gas chromatography-mass spectrometry was 691 mg / kg, which was increased by 340% compared with the control group. The cheese samples were evaluated by texture analyzer, using P / 50 probe, the speed before and after test was 5 mm / s, the test speed was 1 mm / s, and the test distance was 7 mm. According to the measurement results, the physical properties of the cheese samples prepared by the compound group and the control group were tested by the software provided by the instrument, and the physical properties of the cheese samples prepared by the compound group and the control group and the results are shown in Table 4.
[0070] Table 4
[0071] The preferred embodiments of the present application are described in detail above, but the present application is not limited thereto. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including that each technical feature is combined in any other suitable manner. These simple modifications and combinations should also be considered as disclosed by the present application and fall within the protection scope of the present application.
Claims
1. A strain of Aspergillus chevaleri ( Aspergillus chevalieri ), characterized in that, The Aspergillus chevalieri has a preservation number of CGMCC No. 42131.
2. A composition for preparing soy sauce koji, characterized by comprising, The composition comprises koji and the Aspergillus chevalieri of claim 1.
3. The composition of claim 2, wherein, The content of the Aspergillus chevalieri is 0.1-1wt% of the dry weight of the koji, based on the content of the spore powder of the Aspergillus chevalieri. And / or, the koji comprises bran and water.
4. A method for preparing soy sauce koji, characterized by, The method comprises culturing the Aspergillus chevalieri of claim 1 in koji, or culturing the composition of claim 2 or 3.
5. The production method according to claim 4, wherein, The temperature of the culturing is 25-35℃; And / or, the humidity of the culturing is 80-90%; And / or, the culturing time is 48-96h.
6. A method for brewing soy sauce, characterized by, The method comprises inoculating the soy sauce koji prepared by the method of claim 4 or 5 into soybean raw materials for fermentation.
7. The brewing method according to claim 6, wherein, The fermentation is carried out in the presence of salt. And / or, the temperature of the fermentation is 35-50℃; And / or, the time of the fermentation is 15-25 days.
8. A method of fermenting a yogurt or cheese, characterized in that, The method comprises inoculating the Aspergillus chevalieri of claim 1 into dairy raw materials for dairy fermentation.
9. The method of claim 8, wherein, The temperature of the dairy fermentation is 35-45℃; And / or, the time of the dairy fermentation is 1-50h.
10. The Aspergillus chevalieri of claim 1 is used in the production of soy sauce, yogurt or cheese.
Citation Information
Patent Citations
Lactobacillus plantarum capable of realizing high yield of lactic acid and application of the same to fields of food and feeds
CN109423467A
Eurotium cristatum, microbial inoculum and application of eurotium cristatum and microbial inoculum
CN113249233A
Eurotium chevalieri producing feruloyl esterase and application thereof in yeast for making hard liquor
CN109468232A
Compound microbial agent and application thereof in liquor yeast
CN117903969A
Aspergillus oryzae and application thereof
CN119979343A