Recombinant pichia pastoris strain for producing coupled and coproduced xylitol by NADPH (nicotinamide adenine dinucleotide phosphate) dependent growth and construction method thereof

Abstract

The invention relates to a recombinant pichia pastoris strain for producing coupled xylitol by NADPH (nicotinamide adenine dinucleotide phosphate) dependent growth and a construction method of the recombinant pichia pastoris strain, and belongs to the technical field of microbial fermentation. The recombinant pichia pastoris strain provided by the invention contains an NADPH dependent xylitol dehydrogenase gene, a sugar phosphatase gene, a D-arabinol-4-dehydrogenase gene, a fructose-1, 3, 4-triazole-1, 3, 4-triazole-1, 3-triazole-1, 3-triazole-1, 3-triazole-1, 3- The gene sequence is as follows: a 1, 6-diphosphatase gene, a phosphoketolase gene, a phosphate transacetylase gene, a glucose-6-phosphate dehydrogenase gene, a 6-phosphogluconolactonase gene, a 6-phosphogluconate dehydrogenase gene and a ribulose-5-phosphate epimerase gene; gene for expressing xylulokinase is knocked out or down-regulated: NADH dependent type xylitol dehydrogenase gene, ribose-5-phosphate isomerase gene, glutamate dehydrogenase gene, phosphofructokinase gene and phosphoglucose isomerase gene. The yield of xylitol produced by fermentation of the strain is far higher than that in the prior art.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a recombinant Pichia pastoris strain that produces xylitol through NADPH-dependent growth and its construction method. Background Technology

[0002] Xylitol is an important pentose sugar alcohol, first isolated from beech bark in 1890. It is readily soluble in water, has a cool, sweet taste, and a density of 1.52 g / cm³. 3 Xylitol has a melting point of 92-96℃ and a boiling point of 216℃, exhibiting excellent thermal stability. Its sweetness is similar to sucrose, but its calorie content is only 2.4 kcal / g. It also possesses excellent antimicrobial degradation properties and wide pH stability, making it suitable for long-term storage. Xylitol demonstrates outstanding performance in preventing tooth decay and not increasing blood sugar levels, leading to a growing global demand and its inclusion as one of the 12 value-added chemicals by the U.S. Department of Energy.

[0003] Currently, the industrial production of xylitol typically involves acid hydrolysis to reduce xylan in hemicellulose plant materials (such as birch and corn cobs) to D-xylose, followed by hydrogenation of D-xylose under high temperature and pressure using a catalyst to produce xylitol (e.g., Chinese invention patent: CN200910018483.7, A process for preparing xylitol; US invention patents: US4066711, Method for recovering xylitol; US3586537, Process for production of xylitol). However, this method relies on high temperature, high pressure, expensive metals, and toxic catalysts, resulting in high production costs, environmental unfriendliness, and high energy consumption. Furthermore, downstream processes require expensive chromatographic or recrystallization methods to purify D-xylose and remove byproducts. Although subsequent studies have attempted to improve the conversion rate using different metal catalysts, such as Du Hong et al.'s discovery that a single cobalt / SiO2 catalyst could achieve a 99% yield of xylose to xylitol under 150℃ and 5MPa hydrogen conditions (Du H et al. Xylitol Production from Xylose by Catalytic Hydrogenation over an Efficient Cu–Ni / SiO2Bimetallic Catalyst. ACSSustainable Chemistry & Engineering, 2023, 11(6):2115-26), chemical catalysis still suffers from high operating costs and poor environmental sustainability. Therefore, biocatalysis with milder reaction conditions has become a current research focus.

[0004] The operating conditions of biotransformation technology are often mild, which is a kind of green process. Similar to plants, some microorganisms have the ability to naturally produce xylitol, which is achieved by reducing xylose to xylitol through xylose reductase. In recent years, there have been a large number of reports on the use of xylose or biomass hydrolysate as raw material to ferment and synthesize xylitol (such as US patents: US20040191881, Fermentation process for production of xylitol from Pichia stipitis; US20110003356, Process for production of xylitol; US20130217070, Production of xylitol from a mixture of hemicellulosic sugars). Although it only needs one step to produce xylitol using xylose as carbon source, and can achieve very high conversion rate, but the cost of xylose is high and not environmentally friendly. At present, the production of industrial-grade xylose mainly uses chemical hydrolysis method. This method uses plant raw materials rich in polyhydric sugar (such as corn cob, bagasse, birch and cottonseed hulls) as substrate, and performs directional hydrolysis under the catalysis of sulfuric acid, followed by purification, crystallization and separation to obtain xylose. The operation process is relatively complex, and introduces chemical substances such as dilute sulfuric acid, which not only has high cost, but also is not environmentally friendly. Therefore, when using xylose or hemicellulose hydrolysate as raw material, this poses a major challenge to the realization of sustainable industrial-scale production of xylitol. Therefore, cost-effective and eco-friendly glucose has great potential as an alternative substrate for producing xylitol through "whole biofermentation method".

[0005] There are two pathways for the synthesis of xylitol from glucose. The first pathway is that glucose generates xylulose-5-phosphate (xylulose-5-P) through the pentose phosphate pathway, and then xylulose-5-phosphate is dephosphorylated by xylulokinase to form xylulose (D-xylulose), and then xylitol dehydrogenase is used to oxidize xylulose to form xylitol (xylitol). In addition, xylulose-5-phosphate (xylulose-5-P) can also be reduced to xyliyol-1-P, and then dephosphorylated to form xylitol (xylitol). Povelainen and Miasnikov et al. successfully expressed the xylitol phosphate dehydrogenase (XPDH) gene of Lactobacillus rhamnosus and Clostridium difficile in Bacillus subtilis. The recombinant Bacillus subtilis was fermented in a fermentation medium containing 100 g / L glucose for 300 hours, and 23±1.8 g / L xylitol was obtained (Povelainen M, Miasnikov AN. Production of xylitol by metabolically engineered strains of Bacillus subtilis. Journal of Biotechnology, 2007, 128(1): 24-31). The team of Xian Mo constructed five key enzyme genes ZWF, PGL, GND, RPE and XylA to realize the synthesis of xylose in Escherichia coli, and then replaced the endogenous xylulokinase encoded by XylB with AraL from Bacillus subtilis, and finally introduced the Xyl1 gene to realize the de novo biosynthesis of xylitol. The yield reached 9.5 mg / L in a fermentation medium containing 20 g / L glucose (Yin W et al. Metabolic Engineering of E. coli for Xylose Production from Glucose as the Sole Carbon Source. ACS Synthetic Biology, 2021, 10(9): 2266-75). This method has a long fermentation process, low yield, and the need to add antibiotics, which limits the practical application of this method.

[0006] Another approach is to synthesize through D-arabinol, using glucose to ferment first to form D-arabinol, and then D-arabinol-4-dehydrogenase to convert it to xylulose, and then xylitol dehydrogenase catalytic reduction to xylitol. Cheng Hai et al. expressed arabinol dehydrogenase gene (DalD) and xylitol dehydrogenase gene (XDH) in Pichia pastoris, constructed a recombinant strain Pichia pastoris GS225, which can convert glucose to xylitol, the highest yield reached 0.078g xylitol / g glucose, productivity was 0.29g / L / h (Cheng H, Lv J, Wang H, et al. Genetically engineered Pichia pastoris yeast for conversion of glucose to xylitol by a single-fermentation process. Applied Microbiology and Biotechnology, 2014, 98(8):3539-52).

[0007] There is a strong phosphopentose pathway metabolism in Pichia pastoris, and it can generate D-arabinol, so the two xylitol synthesis pathways shown above can be used.

[0008] The currently reported xylitol synthesis strains are usually expressing NADH-dependent xylitol dehydrogenase in the strain, however, the phosphopentose pathway will lead to the generation of a large amount of NADPH, resulting in the imbalance of coenzyme, there is no report of using NADPH-dependent xylitol dehydrogenase expression, and its expression effect in Pichia pastoris is not clear. SUMMARY

[0009] In view of the problems existing in the prior art, in order to solve the problem of imbalance of traditional NADH-dependent xylitol production, the purpose of the present application is to design and provide a Pichia pastoris strain capable of expressing NADPH-dependent xylitol dehydrogenase for producing xylitol, so as to realize the balance of coenzyme and the coupling of xylitol growth and production. The present application is to use Pichia pastoris as a chassis microorganism, through metabolic engineering, genetic engineering and synthetic biology means, to construct a method of recombinant Pichia pastoris which can ferment and synthesize xylitol using one or several carbon sources such as glucose, glycerol and methanol.

[0010] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0011] In one aspect, the present application provides a recombinant Pichia pastoris strain for NADPH-dependent growth-coupled production of xylitol, comprising a modified strain obtained by any one of the following genetic modifications or a combination of multiple genetic modifications on a chassis microorganism:

[0012] (1) expressing or overexpressing a NADPH-dependent xylitol dehydrogenase gene; (obtaining the function of reducing xylulose to xylitol)

[0013] (2) expressing or overexpressing a sugar phosphatase gene;

[0014] (3) expressing or overexpressing a D-arabinitol 4-dehydrogenase gene; (obtaining the ability to convert D-arabinitol into xylulose)

[0015] (4) expressing or overexpressing a Fructose-1,6-bisphosphatase gene; (hydrolyzing Fructose 1,6-bisphosphate into Fructose 6-phosphate)

[0016] (5) expressing or overexpressing a Phosphoketolase gene; (obtaining the ability to cleave xylulose-5-phosphate and Fructose-6-phosphate to generate acetyl phosphate and glyceraldehyde-3-phosphate)

[0017] (6) expressing or overexpressing a Phosphotransacetylase gene; (obtaining the ability to interconvert between acetyl phosphate and acetyl-CoA)

[0018] (7) expressing or overexpressing a Glucose-6-phosphate dehydrogenase gene; (obtaining the ability to catalyze the oxidation of glucose-6-phosphate (G6P) to 6-phosphogluconate-δ-lactone)

[0019] (8) expressing or overexpressing a 6-Phosphogluconolactonase gene; (obtaining the ability to catalyze the hydrolysis of 6-phosphogluconate-δ-lactone to 6-phosphogluconate)

[0020] (9) expressing or overexpressing a 6-Phosphogluconate dehydrogenase gene; (obtaining the ability to catalyze the oxidative decarboxylation of 6-phosphogluconate to ribulose-5-phosphate)

[0021] (10) Express or overexpress the Ribulose-5-phosphate epimerase gene; (obtain the ability to catalyze the epimerization of ribulose-5-phosphate (Ru5P) to xylulose-5-phosphate)

[0022] (11) Knock out or down-regulate the gene expressing xylulose kinase; (knock out to lose the ability to phosphorylate xylulose to xylulose-5-phosphate)

[0023] (12) Knock out or down-regulate the gene expressing NADH-dependent xylitol dehydrogenase; (knock out to lose the ability to reduce xylulose to xylitol using NADH)

[0024] (13) Knock out or down-regulate the gene expressing Ribose-5-phosphate isomerase; (knock out to lose the ability to catalyze the interconversion between ribose-5-phosphate and ribulose-5-phosphate)

[0025] (14) Knock out or down-regulate the gene expressing glutamate dehydrogenase; (knock out to reduce the generation of NADH and increase the generation of NADPH)

[0026] (15) Knock out or down-regulate the gene expressing phosphofructokinase; (knock out to lose the ability to convert fructose-6-phosphate to fructose-1,6-bisphosphate)

[0027] (16) Knock out or down-regulate the gene expressing phosphoglucose isomerase; (knock out to lose the ability to isomerize glucose-6-phosphate to fructose-6-phosphate

[0028] Wherein, "knock out or down-regulate expression" means to lose or weaken the corresponding function; "expression" means to obtain the corresponding function.

[0029] The NADPH-dependent growth production coupling xylitol-producing recombinant Pichia pastoris strain, the chassis microorganism is Pichia pastoris strain.

[0030] The NADPH-dependent growth production coupling xylitol-producing recombinant Pichia pastoris strain, the construction method of the Pichia pastoris strain is: the wild type strain GS115 Pichia pastoris is subjected to Ku70 gene knockout, and the Rad52 gene is overexpressed at the site, to obtain the starting strain GSY002.

[0031] The nucleic acid sequence of the NADPH-dependent xylitol dehydrogenase gene is shown as SEQ ID NO. 1.

[0032] The nucleic acid sequence of the D-arabitol-4-dehydrogenase gene is shown as SEQ ID NO. 2.

[0033] The sugar phosphatase gene is a sugar phosphatase gene from Bacillus subtilis, and the nucleic acid sequence is shown as SEQ ID NO. 3.

[0034] The nucleic acid sequence of the fructose-1,6-bisphosphatase gene is shown as SEQ ID NO. 4.

[0035] The nucleic acid sequence of the phosphoketolase gene is shown as SEQ ID NO. 5.

[0036] The nucleic acid sequence of the phosphotransacetylase gene is shown as SEQ ID NO. 6.

[0037] The nucleic acid sequence of the glucose-6-phosphate dehydrogenase gene is shown as SEQ ID NO. 7.

[0038] The nucleic acid sequence of the 6-phosphogluconolactonase gene is shown as SEQ ID NO. 8.

[0039] The nucleic acid sequence of the 6-phosphogluconate dehydrogenase gene is shown as SEQ ID NO. 9.

[0040] The nucleic acid sequence of the ribulose-5-phosphate epimerase gene is shown as SEQ ID NO. 10.

[0041] Preferably, the NADPH-dependent xylitol production coupling growth recombinant Pichia pastoris strain comprises a modified strain obtained by any one or more of the following genetic modification methods on the chassis microorganism:

[0042] (1) Overexpressing the NADPH-dependent xylitol dehydrogenase gene and the D-arabitol-4-dehydrogenase gene, and the insertion site is selected as the II-4 site;

[0043] (2) Knocking out the self xylulokinase gene on the basis of method (1), and expressing the Bacillus subtilis-derived xylulokinase gene and the NADPH-dependent xylitol dehydrogenase gene at the knockout site;

[0044] (3) Knocking out the NADH-dependent xylitol dehydrogenase gene on the basis of method (2);

[0045] (4) On the basis of way (3), the ribose-5-phosphate isomerase gene is knocked out, and a fructose-1, 6-bisphosphatase gene is expressed at the knockout site;

[0046] (5) On the basis of way (4), the glutamate dehydrogenase gene is knocked out, and the phosphoketolase gene and the phosphotransacetylase gene are expressed at the knockout site;

[0047] (6) On the basis of way (5), the phosphofructokinase gene is knocked out, and the phosphopentose oxidation pathway-related gene is expressed at the knockout site;

[0048] (7) On the basis of way (6), the phosphoglucose isomerase gene is knocked out.

[0049] The NADPH-dependent growth production coupling xylitol-producing recombinant Pichia pastoris strain, and the PPP gene comprises a glucose-6-phosphate dehydrogenase gene or a 6-phosphogluconolactonase gene.

[0050] In a second aspect, the application provides a construction method of any of the NADPH-dependent growth production coupling xylitol-producing recombinant Pichia pastoris strains, which is obtained by gene integration and knockout method on a chassis microorganism.

[0051] In a third aspect, the application provides a method for synthesizing xylitol, which comprises fermenting any of the recombinant Pichia pastoris strains to obtain xylitol.

[0052] In a fourth aspect, the application provides the application of any of the recombinant Pichia pastoris strains in synthesizing xylitol.

[0053] In a fifth aspect, the application provides the application of the construction method in synthesizing xylitol.

[0054] Compared with the prior art, the application has the following beneficial effects:

[0055] Compared with the prior art, the application has the following beneficial effects: BRIEF DESCRIPTION OF DRAWINGS

[0056] Figure 1 The figure is a schematic diagram of the knockout plasmid BB3cH_pGAP_23*_pLAT1_Cas9 of the application;

[0057] Figure 2 The figure is a schematic diagram of the knockout plasmid BB3cH_pGAP_23*_pLAT1_Cas9 of the application;

[0058] Figure 3 The liquid chromatogram of the present application;

[0059] Figure 4 The PCR electrophoresis result of the strain of the present application overexpressing NADPH-dependent xylitol dehydrogenase gene and D-arabitol-4-dehydrogenase gene; M: molecular weight marker (5000bp Ladder); samples 1-6 are the verification results of the strain overexpressing NADH-dependent xylitol dehydrogenase gene and D-arabitol-4-dehydrogenase gene, and the PCR product is 5045bp; samples 7-13 are the verification results of the strain overexpressing NADPH-dependent xylitol dehydrogenase gene and D-arabitol-4-dehydrogenase gene, and the PCR product is 5045bp;

[0060] Figure 5 The PCR electrophoresis result of the present application knocking out the endogenous NADH-dependent xylitol dehydrogenase gene; M: molecular weight marker (5000bp Ladder); samples 1-7 are the electrophoresis results of the modified strains, and the PCR product is 1074bp; sample 8 is the electrophoresis result of the original strain, and the PCR product is 2166bp;

[0061] Figure 6 The PCR electrophoresis result of the present application knocking out the endogenous NADH-dependent xylitol dehydrogenase gene; M: molecular weight marker (5000bp Ladder); samples 1-7 are the electrophoresis results of the modified strains, and the PCR product is 1074bp; sample 8 is the electrophoresis result of the original strain, and the PCR product is 2166bp;

[0062] Figure 7 The PCR electrophoresis result of the present application knocking out the endogenous NADH-dependent xylitol dehydrogenase gene; M: molecular weight marker (5000bp Ladder); samples 1-7 are the electrophoresis results of the modified strains, and the PCR product is 1074bp; sample 8 is the electrophoresis result of the original strain, and the PCR product is 2166bp;

[0063] Figure 8 The PCR electrophoresis result of the present application knocking out the endogenous NADH-dependent xylitol dehydrogenase gene; M: molecular weight marker (5000bp Ladder); samples 1-7 are the electrophoresis results of the modified strains, and the PCR product is 1074bp; sample 8 is the electrophoresis result of the original strain, and the PCR product is 2166bp;

[0064] Figure 9The knockout of phosphofructokinase gene 1 of the present application is verified by PCR electrophoresis, and M represents a molecular weight marker (5000bp Ladder); samples 1-6 are electrophoresis results of the modified strains, and the PCR product is at 5001bp; samples 7 and 8 are electrophoresis results of the original strains, and the PCR product is at 4480bp.

[0065] Figure 10 The knockout of phosphofructokinase gene 2 of the present application is verified by PCR electrophoresis, and M represents a molecular weight marker (5000bp Ladder); samples 1-5 are electrophoresis results of the modified strains, and the PCR product is at 5087bp; samples 7 and 8 are electrophoresis results of the original strains, and the PCR product is at 4069bp.

[0066] Figure 11 The knockout of phosphofructokinase gene 2 of the present application is verified by PCR electrophoresis, and M represents a molecular weight marker (5000bp Ladder); samples 1-5 are electrophoresis results of the modified strains, and the PCR product is at 5087bp; samples 7 and 8 are electrophoresis results of the original strains, and the PCR product is at 4069bp. DETAILED DESCRIPTION

[0067] The present application will be further described below by means of the accompanying drawings and examples. The genes related to the synthesis of xylitol are overexpressed in Pichia pastoris by the following methods, which are only used as examples to illustrate how the target genes are integrated in Pichia pastoris cells, and are not a limitation of the present application.

[0068] 1、The strain construction method of the present application uses a plasmid BB3cH_pGAP_23*_pLAT1_Cas9 knockout plasmid as shown in Figure 1 The integration and knockout of genes on the Pichia pastoris chromosome: the strain construction method uses a plasmid BB3cH_pGAP_23*_pLAT1_Cas9 knockout plasmid, which can precisely knockout the target sequence in the Pichia pastoris genome and has Hyg selection resistance.

[0069] 2、The strain construction flow chart of the present application is shown in Figure 2 The integration and knockout of genes on the Pichia pastoris chromosome:

[0070] The strain construction method uses a plasmid BB3cH_pGAP_23*_pLAT1_Cas9 knockout plasmid, as shown in the accompanying Figure 1As shown, it can be precisely knocked out in the target sequence in the Pichia pastoris genome and has Hyg selection resistance, and the construction method is referred to the published paper: (Gassler T et al. CRISPR / Cas9-Mediated Homology-Directed Genome Editing in Pichia pastoris. Methods Mol Biol. 2019; 1923: 211-225.) The specific construction steps are as follows:

[0071] (1) Construction of plasmid backbone: the plasmid fragment is digested by BbsI enzyme to construct the plasmid backbone. The specific addition is shown in Table 1, and the gel recovery is performed after 37°C reaction for 3h. The plasmid backbone construction system is shown in Table 1.

[0072] Table 1 Plasmid backbone construction system

[0073]

[0074] (2) Construction of vector fragment HH-sgRNA-HDV: the construction of the vector fragment is generated by six primers splicing by the method of DNA fragment splicing. The nucleic acid sequence of HH-sgRNA-HDV is shown in SEQ ID NO. 11.

[0075] The six primers are composed of four constant primers (A to D) and two primers (1_SgRNA_fw and 2_SgRNA_fw) that need to be designed separately. The first six "N" nucleotides of primer 1_SgRNA_fw are in reverse complementary relationship with the first six "N" nucleotides of primer 2_SgRNA_fw. The 20bp guide RNA sequence required for knocking out a specific gene is the "N" nucleotide sequence in 2_SgRNA_fw. The 20bp sequence is obtained by querying NCBI and designing CRIPERdirect website. The related primers are entrusted to Shengong Biological Company for synthesis.

[0076] (3) Golden gate assembly: the specific reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0077] Table 2 Golden gate assembly reaction system

[0078]

[0079] Table 3 Golden gate assembly reaction conditions

[0080]

[0081]

[0082] The gene expression cassette for homologous recombination is constructed by the principle of chromosomal homologous recombination, which comprises homologous integration arm sequences (including left and right two sections), promoter sequences, terminator sequences, expression gene sequences and other DNA elements. Only the homologous integration arm sequences (including left and right two sections) are needed to knock out the gene. The homologous integration arm sequence in the application is a DNA sequence from the genome of Pichia pastoris, which can insert the DNA sequence between the left and right homologous arms into the homologous DNA sequence in the genome by the method of homologous double exchange recombination. The promoter is a DNA sequence that can induce the transcription of the downstream gene, which is a promoter sequence from the gene of Pichia pastoris itself, such as the promoter sequence of 3-phosphoglycerate dehydrogenase gene. The terminator is a DNA sequence that can terminate the continuous transcription of the upstream gene. The sequence is a terminator subsequence from the gene of Pichia pastoris itself, such as the terminator sequence of 3-phosphoglycerate dehydrogenase gene. The above-mentioned necessary DNA elements, except for the above-mentioned target gene sequence (such as NDAPH-dependent xylitol dehydrogenase gene, D-arabitol-4-dehydrogenase gene and xylulokinase gene) used in the application, can be obtained in the public database (such as database: https: / / www.ncbi.nlm.nih.gov / )。

[0083] The transformation method refers to the paper published by the present inventors: (Lu X et al. Metabolic engineering for sustainable xylitol production from diverse carbon sources in Pichia pastoris. Microb Cell Fact. 2025 Mar 10; 24(1): 59). The specific steps are as follows:

[0084] (1) On the YPD solid culture medium where streaks grow Pichia pastoris single colonies, pick Pichia pastoris single colonies and inoculate 1 mL of YPD liquid medium, and put it in a 30℃ shaker at 200 rpm for overnight culture;

[0085] (2) Take out the overnight cultured bacterial solution, measure OD 600 , and transfer it to a 100 mL shake flask containing 20 mL YPD, with an initial OD 600 of 0.2, and put it in a 30℃ shaker at 200 rpm;

[0086] (3) When the Pichia pastoris cultured in the 30℃ shaker reaches OD 600 of 0.6-0.8, take out the bacterial solution and transfer it to a sterile 50ml centrifuge tube, put it in a floor centrifuge, centrifuge at 4℃, 4000rpm for 5min;

[0087] (4) Discard the supernatant, add 10 mL of sterile water to resuspend the cells, re-put into the floor centrifuge, centrifuge at 4000 rpm for 5 min at 4°C;

[0088] (5) Repeat step 4;

[0089] (6) Discard the supernatant, add 9 mL of pre-cooled BEDS solution to resuspend the cells, then add 1 mL of 1M DTT solution, put into a 30°C shaker and incubate at 200 rpm for 5 min.

[0090] (7) Take out the cultured bacteria, put into the floor centrifuge, centrifuge at 4000 rpm for 5 min at 4°C;

[0091] (8) Discard the supernatant, add 1 mL of BEDS solution, resuspend and transfer to a 1.5 mL sterile centrifuge tube, centrifuge at 4000 rpm for 5 min at 4°C;

[0092] (9) Discard the supernatant, add 200 μL of BEDS solution and mix well to obtain Pichia pastoris competent cells.

[0093] (10) Mix about 1 μg of plasmid DNA, 1 μg of repair fragment with 50 μL of Pichia pastoris competent cells. Transfer into an electroporation cup and incubate on ice for 2 min;

[0094] (11) Insert the electroporation cup into the electroporation slot of the electroporator, set the voltage to 1.5 kV, and perform electroporation. The duration of the electric shock is generally 5-10 ms;

[0095] (12) After electroporation, immediately resuspend the electroporated bacteria in a mixture of 0.5 mL of 1M sorbitol and 0.5 mL of YPD liquid medium, transfer the resuspension to a 1.5 mL centrifuge tube, and incubate in a metal bath at 30°C for one hour.

[0096] After incubation, cells are selected in medium containing the selection marker, in this case the hygromycin resistance gene, and transformed cells are plated on YPD medium containing hygromycin (20 g / L glucose, 10 g / L yeast extract, 5 g / L peptone, 15 g / L agar, 200 μg / mL hygromycin). Genomic DNA is extracted from transformants and amplified with a pair of primers specific for the gene of interest. If a band of the expected size is amplified and the sequence is correct, the gene of interest has been integrated into the Pichia genome. The plasmid is then cured by serial passaging, and the plasmid-cured engineered strain can be used as a host to transform a second gene of interest. The integration and curing of the second gene of interest results in a new engineered strain that can be used as a host to transform additional genes of interest, and so on, until all genes of interest have been integrated into the genome. The final Pichia strain contains all the genes described above that are involved in xylitol synthesis.

[0097] 3. Xylitol production by fermentation of the engineered strains:

[0098] Recombinant Pichia strains were grown in shake flasks in YP (10 g / L yeast extract, 20 g / L peptone) or minimal medium (7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4-7H2O, 10 mg / L histidine, trace metals and vitamins solution) with 20 g / L glucose, methanol or glycerol as carbon source. Initially, single colonies were inoculated into 1 mL YP + 20 g / L glucose to establish a 24 h preculture. These precultures were then inoculated into 20 mL of liquid medium in 100 mL baffled shake flasks at an initial OD600 of 0.2 and grown at 30°C with shaking at 200 rpm for 96 h.

[0099] After the shake flask incubation, the supernatant of all samples was collected by centrifugation. The supernatants were filtered through 0.22 μm filters and stored at -20°C for later quantification of extracellular xylitol.

[0100] Xylitol concentrations were quantified using an Agilent HPLC system equipped with a refractive index detector (RID). Separations were performed using an Aminex HPX-87H column (Bio-Rad, Hercules, CA; 300 x 7.8 mm; 10 μL injection volume). The mobile phase was ultrapure water with 5 mM H2SO4 at a flow rate of 0.6 mL / min. The oven temperature was maintained at 50°C. Chromatograms of fermentation samples and xylitol standards are shown in Figure 2. Figure 3

[0101] The following example will provide a detailed procedure for constructing an NADPH- producing xylitol strain. ​

[0102] Example 1: Obtain the modified strain XP04 by overexpressing the NADPH-dependent xylitol dehydrogenase gene and the D-arabitol-4-dehydrogenase gene (KpDalD) in Pichia pastoris

[0103] (1) The laboratory commonly used Pichia pastoris strain GS115 was used as the chassis cell. The Ku70 gene of the wild-type strain GS115 Pichia pastoris (histidine-deficient) was knocked out, and the Rad52 gene was overexpressed at its site to improve its homologous recombination efficiency and inhibit non-homologous ends, obtaining the starting strain GSY002.

[0104] (2) First, the artificially synthesized xylitol dehydrogenase (PsXyl2) derived from Pichia stipitis was used as a template to optimize the synthesis of the NADPH-dependent xylitol dehydrogenase gene (PsXyl2***) according to the codon bias of Pichia pastoris. The specific modification method is to use the artificially synthesized xylitol dehydrogenase gene (PsXyl2) as a template, and then use the primers designed at the mutation site to amplify by PCR, and then realize it by multi-fragment fusion method. The specific modification information refers to the research of Watanabe (Watanabe S, Kodaki T, Makino K. Complete Reversal of Coenzyme Specificity of Xylitol Dehydrogenase and Increase of Thermostability by the Introduction of Structural Zinc [J]. Journal of Biological Chemistry, 2005, 280(11):10340-9).

[0105] The D-arabitol-4-dehydrogenase gene (Dald) was used as a template to optimize the synthesis of KpDalD according to the codon bias of Pichia pastoris. The template D-arabitol-4-dehydrogenase gene is derived from Klebsiella Pneumoniae.

[0106] In order to insert the optimized NADPH xylitol dehydrogenase gene and D-arabitol-4-dehydrogenase gene (KpDalD) into the Pichia pastoris genome, first construct the homologous recombination repair fragment, and the insertion site is selected as II-4 site. Among them, the expression of xylitol dehydrogenase adopts the promoter P GAP and the terminator T TEF1 , and the expression of D-arabitol-4-dehydrogenase gene adopts the promoter P TEF1 and the terminator T GAPThese basic DNA elements can be found in NCBI database by those skilled in the art https: / / www.ncbi.nlm.nih.gov / We also expressed unmodified xylitol dehydrogenase gene and D-arabitol-4-dehydrogenase gene in the starting strain as control strain, the site and other elements are the same as above.

[0107] (3) Then the homologous recombination repair fragment and II-4 site knockout plasmid were transformed into Pichia pastoris strain GSY002.

[0108] After transformation, the transformants were screened on YPD agar medium containing hygromycin as a selection marker (glucose 20 g / L, yeast extract 10 g / L, peptone 5 g / L, agar 15 g / L, hygromycin 200 μg / mL). The grown transformants were cultured in liquid YPD medium without hygromycin, and part of the bacterial liquid was extracted for its genome, and then PCR verification was performed using the upper and lower verification primers, and the verification primer sequences are as follows:

[0109] II-4-V-F: GACACTGAAGGTTGAACTGTTCG

[0110] II-4-V-R: CAGATAAAGGAGGCTCTCCAT

[0111] The verification results are shown in Figure 4 The correct strain was transferred to YPD liquid medium without selection marker for subculture to remove the knockout plasmid, and after 5-6 times of transfer, it was streaked on YPD agar medium containing hygromycin as a selection marker and YPD agar medium without hygromycin as a selection marker, respectively. If no colonies grow on the YPD agar medium containing hygromycin as a selection marker, it indicates that the plasmid is completely removed, which can be used for subsequent gene knockout or insertion expression.

[0112] (4) The mutant with the above-mentioned overexpressed xylose dehydrogenase gene and D-arabitol-4-dehydrogenase gene knockout plasmid was inoculated in a fermentation medium to test the synthesis of xylitol. The components of the fermentation medium were 20 g / L glucose, 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 10 mg / L histidine, trace metal and vitamin solution. The fermentation conditions were 30°C, 200 rpm for 96 hours. The fermentation results showed that the strain XP04 expressing the NADPH-dependent xylose dehydrogenase gene (nucleic acid sequence as shown in SEQ ID NO. 1) and the D-arabitol-4-dehydrogenase gene (nucleic acid sequence as shown in SEQ ID NO. 2) had a xylitol yield of 450 mg / L, while the strain expressing the NADH-dependent xylose dehydrogenase gene and the D-arabitol-4-dehydrogenase gene had a xylitol yield of only 170 mg / L.

[0113] As can be seen from the fermentation results, the strain overexpressing only the NADPH xylose dehydrogenase gene had a xylitol yield nearly three times higher than the strain overexpressing the NADH-dependent xylose dehydrogenase gene, indicating that the NADPH xylose dehydrogenase gene had more advantages than the NADH-dependent xylose dehydrogenase gene in the expression in Pichia pastoris.

[0114] Example 2: Knocking out the endogenous xylulokinase gene, expressing the sugar phosphatase gene from Bacillus subtilis and the NADPH-dependent xylose dehydrogenase gene to obtain the modified strain XP07

[0115] (1) On the basis of the modified strain XP04 in Example 1 or, the endogenous xylulokinase gene (abbreviated as xks1) was knocked out.

[0116] The sugar phosphatase gene from Bacillus subtilis (BsAraL) was synthesized according to the codon preference of Pichia pastoris. The template sugar phosphatase gene was derived from Bacillus subtilis. We first constructed an endogenous xylulokinase knockout plasmid,. The knockout site sequence was AACAGTTCCGGGCTCGTATAG.

[0117] The homologous recombination repair fragment expressing the sugar phosphatase gene from Bacillus subtilis (BsAraL, nucleic acid sequence as shown in SEQ ID NO. 3) and the NADPH-dependent xylose dehydrogenase gene (PsXyl2) was constructed at the knockout site. The expression of the xylulokinase gene from Bacillus subtilis used the promoter P GAP and the terminator T TEF1 , and the expression of the NADPH-dependent xylose dehydrogenase gene used the promoter P TEF1 and the terminator T GAP .

[0118] (2) The transformation method and verification method of the strain are the same as in Example 1, and the verification primer sequence is as follows:

[0119] Xks1-V-F: CAGTTGAACTGATAGCTTCAGG

[0120] Xks1-V-R: TGCCAGATACTTCAGGCAATC

[0121] The verification results are shown in the following table: Figure 5 The method for removing plasmids from the correct strain is the same as in Example 1.

[0122] (3) Fermentation was carried out under the same conditions as in Example 1, and the fermentation test results showed that the xylitol yield of the recombinant strain XP07 was increased to about 1250 mg / L, with an increase of 170%.

[0123] Example 3: Knocking out the endogenous NADH-dependent xylitol dehydrogenase gene to obtain modified strain LP04

[0124] (1) On the basis of the modified strain XP07 obtained in Example 2, the endogenous NADH-dependent xylitol dehydrogenase gene (PpXyl2) was knocked out. We first constructed an endogenous NADH-dependent xylitol dehydrogenase knockout plasmid, and the construction method was the same as in Example 2. The knockout site sequence was: GCTGCTACGGCTAGAGCTTA. And a homologous integration arm sequence (left and right two segments of the knockout gene) was constructed.

[0125] (2) The transformation method and verification method of the strain are the same as in Example 1, and the verification primer sequence is as follows:

[0126] XDH-V-F: AAATTCGACTAAACTGCAAGCAT

[0127] XDH-V-R: GTCTTGAAATGTGTCAATGAACG

[0128] The verification results are shown in the following table: Figure 6 The method for removing plasmids from the correct strain is the same as in Example 1.

[0129] (3) Fermentation was carried out under the same conditions as in Example 1, and the fermentation test results showed that the xylitol yield of the recombinant strain LP04 was reduced to about 1100 mg / L.

[0130] Example 4: Knocking out the ribose-5-phosphate isomerase gene and expressing the fructose-1,6-bisphosphatase gene to obtain modified strain LP10

[0131] (1) On the basis of the modified strain LP04 obtained in Example 3, the endogenous ribose-5-phosphate isomerase gene (RKI) was knocked out. We first constructed a ribose-5-phosphate isomerase gene knockout plasmid, and the construction method was the same as in Example 2. The knockout site sequence was: TGTTCCCATTGAAGTCGTTC. The fructose-1,6-bisphosphatase gene (abbreviated as FBP, the nucleic acid sequence is shown as SEQ ID NO. 4) was expressed at the knockout site. The fructose-1,6-bisphosphatase gene used the promoter P GAP and the terminator T TEF1 .

[0132] (2) The transformation method and verification method of the strain were the same as in Example 1, and the verification primer sequences were as follows:

[0133] RKI-V-F: CGTAGCCTTTGATGGAGCTGAT

[0134] RKI-V-R: GTACAGGCATTTGTCCACTGGT

[0135] The verification results are shown in the following table: Figure 7 The correct strain was deplasmidized in the same way as in Example 1.

[0136] (3) Under the same conditions as in Example 1, fermentation was carried out, and the fermentation test results showed that the yield of xylitol of the recombinant strain was increased to about 2800 mg / L.

[0137] Example 5: Knocking out glutamate dehydrogenase gene and expressing phosphoketolase gene and phosphotransacetylase gene to obtain modified strain LP15

[0138] (1) On the basis of the modified strain LP10 obtained in Example 4, the endogenous glutamate dehydrogenase gene (GDH2) was knocked out. We first constructed a glutamate dehydrogenase gene knockout plasmid, and the construction method was the same as in Example 2. The knockout site sequence was: AACAAAGATATCCCCGAGGG. The phosphoketolase gene (abbreviated as xfpk, the nucleic acid sequence is shown as SEQ ID NO. 5) and the phosphotransacetylase gene (abbreviated as pta, the nucleic acid sequence is shown as SEQ ID NO. 6) were expressed at the knockout site. The expression of the phosphoketolase gene used the promoter P GAP and the terminator T TEF1 , and the expression of the phosphotransacetylase gene used the promoter P TEF1 and the terminator T GAP .

[0139] (2) The transformation method and verification method of the strain were the same as in Example 1, and the verification primer sequences were as follows:

[0140] GDH2-V-F: GTTATCAGTCAATCTCTATGGTTATCTGG

[0141] GDH2-V-R: CATTGATGGGACTCCCTATTGG

[0142] The verification results are shown in Table 1. Figure 8 The method for removing plasmid from the transformed strain is the same as in Example 1.

[0143] (3) Fermentation was carried out under the same conditions as in Example 1, and the fermentation test results showed that the growth of the recombinant strain was impaired and the xylitol yield was reduced to about 2000 mg / L.

[0144] Example 6: Knocking out phosphofructokinase gene (pfkl) while strengthening phosphopentose oxidation pathway to obtain modified strain LP18

[0145] (1) On the basis of the modified strain LP15 obtained in Example 5, the phosphofructokinase gene was knocked out. There are two phosphofructokinase genes, pfkl and pfk2, in Pichia pastoris, so the corresponding knockout plasmids were constructed. The construction method is the same as in Example 2. The pfkl knockout site sequence is: GAACCCTATCACTTCTGAAG and the pfk2 knockout site sequence is: GACGTTCTGGTCAATAGATT.

[0146] We first knocked out the phosphofructokinase gene (pfkl) and expressed the glucose-6-phosphate dehydrogenase gene (zwf for short, nucleic acid sequence as shown in SEQ ID NO. 7) and the 6-phosphogluconolactonase gene (pgl for short, nucleic acid sequence as shown in SEQ ID NO. 8) at the knockout site. The expression of the glucose-6-phosphate dehydrogenase gene used the promoter P TEF1 and the terminator T GAP , and the expression of the 6-phosphogluconolactonase gene used the promoter P GAP and the terminator T TEF1 .

[0147] (2) After transformation, screen on YPDEG agar medium containing hygromycin as a selection marker (glucose 20 g / L, 0.5% glycerol, 0.5% ethanol, yeast extract 10 g / L, peptone 5 g / L, agar 15 g / L, hygromycin 200 μg / mL), and other conditions are the same as in Example 1.

[0148] The verification primer sequences are as follows:

[0149] Pfk1-V-F: GACTGTGCTGTCTTCAGTGG

[0150] Pfk1-V-R: GCAGATATCCGAAATGCGTAACTC

[0151] The verification results are shown in the following table: Figure 9 The correct transformed strains were passaged in YPDEG liquid medium to remove plasmids. The growth of the transformed strains was impaired under the condition of only glucose as the carbon source, so we performed subculture in YPDEG liquid medium. After one week of subculture, the growth of the strains was restored.

[0152] (3) Fermentation was carried out under the same conditions as in Example 1, and the fermentation test results showed that the xylitol yield was increased to about 4000 mg / L.

[0153] Example 7: Knockout of phosphofructokinase gene (pfk2) and simultaneous enhancement of PPP to obtain modified strain LP22

[0154] (1) The pfk2 gene was knocked out from the modified strain LP18 obtained in Example 6 after removal of plasmids, and the 6-phosphogluconate dehydrogenase gene (abbreviated as gnd, the nucleic acid sequence is shown as SEQ ID NO. 9) and the ribulose-5-phosphate epimerase gene (abbreviated as rpe, the nucleic acid sequence is shown as SEQ ID NO. 10) were expressed at the knockout site. The expression of the 6-phosphogluconate dehydrogenase gene used the promoter P GAP and the terminator T TEF1 , and the expression of the ribulose-5-phosphate epimerase gene used the promoter P TEF1 and the terminator T GAP .

[0155] (2) The transformation method and verification method of the strain were the same as in Example 6, and the verification primer sequences are as follows:

[0156] Pfk2-V-F: GAATGTGATTGTCAGCCTCACC

[0157] Pfk2-V-R: TATAACGAGGCCGGAAACAAGG

[0158] The verification results are shown in the following table: Figure 10 The correct transformed strains were passaged in YPDEG liquid medium to remove plasmids.

[0159] (3) Fermentation was carried out under the same conditions as in Example 1, and the fermentation test results showed that the xylitol yield was increased to about 4200 mg / L.

[0160] Example 8: Knockout of phosphoglucomutase gene to obtain modified strain LP23

[0161] (1) On the basis of the modified strain LP22 obtained in Example 7, the phosphoglucose isomerase gene (pgi) was knocked out. First, the corresponding knockout plasmid was constructed, and the construction method was the same as that in Example 2. The knockout site sequence was: CAGGGAATCTGTGCATATAT. At the same time, the homologous integration arm sequence (left and right two segments of the knockout gene) was constructed.

[0162] (2) The transformation method and verification method of the strain were the same as those in Example 6. The verification primer sequences were as follows:

[0163] PGI-V-F: GATGTTAAACAACTGTCAACGCAG

[0164] PGI-V-R: CGGGATTTTGAGGAAGATATTTGC

[0165] The verification results are shown in the following table: Figure 11

[0166] (3) The modified strain cannot grow under the condition of only glucose as the carbon source. The composition of the fermentation medium is: 20 g / L glucose, 0.5% glycerol, 0.5% ethanol, 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 10 mg / L histidine, trace metal and vitamin solution. The fermentation conditions are: 30 degrees, 200 rpm, and fermentation for 120 hours. The fermentation results show that the final strain produces 5000 mg / L of xylitol.

[0167] The specific embodiments of the present application are described above. It should be understood that the present application is not limited to the above specific embodiments, and those skilled in the art can make various modifications or changes within the scope of the claims, which does not affect the essential content of the present application.​

Claims

1. A recombinant Pichia pastoris strain producing xylitol with NADPH- dependent growth-yield coupling, characterized in that, The modified strain obtained by any one of the following genetic modification methods or a combination of multiple genetic modification methods on a chassis microorganism: (1) expressing or overexpressing an NADPH-dependent xylitol dehydrogenase gene; (2) expressing or overexpressing a sugar phosphatase gene; (3) expressing or overexpressing a D-arabitol-4-dehydrogenase gene; (4) expressing or overexpressing a fructose-1,6-bisphosphatase gene; (5) expressing or overexpressing a phosphoketolase gene; (6) expressing or overexpressing a transacetylase gene; (7) expressing or overexpressing a glucose-6-phosphate dehydrogenase gene; (8) expressing or overexpressing a 6-phosphogluconolactonase gene; (9) expressing or overexpressing a 6-phosphogluconate dehydrogenase gene; (10) expressing or overexpressing a ribulose-5-phosphate epimerase gene; (11) knocking out or down-regulating a gene expressing xylulokinase; (12) knocking out or down-regulating a gene expressing NADH-dependent xylitol dehydrogenase; (13) knocking out or down-regulating a gene expressing ribose-5-phosphate isomerase; (14) knocking out or down-regulating a gene expressing glutamate dehydrogenase; (15) knocking out or down-regulating a gene expressing phosphofructokinase; (16) knocking out or down-regulating a gene expressing phosphoglucoisomerase.

2. The NADPH dependent growth-coupled xylitol-producing recombinant Pichia pastoris strain according to claim 1, characterized in that, The chassis microorganism is a Pichia pastoris strain.

3. The NADPH dependent growth-coupled xylitol-producing recombinant Pichia pastoris strain according to claim 2, characterized in that, The Pichia pastoris strain is constructed by knocking out a Ku70 gene of a wild-type strain GS115 Pichia pastoris and overexpressing a Rad52 gene at the site of the wild-type strain, to obtain a starting strain GSY002.

4. The NADPH dependent growth-coupled xylitol-producing recombinant Pichia pastoris strain according to claim 1, characterized in that, The nucleic acid sequence of the NADPH-dependent xylitol dehydrogenase gene is shown in SEQ ID NO. 1; The nucleic acid sequence of the D-arabitol-4-dehydrogenase gene is shown in SEQ ID NO. 2; The sugar phosphatase gene is a sugar phosphatase gene from Bacillus subtilis, and the nucleic acid sequence is shown in SEQ ID NO. 3; The nucleic acid sequence of the fructose-1,6-bisphosphatase gene is shown in SEQ ID NO. 4; The nucleic acid sequence of the phosphoketolase gene is shown in SEQ ID NO. 5; The nucleic acid sequence of the transacetylase gene is shown in SEQ ID NO. 6; The nucleic acid sequence of the glucose-6-phosphate dehydrogenase gene is shown in SEQ ID NO. 7; The nucleic acid sequence of the 6-phosphogluconolactonase gene is shown in SEQ ID NO. 8; The nucleic acid sequence of the 6-phosphogluconate dehydrogenase gene is shown in SEQ ID NO. 9; The nucleic acid sequence of the ribulose-5-phosphate epimerase gene is shown in SEQ ID NO.

10.

5. The NADPH dependent growth-coupled xylitol-producing recombinant Pichia pastoris strain according to claim 1, characterized in that, The modified strain obtained by any one of the following genetic modification methods on a chassis microorganism: (1) overexpressing an NADPH-dependent xylitol dehydrogenase gene and a D-arabitol-4-dehydrogenase gene; (2) knocking out a xylulokinase gene on the basis of method (1), and expressing a Bacillus subtilis-derived xylulokinase gene and an NADPH-dependent xylitol dehydrogenase gene at the knockout site; (3) Knocking out the NADH-dependent xylitol dehydrogenase gene on the basis of method (2); (4) Knocking out the ribose-5-phosphate isomerase gene on the basis of method (3), and expressing the fructose-1, 6-bisphosphatase gene at the knockout site; (5) Knocking out the glutamate dehydrogenase gene on the basis of method (4), and expressing the phosphoketolase gene and the phosphotransacetylase gene at the knockout site; (6) Knocking out the phosphofructokinase gene on the basis of method (5), and expressing the phosphopentose oxidation pathway-related gene at the knockout site; (7) Knocking out the phosphoglucose isomerase gene on the basis of method (6).

6. The NADPH dependent growth-coupled xylose reducting recombinant Pichia pastoris strain according to claim 5, characterized in that, The PPP gene comprises a glucose-6-phosphate dehydrogenase gene or a 6-phosphogluconolactonase gene.

7. A method for constructing a recombinant Pichia pastoris strain for NADPH- dependent growth-coupled production of xylitol according to any one of claims 1 to 6, characterized in that, Obtained by gene integration and knockout methods on the chassis microorganism.

8. A method of synthesizing xylitol, characterized by, The six-xylitol is isolated and obtained by fermenting the recombinant Pichia pastoris strain according to any one of claims 1-6.

9. The recombinant Pichia pastoris strain according to any one of claims 1-6 is applied to synthesis of xylitol.

10. The construction method according to claim 7 is applied to synthesis of xylitol.

Images