G-quadruplex nucleic acid aptamer sequence optimization method, sequence obtained through optimization and application of sequence in fluoroquinolone veterinary drug detection

Abstract

The invention discloses a G-quadruplex nucleic acid aptamer sequence optimization method, an optimized sequence and application of the G-quadruplex nucleic acid aptamer sequence in fluoroquinolone veterinary drug detection, belongs to the technical field of biological medicine, and provides application of the G-quadruplex nucleic acid aptamer sequence in content detection of fluoroquinolone veterinary drugs in food. The G-quadruplex nucleic acid aptamer sequence optimization method is characterized in that the G-quadruplex nucleic acid aptamer sequence is shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The G-quadruplex nucleic acid aptamer sequence is shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and the G-quadruplex nucleic acid aptamer sequence is shown as SEQ ID NO.4. According to the present invention, the sequence optimization is performed on the G4 structure of the nucleic acid aptamer, such that the G4 nucleic acid aptamer having high affinity on the FQs target and having the high fluorescence enhancement effect is obtained; the application limitation that the nucleic acid aptamer usually needs to cooperate with the G4 sequence to construct the fluorescence enhanced DNA mimic enzyme is effectively solved, meanwhile, the fluorescence excitation intensity of the DNA mimic enzyme is greatly enhanced, and the sensitivity and accuracy of detecting FQs in food are improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological hospital technology, in particular to a G-quadruplex nucleic acid aptamer sequence optimization method, an optimized sequence and application thereof in fluoroquinolone veterinary drug detection. BACKGROUND

[0002] Due to excellent broad-spectrum antibacterial properties, fluoroquinolones (FQs) are widely used in livestock and aquaculture. However, due to non-standard use of FQs, it may cause environmental pollution and pose a potential threat to human health. Therefore, it is necessary to detect and monitor its content, especially in food. Traditional detection methods, including high-performance liquid chromatography, gas chromatography-mass spectrometry, liquid chromatography-mass spectrometry, have been used to sensitively and accurately detect FQs. However, due to complex sample processing procedures and expensive instruments, these methods are not practical.

[0003] The biosensing technology of functional nucleic acids has attracted much attention in the field of food safety detection due to its high efficiency, flexibility, and ease of operation. In particular, G-quadruplex and aptamer-based biosensors have shown great potential in food safety detection due to their sensitivity, simplicity, and cost-effectiveness.

[0004] Nucleic acid aptamers are single-stranded DNA or RNA molecules that exhibit high specificity and affinity to specific targets, including enzymes, metal ions, biological toxins, and small drug molecules. Aptamer sensing technology has successfully achieved rapid and specific analysis of targeted antibiotics. However, existing research mainly focuses on detecting one antibiotic at a time and constructing a single-channel sensing system.

[0005] G-quadruplex (G4) is a special DNA spatial structure formed by the stacking of consecutive G-tetrads. When G4 binds to hemin, it forms a biological catalytic complex with peroxidase activity. When it binds to certain metal ions or Thioflavine T (ThT), a specific fluorescent dye, it can significantly enhance the fluorescence intensity of the fluorescent dye. DNA mimetic enzymes composed of G4 and specific ligands not only have peroxidase activity stability or fluorescence enhancement characteristics, but also have the advantages of flexible sequence assembly, sensitive detection, and cost control.

[0006] Aptamer biosensors and G4 DNA mimetic enzymes have attracted much attention in the field of veterinary drug residue detection. However, the complexity of food substances, as well as the sensitivity of functional nucleic acids with aptamer and G4 properties in practical applications, often face challenges.

[0007] In the inventor's previous research, a G4 configuration broad-spectrum aptamer W-G1 was obtained by optimization such as truncation, and the sequence is 5'-TAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTC-3', and the sequence length is 40-nt. However, in the process of constructing a label-free fluorescent aptamer sensor by using W-G1, it was found that the aptamer had no significant effect on the fluorescence signal enhancement of specific fluorescent ligands, and the detection performance and anti-interference ability of FQs were not ideal.

[0008] Therefore, there is an urgent need in the art to improve the above problems, so as to provide a simple, rapid, sensitive and low-cost aptamer sensor for detecting FQs residues in food. SUMMARY

[0009] One of the purposes of the present application is to provide a G-quadruplex nucleic acid aptamer sequence optimization method, which aims to improve the stability of the G4 structure of the aptamer, and enhance the detection performance of the label-free fluorescent aptamer sensor based on the G4 binding specific fluorescent ligand, so as to solve the above problems.

[0010] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows: The inventor has proposed three sequence optimization schemes for the G4 structure of the aptamer through a large number of experiments, as shown in the following table: Figure 1 (1) In addition to the G-rich G-quadruplex structure (QGRS) capable of forming G4 in the sequence of W-G1, there are 2 and 7 bases at the 5' end and 3' end respectively, and these non-essential nucleotides may affect the special structure of the aptamer, so the bases at the two ends of W-G1 except QGRS are selected to obtain WG1-T1 and WG1-T2; (2) The number of G residues, i.e. the number of G-quadruplexes, is closely related to the stability of G4 structure, and the number of G residues in W-G1 is only 2, which also affects the stability of W-G1 structure. Therefore, the number of G residues in the sequence of W-G1 is increased to obtain WG1-A1, WG1-A2 and WG1-A3; (3) Some researchers will "tandem" two G4s to enhance the fluorescence signal in order to enhance the fluorescence enhancement effect of G4 fluorescence enhancement type DNA mimic enzyme, therefore, a stable G4 sequence "D" is selected and "tandem" at the 5' end and 3' end of W-G1 to obtain D-WG1 and WG1-D.

[0011] ​The second object of the present application is to provide the sequences of G-quadruplex aptamer of fluoroquinolone veterinary drugs obtained by the above-mentioned optimization methods, which are shown as SEQ.ID.NO.1, SEQ.ID.NO.2, SEQ.ID.NO.3 and SEQ.ID.NO.4 as follows: SEQ.ID.NO.1: GGCTAACACGGTTCGGCTCTCTGAGCCCGG; SEQ.ID.NO.2: TAGGGCTAACACGGGTTCGGGCTCTCTGAGCCCGGGTTATTTC; SEQ.ID.NO.3: TAGGGGGCTAACACGGGGGTTCGGGGGCTCTCTGAGCCCGGGGGTTATTTC; SEQ.ID.NO.4: TAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCTAGGGGTTAGGGTTAGGGTTAGGG.

[0012] As a preferred technical solution, the sequences are shown as SEQ.ID.NO.2 and SEQ.ID.NO.3.

[0013] Through the above-mentioned three optimization methods, the inventors obtained the following seven optimized sequences in Table 1 The "WG1-T1" in the above table is SEQ.ID.NO.1, the "WG1-A1" in the above table is SEQ.ID.NO.2, the "WG1-A3" in the above table is SEQ.ID.NO.3, and the "WG1-D" in the above table is SEQ.ID.NO.4.

[0014] The third object of the present application is to provide the application of the above-mentioned sequence of G-quadruplex aptamer of fluoroquinolone veterinary drugs in the detection of the content of fluoroquinolone veterinary drugs in food.

[0015] By a series of characterization of the optimized sequences, the application finally obtains four nucleic acid aptamers WG1-T1, WG1-A1, WG1-A3 and WG1-D of G4 configuration with higher affinity and higher fluorescence enhancement performance relative to WG1, wherein, WG1-A1 and WG1-A3 have better performance: the dissociation constant Kd of WG1-A1 with Enrofloxacin (ENR), Lomefloxacin (LOW), Ciprofloxacin (CIP), Pefloxacin (PEF) and Ofloxacin (OFL) is 0.99±0.11, 0.33±0.15, 1.01±0.21, 4.24±2.68 and 3.89±1.71 μmol / L respectively, and the ThT fluorescence enhancement can reach 8 times of that of W-G1, and the Kd value of WG1-A3 with ENR, OFL and LOW is 1.54±0.81, 4.28±1.65 and 0.47±0.31 μmol / L respectively, and the ThT fluorescence enhancement can reach 20 times of that of W-G1.

[0016] Compared with the prior art, the application has the advantages that: by optimizing the G4 structure of the nucleic acid aptamer, the application obtains the G4 nucleic acid aptamer with high affinity to the FQs target and high fluorescence enhancement effect; effectively solves the application limitation that the nucleic acid aptamer usually needs to cooperate with the G4 sequence to construct the fluorescence enhancement type DNA mimic enzyme, and greatly enhances the fluorescence excitation intensity of the DNA mimic enzyme, and improves the sensitivity and accuracy of the FQs detection in food. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The sequence optimization schematic diagram of the W-G1 aptamer; Figure 2 The CD map of the aptamer of the application, wherein: (A) W-G1, (B) WG1-A1, (C) WG1-A3, (D) WG1-T1, (E) WG1-D; Figure 3 The fluorescence spectrum of the aptamer of Example 4 of the application. DETAILED DESCRIPTION

[0018] The application will be further described below in combination with examples.

[0019] Example 1: Fluoroquinolone veterinary G-quadruplex nucleic acid aptamer sequences, which are as shown in SEQ.ID.NO.1, SEQ.ID.NO.2, SEQ.ID.NO.3 and SEQ.ID.NO.4 as follows: SEQ.ID.NO.1: GGCTAACACGGTTCGGCTCTCTGAGCCCGG; SEQ.ID.NO.2: TAGGGCTAACACGGGTTCGGGCTCTCTGAGCCCGGGTTATTTC; SEQ.ID.NO.3: TAGGGGGCTAACACGGGGGTTCGGGGGCTCTCTGAGCCCGGGGGTTATTTC; SEQ.ID.NO.4: TAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCTAGGGGTTAGGGTTAGGGTTAGGG.

[0020] The affinity, spatial structure and fluorescence signal enhancement ability of the aptamer of Example 1 above to the specific fluorescent ligand were characterized by micro-thermal mobility instrument, circular dichroism spectrometer and fluorescence spectrometer.

[0021] The instruments and reagents used in the following examples are as follows: ENR (B24155), PEF (B67047) and LOW (B25450) were purchased from Shanghai Yuan Ye Biotechnology Co., Ltd., CIP (17850) was purchased from Sigma Aldrich Company (Shanghai), OFL (0102014) was purchased from Aladdin Chemical Co., Ltd., and the above FQs reagents were all analytical standards (≥98%). The nucleic acid aptamer and modified sequence used were purchased from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China).

[0022] Micro-thermal mobility instrument (Monolith NT.115, Nano Temper Technologies, Germany); circular dichroism spectrometer (Chirascan qCD, Applied Photophysics, UK); fluorescence spectrometer (FluoroMax®-4P, HORIBA, USA).

[0023] Example 2 1. Micro-thermal mobility instrument determination (1) The 5' end of the aptamer was labeled with FAM fluorescence, and it was diluted to 200 nmol / L with a binding buffer; (2) Take 16 PCR tubes, respectively labeled as 1~16, except for the No. 1 tube, add 10 μL of binding buffer to each tube, add 20 μL of FQs solution to the No. 1 tube. Then, take 10 μL of FQs solution from the No. 1 tube and add it to the No. 2 tube, mix well, then add it to the No. 3 tube, and so on, sequentially to the No. 16 tube; (3) MST detection: First, mix the 5' end labeled with FAM with gradient concentration of FQs solution, incubate at 4℃ in the dark for 20 min, then use the Monolith NT.115 instrument to measure its affinity. Use a capillary to suck the sample, sequentially load the No. 1~16 sample to the corresponding position of the tray, note: the No. 1 is the highest concentration of 50 mmol / L, the No. 16 is the lowest concentration of 6.25 nmol / L, during the process of sucking the sample, do not touch the sample and the middle part of the capillary, the capillary is vertical, there should be no bubbles in the detection part of the capillary. The MST detection program is set as: LED channel is "blue", LED power is set to 20%, MST power is set to "medium", MST temperature is set to 25℃, "Fluo. Before" time is 5 s, "MSTon" time is 20 s, "Fluo. After" time is 3 s. After the measurement is completed, use the analysis software of the instrument to analyze and process the data, and get the value of dissociation constant Kd.

[0024] 2. Circular dichroism measurement Prepare the aptamer concentration of 5 μmol / L, incubate in the incubator at 95℃ for 5 min, take out and place it in the 4℃ refrigerator for rapid cooling, after cooling to room temperature. Prepare a solution of nucleic acid aptamer and FQs molar concentration ratio of 1:10, incubate at 37℃ for 1 h, after incubation, take the sample, collect the far ultraviolet CD spectrum in the quartz cuvette with an optical path length of 0.1 cm at a scanning speed of 100 nm / min, a response time of 1.5 s, a band width of 1 nm, and a data interval of 0.5 nm in the range of 200~320 nm. The recorded spectrum is the average of 3 scans. The circular dichroism spectrum of binding buffer is used as a negative control.

[0025] 3. Fluorescence spectrum analysis The aptamer concentration was prepared to be 200 nmol / L, incubated at 95 °C in an incubator for 5 min, and then placed in a 4 °C refrigerator for rapid cooling after being taken out and cooled to room temperature. The ThT concentration was 10 μmol / L, the aptamer was mixed with ThT in equal volume, and after uniform mixing, it was incubated at 37 °C in the dark for 10 min. After the fluorescence tended to be stable, it was detected by FLUOROMAX-4cp fluorescence spectrometer. The detection conditions were set as follows: excitation wavelength 425 nm, slit width 5 nm, emission range 450-600 nm, slit width 5 nm, and step length 1 nm.

[0026] Experimental results: 1. G-quadruplex aptamer affinity characterization In this experiment, the affinity of G4 aptamer binding to FQs was characterized by MST. According to the results shown in Table 2 below, W-G1 showed high affinity to all 5 targets, with Kd values ranging from (0.07 ± 0.04) to (0.72 ± 0.54) μmol / L. However, WG1-T2 and WG1-A2 in Table 1 showed no affinity to all 5 FQs after sequence change, and were therefore excluded. On the contrary, WG1-T1 and WG1-A1 still exhibited high affinity to all 5 FQs, with Kd values ranging from (0.04 ± 0.05) to (27.31 ± 36.48) μmol / L, and therefore remained in the study. As for WG1-A3, although its affinity to CIP and PEF decreased, it still maintained high affinity to ENR, OFL and LOW, with Kd values ranging from (0.47 ± 0.31) to (4.28 ± 1.71) μmol / L. Although the affinity to 2 of the FQs decreased, WG1-A3 still showed high affinity to 3 of them, and was therefore identified as a strong candidate for a multi-target aptamer. Similarly, WG1-D still maintained high affinity to ENR, OFL and LOW, and was therefore retained for further study. However, for D-WG1, only its affinity to ENR and LOW was considered to be good, and its affinity to the other 3 FQs was not high, and therefore it was excluded. In summary, WG1-T1, WG1-A1, WG1-A3 and WG1-D were all considered to be broad-spectrum nucleic acid aptamers with high affinity.

[0027] Table 2 Kd values of aptamer binding to FQs Example 3 G-quadruplex aptamer spatial structure analysis The spatial structure of G4 aptamer was characterized in detail by circular dichroism spectroscopy (CD). The experimental data were analyzed using the Xgboost algorithm of CD-NuSS website. As shown in FIG. Figure 2 (A), the CD spectrum of W-G1 showed a negative peak at 240 nm and a positive peak at 260 nm, which was consistent with the typical characteristic peaks of positive parallel G-quadruplex. Figure 2 (B) and Figure 2 (C) showed the CD spectra of WG1-A1 and WG1-A3, which also showed a negative peak at 240 nm and a positive peak at 260 nm, which was consistent with the typical characteristics of positive parallel G-quadruplex. In addition, as shown in Figure 2 (D), WG1-D is a DNA-RNA double-stranded structure. As can be seen from the CD spectrum, simply "tandem" another G-quadruplex at one end of a G-quadruplex may affect the formation of G-quadruplex structure. And Figure 2 (E) showed the CD spectrum of WG1-T1, which showed a negative peak at 240 nm and a positive peak at 265 nm and 295 nm, showing a typical 3+1 mixed G-quadruplex structure. In summary, it was observed that WG1-A1, WG1-A3 and WG1-T1 could still form G-quadruplex structures after sequence changes. However, after the 3' end of W-G1 "tandem" sequence "D", although it maintained a high affinity with FQs to some extent, it affected the formation of G-quadruplex structure. In summary, WG1-A1, WG1-A3 and WG1-T1 are all G4 conformation nucleic acid aptamers.

[0028] Example 4 Effect of G-quadruplex aptamer on fluorescence enhancement performance In this experiment, the fluorescence spectrometer was used to characterize the effect of G4 aptamer on the fluorescence performance in G4 fluorescence-enhanced DNA mimic enzyme. The G4 / ThT system was taken as an example for characterization, and the fluorescence emission spectra generated by W-G1, WG1-A1, WG1-A3 and WG1-T1 were compared. The experimental results are shown in Figure 3 As can be seen from the observation of the fluorescence spectrum, WG1-T1 has the same QGRS as W-G1, so WG1-T1 has the same intensity of exciting ThT fluorescence signal as W-G1, which indicates that in addition to the QGRS sequence, the extra base pairs at both ends of W-G1 have no effect on the formation of G-quadruplex structure. It is worth noting that the fluorescence emission intensity of WG1-A1 / ThT is 8 times higher than that of W-G1 / ThT, and the fluorescence emission intensity of WG1-A3 / ThT is 20 times higher than that of W-G1 / ThT.

[0029] The affinity, spatial structure and the ability of enhancing the fluorescence signal of the specific fluorescent ligand of the aptamer and the FQs target were characterized by micro-thermal mobility instrument, circular dichroism spectrum and fluorescence spectrometer. Finally, two high-affinity, high-fluorescence enhancement performance G4 configuration nucleic acid aptamers WG1-A1 and WG1-A3 were obtained, wherein the dissociation constant Kd of WG1-A1 to ENR, LOW, CIP, PEF and OFL is 0.99±0.11, 0.33±0.15, 1.01±0.21, 4.24±2.68 and 3.89±1.71 μmol / L respectively, and the ThT fluorescence enhancement can reach 8 times of that of W-G1, and the Kd of WG1-A3 to ENR, OFL and LOW is 1.54±0.81, 4.28±1.65 and 0.47±0.31 μmol / L respectively, and the ThT fluorescence enhancement can reach 20 times of that of W-G1.

[0030] The above merely describes preferred embodiments of the present application and is not intended to limit the present application, and any modification, equivalent replacement and improvement within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for G-quadruplex nucleic aptamer sequence optimization, characterized in that, The optimization method is optimization based on W-G1: 5'-TAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTC-3', and the specific method comprises the following steps: (1) cutting off the bases at both ends of W-G1 except QGRS; (2) increasing the number of G residues in the sequence of W-G1; (3) selecting a stable G4 sequence "D" and connecting it to the 5' end and 3' end of W-G1 respectively.

2. A fluoroquinolone veterinary drug G-quadruplex nucleic acid aptamer sequence, characterized in that, The sequence is shown in SEQ.ID.NO.1, SEQ.ID.NO.2, SEQ.ID.NO.3 and SEQ.ID.NO.4 as follows: SEQ.ID.NO.1: GGCTAACACGGTTCGGCTCTCTGAGCCCGG; SEQ.ID.NO.2: TAGGGCTAACACGGGTTCGGGCTCTCTGAGCCCGGGTTATTTC; SEQ.ID.NO.3: TAGGGGGCTAACACGGGGGTTCGGGGGCTCTCTGAGCCCGGGGGTTATTTC; SEQ.ID.NO.4: TAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCTAGGGGTTAGGGTTAGGGTTAGGG.

3. The fluoroquinolone veterinary G-quadruplex nucleic acid aptamer sequence according to claim 2, characterized in that, The sequence is shown in SEQ.ID.NO.2 and SEQ.ID.NO.

3.

4. The application of the fluoroquinolone veterinary drug G-quadruplex nucleic acid aptamer sequence in claim 2 or 3 in the detection of the content of fluoroquinolone veterinary drugs in food.

Images