Multiplex PCR (Polymerase Chain Reaction) primer group and reagent for identifying five bacilli and application of multiplex PCR primer group and reagent
By designing multiplex PCR primer sets and electrophoresis methods, the problem of accurately identifying five Bacillus species, including Bacillus cereus and Bacillus thuringiensis, in existing technologies has been solved, achieving rapid and specific detection and improving detection efficiency and accuracy.
Patent Information
- Application Number
- CN202511170857.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-07
AI Technical Summary
The existing VITEK fully automated microbial analysis system and 16S rDNA sequencing method are inefficient in distinguishing five types of Bacillus, including Bacillus cereus and Bacillus thuringiensis, making it difficult to accurately differentiate them and leading to false negative/positive results, which affects food safety.
A multiplex PCR primer set was designed, including specific primer combinations for detecting Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis, and Bacillus mycosis fungoides, and these strains were rapidly identified by PCR amplification and gel electrophoresis.
It enables the simultaneous, rapid, and specific detection of multiple Bacillus species, shortening the identification time, improving detection efficiency and accuracy, and reducing labor costs.
Smart Images

Figure BDA0005558030010000072 
Figure BDA0005558030010000081 
Figure BDA0005558030010000082
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, and particularly relates to a multiplex PCR primer set for identifying five Bacillus species, reagents and application thereof. BACKGROUND
[0002] The Bacillus has a strong resistance due to its spore structure, and can survive in harsh environments such as high temperature, dryness and disinfectants. Different species have great differences in harm to humans and animals. Among them, Bacillus cereus and other species can cause food poisoning and other health problems. Misjudgment of the species will bring great safety hazards to food quality and safety. It is very important to identify the isolated strains to the species level for the development of food safety and public health. In food production, the microbial environment in the production workshop and laboratory environment is relatively complex. In addition to the common Bacillus cereus and Bacillus thuringiensis, there are three other Bacillus species, such as Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides with similar fungal colony morphology, which are worth our attention.
[0003] At present, the species identification mainly relies on VITEK automatic microbial analysis system, 16s rDNA sequencing and specific gene identification. However, the VITEK automatic microbial analysis system relies on the biochemical reaction database, and the resolution is insufficient for the species with close genetic relationship (such as Bacillus cereus and Bacillus thuringiensis), and false negative / positive may occur; 16s rDNA sequencing largely depends on the ANI method, and the 0.95 ANI threshold is used to judge whether it is the same species, which is the gold standard for species description. However, Bacillus cereus and Bacillus thuringiensis have high genetic similarity, and the ANI value of their 16s rDNA is greater than the species division threshold 0.95, both of which are higher than the standard value for population identification, and it is very difficult to distinguish. The specific PCR detection technology can significantly improve the detection efficiency and accuracy by detecting specific genes (such as gyrB, rpoB, spo0A) or functional genes (such as enterotoxin gene ccs, insecticidal protein gene cry). Therefore, using the specific gene identification method, developing a detection method that can quickly and simultaneously detect multiple Bacillus species is urgently needed in the market. SUMMARY
[0004] In order to solve the problems of slow detection efficiency and difficulty in distinguishing the five kinds of bacteria, especially the five kinds of bacteria containing Bacillus cereus and Bacillus thuringiensis, in the existing VITEK automatic microbial analysis system and 16s rDNA sequencing, the application provides a multiplex PCR primer group capable of simultaneously and rapidly detecting Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides and application thereof.
[0005] The primer group comprises at least one of the following (1)-(5):
[0006] (1), a first primer group for detecting Bacillus thuringiensis; the upper and lower primers of the first primer group have sequences shown as SEQ ID NO: 1-2 in sequence, or sequences with at least 80% homology with SEQ ID NO: 1-2;
[0007] (2), a second primer group for detecting Bacillus cereus, the upper and lower primers of the second primer group have sequences shown as SEQ ID NO: 5-6 in sequence, or sequences with at least 80% homology with SEQ ID NO: 5-6;
[0008] (3), a third primer group for detecting Bacillus licheniformis; the upper and lower primers of the third primer group have sequences shown as SEQ ID NO: 7-8 in sequence, or sequences with at least 80% homology with SEQ ID NO: 7-8;
[0009] (4), a fourth primer group for detecting Bacillus subtilis, the upper and lower primers of the fourth primer group have sequences shown as SEQ ID NO: 13-14 in sequence, or sequences with at least 80% homology with SEQ ID NO: 13-14;
[0010] (5), a fifth primer group for detecting Bacillus mycoides; the upper and lower primers of the fifth primer group have sequences shown as SEQ ID NO: 15-16 in sequence, or sequences with at least 80% homology with SEQ ID NO: 15-16.
[0011] The application further provides application of the primer group in detection of Bacillus.
[0012] In the above application, the Bacillus includes at least one of Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides.
[0013] The application further provides a kit for identifying five Bacillus strains, which comprises the primer set as described above.
[0014] The kit described in the application further comprises at least one of a PCR amplification reagent, a DNA extraction reagent, and a nucleic acid purification reagent.
[0015] The PCR reaction reagent comprises at least one of a buffer, a dNTP Mixture, ddH2O, and Taq enzyme.
[0016] The application further provides a multiplex PCR detection method for non-diagnostic purposes, comprising the following steps:
[0017] PCR amplification is performed on the sample by using the primer set described in the application or the kit described in the application.
[0018] Electrophoresis is performed on the amplification product, and the pathogenic bacteria in the sample are identified according to the bands.
[0019] The method provided in the application can be for diagnostic purposes or for non-diagnostic purposes. When the sample is from a human or animal body or is an ex vivo sample from a human or animal body, the detection is for diagnostic purposes. When the sample is an environmental sample or a simulation sample, the detection method belongs to a non-diagnostic detection method.
[0020] In the application, the sample comprises a food sample, an environment-related sample, and a patient sample. The food sample comprises rice, meat, dairy products, vegetable salad, etc. The environment-related sample comprises utensils and kitchenware used by a patient, raw materials of the same batch of food, and processing environment samples (such as a cutting board and an operating table). The patient-related sample comprises vomit, feces, and blood of a patient.
[0021] In some specific embodiments, the detection method comprises the following steps:
[0022] S1. PCR amplification is performed on the DNA of the sample to be detected as a template to obtain an amplification product. The primer comprises the primer pair BT-F / R for specifically detecting Bacillus thuringiensis, the primer pair BC-F / R for Bacillus cereus, the primer pair BL-F / R for Bacillus licheniformis, the primer pair BS-F / R for Bacillus subtilis, and the primer pair BM-F / R for Bacillus mycoides.
[0023] S2. Gel electrophoresis is performed on the amplification product, and then the strain of the strain to be detected is identified according to the combined bands presented in the electrophoresis result.
[0024] Preferably, in S1, the reaction system of PCR amplification comprises the following components: a primer, genomic DNA, dNTPs, and Taq DNA polymerase.
[0025] Preferably, in step S1, the amount of each primer is as follows: 1 μL of each of BC-F / R upstream primers (10 μM); 0.5 μL of each of BT-F / R, BL-F / R, BS-F / R, and BM-F / R upstream primers (10 μM).
[0026] Preferably, in step S1, the PCR amplification conditions are as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s, annealing at 63℃ for 1 min (decrease by 0.5℃ per cycle), extension at 72℃ for 45 s, 15 cycles; denaturation at 94℃ for 45 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 20 cycles; incubation at 72℃ for 5 min.
[0027] In the detection method of the present application, the criteria for identification include:
[0028] If a 344 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus thuringiensis;
[0029] If a 365 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus cereus;
[0030] If a 541 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus licheniformis;
[0031] If a 501 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus subtilis;
[0032] If a 968 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus mycoides.
[0033] The primer set provided by the present application can be used for detecting Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis, and Bacillus mycoides. Among them, the BT-F / R primer pair of the multiplex PCR primer set is used for detecting Bacillus thuringiensis, the BC-F / R primer pair is used for detecting Bacillus cereus, the BL-F / R primer pair is used for detecting Bacillus licheniformis, the BS-F / R primer pair is used for detecting Bacillus subtilis, and the BM-F / R primer pair is used for detecting Bacillus mycoides. Using the broken bacterial liquid of the strain to be tested as a template, and using the combinations of BT-F / R, BC-F / R, BL-F / R, BS-F / R, and BM-F / R primers for multiplex PCR amplification can simultaneously detect Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis, and Bacillus mycoides in one time, and the detection has high specificity, convenience, and efficiency.
[0034] Compared with the prior art, the present application has the following advantages and progress:
[0035] 1) The present application provides a multiplex PCR method, which shortens the time for strain identification and reduces the labor cost;
[0036] 2) The present application designs a primer combination based on five different product primers, which is used for simultaneously identifying Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides;
[0037] 3) The present application designs a multiplex PCR method for identifying five kinds of Bacillus, which can quickly identify the five kinds of Bacillus through PCR and gel electrophoresis. BRIEF DESCRIPTION OF DRAWINGS
[0038] Figure 1 Figure 2 is an electrophoretogram of PCR amplification of 19 strains of bacteria by 5 primer pairs; wherein A-E are the PCR amplification results by using BT-F / R, BC-F / R, BL-F / R, BS-F / R and BM-F / R as primers; M in the figure is Takara 100 bp DNA Ladder (DyePlus); 1-19 correspond to Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, Bacillus mycoides CICC 24780, Enterotoxigenic Escherichia coli BCRC 15372, Hemorrhagic Escherichia coli BCRC 15377, Shigella BCRC 10772, Salmonella BCRC 10744, Yersinia enterocolitica BCRC 13999, Yersinia pseudotuberculosis NCTC 1779, Vibrio cholerae BCRC 17642, Vibrio parahaemolyticus BCRC 10806, Vibrio vulnificus BCRC 12905, Listeria BCRC 14848, Staphylococcus aureus BCRC 14943, Enterobacter sakazakii BCRC 14122; N is a blank control;
[0039] Figure 2Figure 8 is a multiplex PCR amplification electrophoretogram of 19 strains of bacteria using primer combination I (1 μL of each of the upstream and downstream primers of BC-F / R, 0.5 μL of each of the upstream and downstream primers of BT-F / R, BL-F / R, BS-F / R, and BM-F / R, each at 10 μM); wherein M is Takara 100 bp DNA Ladder (Dye Plus); 1-19 correspond to Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, Bacillus mycoides CICC 24780, Enterotoxigenic Escherichia coli BCRC 15372, Hemorrhagic Escherichia coli BCRC 15377, Shigella BCRC 10772, Salmonella BCRC 10744, Yersinia enterocolitica BCRC 13999, Pseudotuberculosis Yersinia NCTC 1779, Vibrio cholerae BCRC 17642, Vibrio parahaemolyticus BCRC 10806, Vibrio vulnificus BCRC 12905, Listeria BCRC 14848, Staphylococcus aureus BCRC 14943, Enterobacter sakazakii BCRC 14122; and N is a blank control;
[0040] Figure 3 Figure 9 is a multiplex PCR amplification electrophoretogram of 19 strains of bacteria using primer combination II (1 μL of each of the upstream and downstream primers of BC-F / R, 0.5 μL of each of the upstream and downstream primers of BT-1-F / R, BL-F / R, BS-F / R, and BM-1-F / R, each at 10 μM); wherein M is Takara 100 bp DNA Ladder (Dye Plus); 1-19 correspond to Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, Bacillus mycoides CICC 24780, Enterotoxigenic Escherichia coli BCRC 15372, Hemorrhagic Escherichia coli BCRC 15377, Shigella BCRC 10772, Salmonella BCRC 10744, Yersinia enterocolitica BCRC 13999, Pseudotuberculosis Yersinia NCTC 1779, Vibrio cholerae BCRC 17642, Vibrio parahaemolyticus BCRC 10806, Vibrio vulnificus BCRC 12905, Listeria BCRC 14848, Staphylococcus aureus BCRC 14943, Enterobacter sakazakii BCRC 14122; and N is a blank control;
[0041] Figure 4 Figure 9 is a multiplex PCR amplification electrophoretogram of 19 strains using primer combination III (1 μL of each of BC-F / R upstream primers (10 μM), 0.5 μL of each of BT-F / R, BL-1-F / R, BS-F / R, and BM-1-F / R upstream primers (10 μM)); wherein M is Takara 100 bp DNA Ladder (Dye Plus); 1-19 correspond to Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, Bacillus mycoides CICC 24780, Enterotoxigenic Escherichia coli BCRC 15372, Hemorrhagic Escherichia coli BCRC 15377, Shigella BCRC 10772, Salmonella BCRC 10744, Yersinia enterocolitica BCRC 13999, Pseudotuberculosis Yersinia NCTC 1779, Vibrio cholerae BCRC 17642, Vibrio parahaemolyticus BCRC 10806, Vibrio vulnificus BCRC 12905, Listeria BCRC 14848, Staphylococcus aureus BCRC 14943, Enterobacter sakazakii BCRC 14122; and N is a blank control;
[0042] Figure 5 Figure 10 is a multiplex PCR amplification electrophoretogram of 19 strains using primer combination IV (1 μL of each of BC-F / R upstream primers (10 μM), 0.5 μL of each of BT-F / R, BL-2-F / R, BS-F / R, and BM-2-F / R upstream primers (10 μM)); wherein M is Takara 100 bp DNA Ladder (Dye Plus); 1-19 correspond to Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, Bacillus mycoides CICC 24780, Enterotoxigenic Escherichia coli BCRC 15372, Hemorrhagic Escherichia coli BCRC 15377, Shigella BCRC 10772, Salmonella BCRC 10744, Yersinia enterocolitica BCRC 13999, Pseudotuberculosis Yersinia NCTC 1779, Vibrio cholerae BCRC 17642, Vibrio parahaemolyticus BCRC 10806, Vibrio vulnificus BCRC 12905, Listeria BCRC 14848, Staphylococcus aureus BCRC 14943, Enterobacter sakazakii BCRC 14122; and N is a blank control;
[0043] Figure 6 Figure 7 is an electrophoretogram of amplification of 7 strains of Bacillus with different DNA concentrations by primer combination I (1 μL of each of BC-F / R upstream and downstream primers (10 μM), 0.5 μL of each of BT-F / R, BL-F / R, BS-F / R, and BM-F / R upstream and downstream primers (10 μM)); wherein A-G are PCR amplification results with Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, and Bacillus mycoides CICC 24780 as templates; M is Takara 100 bp DNA Ladder (DyePlus); 1-7 correspond to different concentrations of DNA of each strain, and the concentrations are 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL, respectively. DETAILED DESCRIPTION
[0044] The present application provides a multiplex PCR primer combination for identifying five Bacillus strains, reagents and applications thereof. Those skilled in the art can improve the process parameters as appropriate to achieve the application by referring to the content herein. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The methods and applications of the present application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.
[0045] In the present application, "including", "containing" and "having" are used interchangeably, and are intended to represent the inclusivity of the scheme, meaning that the scheme can have other elements in addition to the listed elements. It should also be understood that the use of "including", "containing" and "having" in the present application also provides a "consisting of" scheme.
[0046] In the present application, "at least one" means one or more, and "multiple" means two or more. "At least one", "at least one item" or similar expressions mean any combination of these items, including any combination of single or multiple items.
[0047] In the present application, "and / or" is used herein to include the meaning of "and", "or" and "all or any other combination of elements linked by the term".
[0048] The test materials used in the present application are ordinary commercially available products, which can be purchased in the market.
[0049] The technical solutions of the present application will be further described below in combination with specific embodiments. The following embodiments are only used to illustrate the present description and should not be regarded as the protection scope of the present application. The main reagents involved in the following embodiments are from TaKaRa Ex Takara. The primers were synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. The technical operation steps or conditions not specified in the examples were carried out according to the techniques or conditions described in the literature of the art or according to the product instructions. The reagents or instruments used were conventional products that can be obtained by purchase.
[0050] Example 1: Design and screening of PCR primers
[0051] Based on the genomes of Bacillus and related species in GenBank database and the existing Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides, the whole genome sequences of the international reference strains of the five kinds of Bacillus in Table 1 were searched and downloaded.
[0052] Table 1 International reference strains of five kinds of Bacillus
[0053]
[0054]
[0055] The Blast program in the NCBI database was used to align each gene fragment, and only the sequences that completely matched Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis or Bacillus mycoides were screened out. Primer 5.0 software was used for primer design, and the primer sequences and amplification lengths are shown in Table 2.
[0056] Table 2 Primer sequence information table
[0057]
[0058] The above primer pairs were used for amplification, wherein the amplified product in Bacillus thuringiensis was a nucleotide sequence shown in SEQ ID NO: 21 (primer pair: SEQ ID NO: 1-2) or SEQ ID NO: 22 (primer pair: SEQ ID NO: 3-4), the amplified product in Bacillus cereus was a nucleotide sequence shown in SEQ ID NO: 23 (primer pair: SEQ ID NO: 5-6), the amplified product in Bacillus licheniformis was a nucleotide sequence shown in SEQ ID NO: 24 (primer pair: SEQ ID NO: 7-8), SEQ ID NO: 25 (primer pair: SEQ ID NO: 9-10) or SEQ ID NO: 26 (primer pair: SEQ ID NO: 11-12), the amplified product in Bacillus subtilis was a nucleotide sequence shown in SEQ ID NO: 27 (primer pair: SEQ ID NO: 13-14), the amplified product in Bacillus mycoides was a nucleotide sequence shown in SEQ ID NO: 28 (primer pair: SEQ ID NO: 15-16), SEQ ID NO: 29 (primer pair: SEQ ID NO: 17-18) or SEQ ID NO: 30 (primer pair: SEQ ID NO: 19-20).
[0059] SEQ ID NO: 21
[0060] CACCTTGTGGATTCACCGGA ATCATACCGCCGATTTCATTCTTTAACATCGAAATAATTGCCGGGCCATTCGCTTTATCTTCCACTAGTTTGGCATGGGCTTTCGGATATTTTCGTACCATATTGCGAATGGCTTGTAGGGTAGTTGGGAAGTTCATACGTGCTTTCAAATTATCAATCAAATACATATCCGCCCCATTCTTCCCCACACCTGAATACACACAAAGTCACTGTCTGCTTCATCCTTAAATGTTGCATCGATACTCATAATCGTATGAACCATCTTCGGCAGCGTATCATAATATTGCCACCATTTACGCTTTA ATAGATTCCCTTCCGCTGCG.
[0061] SEQ ID NO: 22
[0062] CACCTTGTGGATTCACCGGAATCATACCGCCGATTTCATTCTTTAACATCGAAATAATTGCCGGGCCATTCGCTTTATCTTCCACTAGTTTGGCATGGGCTTTCGGATATTTTCGTACCATATTGCGAATGGCTTGTAGGGTAGTTGGGAAGTTCATACGTGCTTTCAAATTATCAATCAAATACATATCCGCCCCATTCTTCCCCACACCTGAATACACACAAAGTCACTGTCTGCTTCATCCTTAAATGTTGCATCGATACTCATAATCGTATGAACCATCTTCGGCAGCGTATCATAATATTGCCACCATTTACGCTTTAATAGATTCCCTTCCGCTGCGGTTGGTCTGCCTTGATACAATGAGTTAAAGCTACTTGGATATCGTTTCCGTTCTTGTATGAACTCTAACCCATATCGTTCTGGCCACAATGGTTCGCCTACTGCTCGTCCTATTACATCATCTTCCTCGGCTTCTAATGGAAGATTGTACACTTGCCAAGGTAATGGTTCACCATATTCCTTACTTAGCAACCTACCCTGTAAATCATCTTCATGCCATCTTGTTAGAATCAGTATGACAATTGCACCCGGATGTAAACGAGTAGAGAAGCTATCTATCCACTCATCCCATATCTTACCTCGATGCGTTTCACTATCAGCTTCCTCACGGTTCTTAATCGGGTCATCGATAATCATTAAGTCAGCACCCATACCAGTGATACCTGATAACACACCACGTGAGATCATGCCACCTATTTCATTATCCAGTAACCATTCATCATGTGCCGAGCTTTCTTTGGATATTTGGATATCGAATAAATCAGTACCATACATTTTGACCTTTTCTTTATTCTTCTTACCAAAACGGCGAGCAAATGTGTCACTATAACTTATTTCAATTACTCTATCTTCTGGAAAGTTTCCTAAATAATAAGATGGTAACGTCTCCGTAATGGTCATCGACTTACTATGACGTGGTGGCATATTGATAGCAATGTATTGGTTC GTGGTTGGAATCTCGCTTGC.
[0063] SEQ ID NO: 23
[0064] ATTGGTGACACCGATCAAACA GGAACAATAACTCGATTTAAACCAGATCCGGAAATTTTCCAAGAAACAACAGTATACGATTTTGATACGCTAGCTACTCGTATGCGTGAATTAGCGTTTTTAAATCGTAGTATTAAATTAACAATTGAAGATAAACGTGAACATAAGCAAAAGAAAGAATTCCATTACGAAGGTGGAATTAAATCATACGTTGAGCATTTAAATCGCTCAAAACAACCGATTCATGAAGAGCCTGTGTACGTAGAAGGTTCAAAAGATGGTATTCAGGTTGAGGTTTCTCTTCAATATAACGAAGGATACACAAATAATATTTACTCATTTAC GAATAACATCCATACGTATGA.
[0065] SEQ ID NO: 24
[0066] AGGCGTGTACAGCACTTACC CAACCAGCACTTATGCAACATTGAACGGAACGTCAATGGCTTCTCCTCATGTAGCGGGAGCAGCAGCTTTGATCTTGTCAAAACATCCGAACCTTTCAGCTTCACAAGTCCGCAACCGTCTCTCCAGTACGGCGACTTATTTGGGAAGCTCCTTCTACTATGGAAAAGGTCTGATCAATGTCGAAGCTGCCGCTCAATAACATATTCTAACAAATGGCATATAGAAAAAGCTAGTGTTTTTAGCACTAGCTTTTTCTTCATTCAGTTGAAGACTGTTCAATATTTTGAATCCGTTCCATTATGGTCGGATGGCCGTATTTAAAAATCTTGACGAGAAACGGCGGGTTCGCCTCGCTCAACCCGGCTTTTGAGAGCTCTTGAAAAGTCGCAACCGCTGCATCGCTGTTGTTCGTCAGTTCAATCGCATACTGGTCAGCGGCTTTTTCCTGATGCCTCGAAACTGCGTTTGTAAATGGAGAAGACGCGAAAGAGATGACCCCCATC AGCATCAGGAGAAGCGG.
[0067] SEQ ID NO: 25
[0068] CTGTAAGATCCGCTTCCGCT TGAATTCAGCACTTTAACCGCGTACAAGGATACGTTCGGCGCAACGCCTAATACACCCGTTGTATTGTCAAGCGCAGCTACTGTACCGGCAACATGCGTGCCGTGTCCGTTGCCGTCGGTGTTATAAGCTTCGCCAGCTACGAAGCTTGCTCCGCCGACTACGTTCAAGTCCGGATGAGAAGCTTGGATTCCTGTATCCAGGACGGCGACTTTTACGTTCGCTCCCTTGTAGCCTTGAGCCTGCACTTTGTCCGCTTTAATGAG AGGAATGCCGTA AGGAACGG.
[0069] SEQ ID NO: 26
[0070] TGTTACAGAGCTTACGGCGG AAGAACGCCTGCTTCATGCCATCTTCGGGGAAAAAGCGCGTGAAGTGCGTGATACGTCGCTGCGTGTACCTCACGGAGGCGGCGGTATCATCCTTGATGTAAAAGTGTTCAACCGCGAAGACGGAGACGAACTGCCTCCGGGCGTTAACCAGCTCGTCCGCGTCTACATCGTTCAGAAGCGTAAAATTTCTGAAGGGGACAAAATGGCCGGACGCCACGGTAACAAAGGTGTTATTTCGAAAATTCTTCCGGAGGAAGATATGCCGTATCTGCCTGACGGAACGCCGATTGACATCATGTTAAACCCGCTGGGCGTACCATCGCGTATGAACATCGGGCAGGTGTTGGAGCTGCACCTTGGTATGGCTGCACGCCGCCTCGGTCTGCATGTCGCGTCACCTGTATTTGACGGTGCCCGCGAAGAAGATGTGTGGGAAAC CCTTGAAGAAGCCGGCATGT.
[0071] SEQ ID NO: 27
[0072] ATGCCCCATGTAACAGCGAAAGACCATAAACCGTTCGAGAAGTGGAAAATTGTTGATAAAACACCGACAATGTAAAAACCAAGCATAGCCGGAGAGCTCAAAATATTCGCCATCATGTCGAAATTGACCTCAGCACCCATTTGTGCGGCAATGCGGGTTTCCCACACGTGCCAGCTGACGAAAATGAGGGTGATGATACCGGTTACACGCTGCAGGACGAATAGCCAGTTTCTCATGTAGCTGTATTGACCGGCGTTATTTTTCGCAGTAAACGCTATGTACACACCATAAACTGCATGATAAATTAATGGTAAGAAGATAATAAAAATTTCCAAGGCATACCTGAAAGGCAGGCTATCCATAAAATGAGCAGCGCTATTGAATGCTTCAGCGCCCCTTGCGGCAAACTGGTTGACGACTAAATGCTGAATAAGAAAGATGCCGACCGGTATGACGCCAAGCAAGGAATGCAATCT TCGAAAATAAAACTCTCTGTTCCCA.
[0073] SEQ ID NO: 28
[0074] CACTGTACGACCTGATGCGAGAGAAGTTGTTTGTTGTTTACTAGGCAAAGTAATACTGAACTCAAAAAAGGGTCTTTCATACTGCATAATTTCACCTGAACCCCATACTTGTTTTAATTCCGCTATTCCATTTGCATTAAATACAGGCAAACCATCCTCATATAAACGGAATGAAGTTTTCCTCCCATTAATATAATCAAAACGATAGGACTTCAAGGATCCACTATGCCCACTTACAAAGTCAAAACTTTTTTGTAAAATTACCGCATTATCCGTAGATTTATCACCATGTACAGCGGAATTTTTATATTTCAACATTGCATCCGACTTATCAATTTCCATAGAACGGATGCCATCTGTAAATGTTTCCTTTGTTTTCTCAGAAATAGGACTTAAATAACGTGGATCACTAAATAAAGCATTTTTAAATGGATCCACTTCTAGTTTAGCTGTAATATACTCTGCCTTACTTAATTCCGTAATCCCCTCTGGTAAAAAAAGTTTTTTTGTATCATTTATTTGATACTCAAAATATGGTCTTGCTACTGTTATAAGTTGATTTTGAGCATTTATAATATCCTTTATATAAGCACCACTCAATGTTGCTTGATATATTTTATGAGGAGTATCATAGGAAACAAAGCTAACTTTAATTTCTTGGTCCTTACTTCTAGAAGGATCAATTATAATACGATTAAAACTTCTGTTACTTTCTATGTTTTTATCTTTAATATTAAACATATTTTTAATCGTATCTAACGGGATATTTGTAGGAAAAACAAATTCAATTTTTTCTTCTCCGTGTACATAAGACAGAAAATCACCTTTAGGGACTGTCCCCGTTATTTCCTCGAAATAATGTAATTCTCCGTTTTCAAGAATTTTATAGATCGAATCCACATTTTCCTTCTTTTCGCTTACATAATGATTTTTCTCTTTATGAATAAC GACAGAGGATGGGCGAACAA.
[0075] SEQ ID NO: 29
[0076] TCGGCTGTAAGACAGCGATTGACAGAGGATGGGCGAACAA.
[0077] SEQ ID NO: 30
[0078] CGCGTCATTTGCCATACCAG CTTCTTCAATTGTGCCCCATACATCTTCCTCACGAGCACCATCGAATACCGGTGTTGCAATGTGAATACCAAGGTATCTTGCCGCCATACCAAGATGAAGCTCTAATACCTGACCGATATTCATACGAGATGGTACCCCTAATGGGTTTAACATGATATCGATTGGCGTACCATCTGGTAAGTAAGGCATATCTTCTTCCGGTAAAATACGGGAGATAACACCTTTGTTACCATGACGACCAGCCATTTTGTCACCTTCAGAAATTTTACGCTTTTGAACGATATATGCACGTACAAGTTGATTCACGCCTGGTGGCAATTCATCGCCATCTTCACGGTTAAACACTTTTACGTCTAAGATAATACCGCCACCACCGTGTGGTACACGTAGTGATGTATCACGTACTTCACGTGCTTTTTCACCGAAGATTGCATGTAATAGACGTTCTTCTGCCGTTAATTCTGTTACACCTTTTGGCGTTACTTTACCAACAAGTAGATCTCCATCTTTTACTTCAGCACCGACGCG AATAATACCGCGCTCGTCAAGAT.
[0079] wherein the sequences indicated by underlining are primer sequences.
[0080] After screening the PCR primer pairs, the DNA of Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830, Bacillus mycoides CICC 24780, Enterotoxigenic Escherichia coli BCRC 15372, Hemorrhagic Escherichia coli BCRC 15377, Shigella BCRC 10772, Salmonella BCRC 10744, Yersinia enterocolitica BCRC 13999, Yersinia pseudotuberculosis NCTC 1779, Vibrio cholerae BCRC 17642, Vibrio parahaemolyticus BCRC 10806, Vibrio vulnificus BCRC 12905, Listeria BCRC 14848, Staphylococcus aureus BCRC 14943 and Enterobacter sakazakii BCRC 14122 were extracted by using TE buffer. The DNA of these bacteria was used as a template to set up a 25 μL PCR reaction system: TaKaRa Ex Taq (5 U / μL) 0.2 μL; 10×Ex Taq Buffer (Mg 2+ plus) (20 mM) 2.5 μL; dNTP Mixture (2.5 mM each) 2 μL; DNA template 1 μL (concentration 100 ng / μL); 1 μL of each BC-F / R upstream and downstream primer (10 μM), 0.5 μL of each BT-F / R, BL-F / R, BS-F / R and BM-F / R upstream and downstream primer (10 μM) as primer pairs; and ddH2O was added to 25 μL, and PCR operation was performed respectively.
[0081] The PCR reaction program was pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s, annealing at 63℃ for 1 min (decrease 0.5℃ per cycle), extension at 72℃ for 45 s, 15 cycles; denaturation at 94℃ for 45 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 20 cycles; and incubation at 72℃ for 5 min.
[0082] Table 3 information of standard strains in experiment
[0083]
[0084]
[0085] The PCR electrophoresis results of 19 strains by using the primer combination (five primer pairs: BT-F / R, BC-F / R, BL-F / R, BS-F / R and BM-F / R) of the present application are shown in Figure 1 , and the amplification results are shown in Table 4, and the strain numbers are shown in Table 3. Figure 1As seen in A, Bacillus thuringiensis CICC 22945 (strain number 1) has an amplified band, the band size of which is between 300-400 bp, the band size is consistent with the experimental expectation, and the rest of the strains have no amplification, indicating that the primer pair BT-F / R can specifically recognize Bacillus thuringiensis CICC 22945; as seen in B, Figure 1 As seen in B, Bacillus cereus CICC 21261 (strain number 2) and Bacillus cereus CGMCC 1.3760 (strain number 3) have amplified bands, the band size of which is between 300-400 bp, the band size is consistent with the experimental expectation, and the rest of the strains have no amplification, indicating that the primer pair BC-F / R can specifically recognize Bacillus cereus CICC 21261 and Bacillus cereus CGMCC 1.3760; as seen in C, Figure 1 As seen in C, Bacillus licheniformis CICC 10101 (strain number 4) and Bacillus licheniformis CICC 10103 (strain number 5) have amplified bands, the band size of which is between 500-600 bp, the band size is consistent with the experimental expectation, and the rest of the strains have no amplification, indicating that the primer pair BL-F / R can specifically recognize Bacillus licheniformis CICC 10101 and Bacillus licheniformis CICC 10103; as seen in D, Figure 1 As seen in D, Bacillus subtilis CICC 23830 (strain number 6) has an amplified band, the band size of which is between 500-600 bp, the band size is consistent with the experimental expectation, and the rest of the strains have no amplification, indicating that the primer pair BS-F / R can specifically recognize Bacillus subtilis CICC 23830; as seen in E, Figure 1 As seen in E, Bacillus mycoides CICC 24780 (strain number 7) has an amplified band, the band size of which is between 900-1000 bp, the band size is consistent with the experimental expectation, and the rest of the strains have no amplification, indicating that the primer pair BM-F / R can specifically recognize Bacillus mycoides CICC 24780.
[0086] As seen from Table 4, using primer pair BT-F / R, the detection result of Bacillus thuringiensis CICC 22945 (strain No. 1) is "+" (with bright amplification band), and the detection results of the rest of strains are "-". Using primer pair BC-F / R, the detection results of Bacillus cereus CICC 21261 (strain No. 2) and Bacillus cereus CGMCC 1.376 (strain No. 3) are "+" (with bright amplification band), and the detection results of the rest of strains are "-". Using primer pair BL-F / R, the detection results of Bacillus licheniformis CICC 10101 (strain No. 4) and Bacillus licheniformis CICC 10103 (strain No. 5) are "+" (with bright amplification band), and the detection results of the rest of strains are "-". Using primer pair BS-F / R, the detection result of Bacillus subtilis CICC 23830 (strain No. 6) is "+" (with bright amplification band), and the detection results of the rest of strains are "-". Using primer pair BM-F / R, the detection result of Bacillus mycoides CICC 24780 (strain No. 7) is "+" (with bright amplification band), and the detection results of the rest of strains are "-". The detection results show that the five primer pairs have good specificity.
[0087] Table 4 PCR amplification results of 5 primer pairs on 19 strains
[0088]
[0089] Note: "+" indicates that there is a bright amplification band, "*" indicates that the amplification band is blurred or there are multiple amplification bands, and "-" indicates no amplification.
[0090] Example 2: Multiplex PCR
[0091] After screening the PCR primer pairs, in order to obtain the optimal combination, four different primer combinations were used for experiments in this embodiment. The DNA of the 19 bacteria in Table 3 was used as a template, and a 25 μL PCR reaction system was set up: TaKaRa Ex Taq (5 U / μL) 0.2 μL; 10×Ex Taq Buffer (Mg 2+2.5 μL of dNTP primers (20 mM each); 2 μL of dNTP primers (2.5 mM each); and 2 μL of the four primer combinations in Table 2: (I) 1 μL each of BC-F / R upstream and downstream primers (10 μM), and 0.5 μL each of BT-F / R, BL-F / R, BS-F / R, and BM-F / R upstream and downstream primers (10 μM); (II) 1 μL each of BC-F / R upstream and downstream primers (10 μM), and 0.5 μL each of BT-1-F / R, BL-F / R, BS-F / R, and BM-1-F / R upstream and downstream primers (10 μM). 0.5 μL; III: 1 μL each of BC-F / R upstream and downstream primers (10 μM), 0.5 μL each of BT-F / R, BL-1-F / R, BS-F / R, and BM-1-F / R upstream and downstream primers (10 μM); IV: 1 μL each of BC-F / R upstream and downstream primers (10 μM), 0.5 μL each of BT-F / R, BL-2-F / R, BS-F / R, and BM-2-F / R upstream and downstream primers (10 μM); 1 μL of DNA template (concentration of 100 ng / μL); add ddH2O to a final volume of 25 μL. The PCR reaction program was as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s, annealing at 63℃ for 1 min (decreasing by 0.5℃ per cycle), extension at 72℃ for 45 s, for 15 cycles; denaturation at 94℃ for 45 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, for 20 cycles; and incubation at 72℃ for 5 min.
[0092] PCR amplification was performed using primer combination I, and the electrophoresis results are as follows: Figure 2 As shown in Table 3, the strain numbers are as follows. As shown in the figure: Bacillus thuringiensis CICC 22945 (strain number 1) showed an amplification band, with a band size between 300-400 bp; Bacillus cereus CICC 21261 (strain number 2) and Bacillus cereus CGMCC 1.3760 (strain number 3) showed amplification bands, with a band size between 300-400 bp; Bacillus licheniformis CICC 10101 (strain number 4) and Bacillus licheniformis CICC10103 (strain number 5) showed amplification bands, with a band size between 500-600 bp; Bacillus subtilis CICC 23830 (strain number 6) showed amplification bands, with a band size between 500-600 bp; Bacillus mycosis fungoides CICC 24780 (strain number 7) showed amplification bands, with a band size between 900-1000 bp, and the remaining strains did not show amplification.
[0093] PCR amplification was performed using primer combination II, and the electrophoresis results are as follows: Figure 3As shown in the figure, each bacterial strain number is shown in Table 3. As can be seen from the figure, Bacillus thuringiensis CICC 22945 (strain number 1) has an amplified band, and the band size is between 1000-1500 bp; Bacillus cereus CICC 21261 (strain number 2), Bacillus cereus CGMCC 1.3760 (strain number 3) have amplified bands, and the band size is between 300-400 bp; Bacillus licheniformis CICC 10101 (strain number 4), Bacillus licheniformis CICC 10103 (strain number 5) have amplified bands, and the band size is between 500-600 bp; Bacillus subtilis CICC 23830 (strain number 6) has an amplified band, and the band size is between 500-600 bp; Bacillus mycoides CICC 24780 (strain number 7) has an amplified band, and the band size is between 1000-1500 bp; and enterotoxigenic Escherichia coli BCRC 15372 (strain number 8) has a weak amplified band, and the band size is between 200-300 bp.
[0094] The primer combination III was used for PCR amplification, and the electrophoresis result is shown in Figure 4 As shown in the figure, each bacterial strain number is shown in Table 3. As can be seen from the figure, Bacillus thuringiensis CICC 22945 (strain number 1) has an amplified band, and the band size is between 300-400 bp; Bacillus cereus CICC 21261 (strain number 2), Bacillus cereus CGMCC 1.3760 (strain number 3) have amplified bands, and the band size is between 300-400 bp; Bacillus subtilis CICC 23830 (strain number 6) has an amplified band, and the band size is between 500-600 bp; Bacillus mycoides CICC 24780 (strain number 7) has an amplified band, and the band size is between 1000-1500 bp; and Bacillus licheniformis CICC 10101 (strain number 4), Bacillus licheniformis CICC 10103 (strain number 5) have no amplified bands.
[0095] The primer combination IV was used for PCR amplification, and the electrophoresis result is shown in Figure 5As shown in the figure, the strain number is shown in Table 3. As can be seen from the figure: Bacillus thuringiensis CICC 22945 (strain number 1) has an amplified band, and the band size is between 300-400 bp; Bacillus cereus CICC 21261 (strain number 2), Bacillus cereus CGMCC 1.3760 (strain number 3) have amplified bands, and the band size is between 300-400 bp; Bacillus licheniformis CICC 10101 (strain number 4), Bacillus licheniformis CICC 10103 (strain number 5) have amplified bands, and the band size is between 400-500 bp; Bacillus subtilis CICC 23830 (strain number 6) has an amplified band, and the band size is between 500-600 bp; Bacillus mycoides CICC 24780 (strain number 7) has multiple amplified bands.
[0096] The PCR amplification results of the 19 strains using the primer combinations are shown in Table 5. Using primer combination I, Bacillus thuringiensis CICC 22945 (strain No. 1), Bacillus cereus CICC 21261 (strain No. 2), Bacillus cereus CGMCC 1.3760 (strain No. 3), Bacillus licheniformis CICC 10101 (strain No. 4), Bacillus licheniformis CICC 10103 (strain No. 5), Bacillus subtilis CICC 23830 (strain No. 6), Bacillus mycoides CICC 24780 (strain No. 7) showed "+" (bright amplification band), and the rest of the strains showed "-" (no amplification); using primer combination II, Bacillus thuringiensis CICC 22945 (strain No. 1), Bacillus cereus CICC 21261 (strain No. 2), Bacillus cereus CGMCC 1.3760 (strain No. 3), Bacillus licheniformis CICC 10101 (strain No. 4), Bacillus licheniformis CICC 10103 (strain No. 5), Bacillus subtilis CICC 23830 (strain No. 6), Bacillus mycoides CICC 24780 (strain No. 7) all showed "+" (bright amplification band), while enterotoxigenic Escherichia coli BCRC 15372 (strain No. 8) showed "*" (one fuzzy amplification band); using primer combination III, Bacillus thuringiensis CICC 22945 (strain No. 1), Bacillus cereus CICC 21261 (strain No. 2), Bacillus cereus CGMCC 1.3760 (strain No. 3), Bacillus subtilis CICC 23830 (strain No. 6), Bacillus mycoides CICC 24780 (strain No. 7) showed "+" (bright amplification band), but Bacillus licheniformis CICC 10101 (strain No. 4), Bacillus licheniformis CICC 10103 (strain No. 5) showed "-" (no amplification); and using primer combination IV, Bacillus thuringiensis CICC 22945 (strain No. 1), Bacillus cereus CICC 21261 (strain No. 2), Bacillus cereus CGMCC 1.3760 (strain No. 3), Bacillus licheniformis CICC 10101 (strain No. 4), Bacillus licheniformis CICC 10103 (strain No. 5), Bacillus subtilis CICC 23830 (strain No. 6) showed "+" (bright amplification band), and Bacillus mycoides CICC 24780 (strain No. 7) showed "*" (multiple amplification bands).In summary, the primer combination I (BT-F / R, BC-F / R, BL-F / R, BS-F / R and BM-F / R) designed and screened by the application is most suitable for specific detection of Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides, and has obvious advantages compared with other primer combinations.
[0097] Table 5 PCR amplification results of 19 strains by each primer combination
[0098]
[0099] Note: "+" represents a bright amplification band, "*" represents an amplification band that is fuzzy or has multiple amplification bands, and "-" represents no amplification.
[0100] Example 3: Detection sensitivity of multiplex PCR
[0101] The optimal primer combination (primer combination I: 1 μL of each of BC-F / R upper and lower primers (10 μM), and 0.5 μL of each of BT-F / R, BL-F / R, BS-F / R and BM-F / R upper and lower primers (10 μM)) is screened out. In order to explore the detection sensitivity of the five Bacillus strains to the primer combination I, Bacillus thuringiensis CICC 22945, Bacillus cereus CICC 21261, Bacillus cereus CGMCC 1.3760, Bacillus licheniformis CICC 10101, Bacillus licheniformis CICC 10103, Bacillus subtilis CICC 23830 and Bacillus mycoides CICC 24780 are used as templates. Each strain is gradiently diluted, so that the final concentration of each strain is 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL and 1 pg / μL. The DNA of the seven Bacillus strains with different concentrations is used as a template, and a 25 μL PCR reaction system is set: 0.2 μL of TaKaRa Ex Taq (5 U / μL); 2.5 μL of 10×Ex Taq Buffer (Mg 2+ plus) (20 mM); 2 μL of dNTP Mixture (2.5 mM each); 1 μL of each of BC-F / R upper and lower primers (10 μM) in the primer combination I, and 0.5 μL of each of BT-F / R, BL-F / R, BS-F / R and BM-F / R upper and lower primers (10 μM); 1 μL of DNA template; and ddH2O is added to 25 μL. The PCR reaction program is as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s, annealing at 63℃ for 1 min (decrease by 0.5℃ for each cycle), extension at 72℃ for 45 s, 15 cycles; denaturation at 94℃ for 45 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 20 cycles; and incubation at 72℃ for 5 min.
[0102] The electrophoresis results are shown in Figure 6 Table 6. As shown in Table 6, the PCR amplification results of 7 strains of Bacillus with different DNA concentrations using the primer combination of the present application (5 primer pairs shown in the first to fifth primer groups: BT-F / R, BC-F / R, BL-F / R, BS-F / R and BM-F / R) are shown in Table 6. As shown in Figure 6 A, the DNA concentration of Bacillus thuringiensis CICC 22945 is 100 ng / μL, 10 ng / μL, 1 ng / μL, and there is an amplification band, the band size is between 300-400 bp, the band size meets the expected experiment, 100 pg / μL amplification band is weak, and 10 pg / μL, 1 pg / μL has no visible band; from Figure 6 B, 6C, it can be seen that the DNA concentration of Bacillus cereus CICC21261 and Bacillus cereus CGMCC 1.3760 is 100 ng / μL, 10 ng / μL, and there is an amplification band, the band size is between 300-400 bp, the band size meets the expected experiment, 1 ng / μL amplification band is weak, and 100 pg / μL, 10 pg / μL, 1 pg / μL has no visible band; from Figure 6 D, 6E, it can be seen that the DNA concentration of Bacillus licheniformis CICC 10101 and Bacillus licheniformis CICC 10103 is 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, and there is an amplification band, the band size is between 500-600 bp, the band size meets the expected experiment, 10 pg / μL amplification band is weak, and 1 pg / μL has no visible band; from Figure 6 F, it can be seen that the DNA concentration of Bacillus subtilis CICC 23830 is 100 ng / μL, 10 ng / μL, 1 ng / μL, and there is an amplification band, the band size is between 500-600 bp, the band size meets the expected experiment, 100 pg / μL amplification band is weak, and 10 pg / μL, 1 pg / μL has no visible band; from Figure 6 G, it can be seen that the DNA concentration of Bacillus mycoides CICC 24780 is 100 ng / μL, 10 ng / μL, and there is an amplification band, the band size is between 900-1000 bp, the band size meets the expected experiment, 1 ng / μL amplification band is weak, and 100 pg / μL, 10 pg / μL, 1 pg / μL has no visible band.
[0103] As seen from Table 6, using the primer combination (the five primer pairs of the first primer group to the fifth primer group: BT-F / R, BC-F / R, BL-F / R, BS-F / R and BM-F / R) of the present application, the detection result of 1 ng / μL Bacillus thuringiensis CICC 22945 is "+", the detection result of 100 pg / μL Bacillus thuringiensis CICC 22945 is "*", the detection result of 10 ng / μL Bacillus cereus CICC 21261 and Bacillus cereus CGMCC 1.3760 is "+", the detection result of 1 ng / μL Bacillus cereus CICC 21261 and Bacillus cereus CGMCC 1.3760 is "*", the detection result of 100 pg / μL Bacillus licheniformis CICC 10101 and Bacillus licheniformis CICC 10103 is "+", the detection result of 10 pg / μL Bacillus licheniformis CICC 10101 and Bacillus licheniformis CICC 10103 is "*", the detection result of 1 ng / μL Bacillus subtilis CICC 23830 is "+", the detection result of 100 pg / μL Bacillus subtilis CICC 23830 is "*", the detection result of 10 ng / μL Bacillus mycoides CICC 24780 is "+", and the detection result of 1 ng / μL Bacillus mycoides CICC 24780 is "*". The detection results show that using the five primer pairs, the detection limit of Bacillus thuringiensis is 1 ng / μL, the detection limit of Bacillus cereus is 10 ng / μL, the detection limit of Bacillus licheniformis is 100 pg / μL, the detection limit of Bacillus subtilis is 1 ng / μL, and the detection limit of Bacillus mycoides is 10 ng / μL.
[0104] Table 6 Multiplex PCR amplification results of primer combination I on 7 strains of Bacillus with different DNA concentrations
[0105]
[0106] Note: "+" indicates bright amplification bands, "*" indicates fuzzy amplification bands or multiple amplification bands, and "-" indicates no amplification.
[0107] From the results of the above-mentioned examples, it can be seen that the multiplex PCR identification method established by the present application has good effects for identifying Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides. Therefore, using the multiplex PCR method of the present application to identify Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides in the environment has great application value.
[0108] The present application is based on the principle of multiplex PCR, and through special analysis, comparison and optimization, the multiplex PCR primer set (i.e. primer combination I: including the first primer group to the fifth primer group) of the present application is finally designed. Using the primer set, the multiplex PCR detection of Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis and Bacillus mycoides can be carried out, and the five kinds of Bacillus can be detected at the same time, and the method has excellent sensitivity, is more efficient, economical and simple than ordinary PCR, and can meet the requirements of simultaneous detection in production.
[0109] Although the present application has been illustrated and described with reference to specific embodiments, it is realized that many other changes and modifications can be made therein without departing from the spirit and scope of the present application. Therefore, it is meant to include all such changes and modifications within the scope of the appended claims.
Claims
1. A primer set, characterized in that, comprises at least one of (1)-(5) below: (1) a first primer set for detecting Bacillus thuringiensis, wherein the upstream and downstream primers of the first primer set have sequences shown in SEQ ID NOs: 1-2, or sequences having at least 80% homology with SEQ ID NOs: 1-2, in order; (2) a second primer set for detecting Bacillus cereus, wherein the upstream and downstream primers of the second primer set have sequences shown in SEQ ID NOs: 5-6, or sequences having at least 80% homology with SEQ ID NOs: 5-6, in order; (3) a third primer set for detecting Bacillus licheniformis, wherein the upstream and downstream primers of the third primer set have sequences shown in SEQ ID NOs: 7-8, or sequences having at least 80% homology with SEQ ID NOs: 7-8, in order; (4) a fourth primer set for detecting Bacillus subtilis, wherein the upstream and downstream primers of the fourth primer set have sequences shown in SEQ ID NOs: 13-14, or sequences having at least 80% homology with SEQ ID NOs: 13-14, in order; (5) a fifth primer set for detecting Bacillus mycoides, wherein the upstream and downstream primers of the fifth primer set have sequences shown in SEQ ID NOs: 15-16, or sequences having at least 80% homology with SEQ ID NOs: 15-16, in order.
2. Use of the primer set of claim 1 in detecting Bacillus, or use of the primer set of claim 1 in preparing a kit for detecting Bacillus.
3. Use according to claim 4, characterized in that, The Bacillus comprises at least one of Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis, and Bacillus mycoides.
4. Use according to claim 3, characterized in that, The Bacillus comprises Bacillus thuringiensis, Bacillus cereus, Bacillus licheniformis, Bacillus subtilis, and Bacillus mycoides.
5. A kit, characterized in that, The kit comprises the primer set of any one of claims 1-3.
6. The kit according to any one of claims 5 to 7, characterized in that, The kit further comprises at least one of a PCR amplification reagent, a DNA extraction reagent, and a nucleic acid purification reagent.
7. The kit of claim 6, wherein The PCR reagent comprises at least one of a buffer, a dNTP mixture, ddH2O, and Taq enzyme.
8. A multiplex PCR detection method for non-diagnostic purposes, characterized by, The kit comprises the following steps: PCR amplification of a sample using the primer set of claim 1 or the kit of any one of claims 5-7; electrophoresis of the amplification product, and identification of the pathogenic bacteria in the sample according to the bands.
9. The multiplex PCR detection method according to claim 8, wherein, The PCR amplification procedure comprises: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 45 s, annealing at 63℃ for 1 min, 15 cycles of decreasing annealing temperature by 0.5℃ per cycle, extension at 72℃ for 45 s; denaturation at 94℃ for 45 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 20 cycles; incubation at 72℃ for 5 min.
10. The multiplex PCR detection method according to claim 8, characterized in that, The identification criteria comprise: if a 344 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus thuringiensis; if a 365 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus cereus; if a 541 bp band is generated by electrophoresis, the strain to be tested is classified as Bacillus licheniformis; If 501 bp band is produced by electrophoresis, the strain to be tested is classified as Bacillus subtilis; If 968 bp band is produced by electrophoresis, the strain to be tested is classified as Bacillus mycoides.