Method for detecting low-concentration sample by combining microorganism enrichment magnetic beads and multiplex PCR (Polymerase Chain Reaction) technology

By combining magnetic nanobeads and multiplex PCR technology, the problems of sensitivity in detecting low-concentration microbial samples and simultaneous detection of multiple microorganisms have been solved, achieving rapid and accurate microbial detection with a detection limit of 50 copies/mL, simplifying operation and being environmentally friendly.

CN120905413APending Publication Date: 2025-11-07THE PEOPLES HOSPITAL SHAANXI PROV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511172006.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-21
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies have low sensitivity for detecting low-concentration microbial samples, making it impossible to detect multiple microorganisms simultaneously and rapidly. Furthermore, traditional culture methods are time-consuming, and immunomagnetic bead technology suffers from cross-reaction and uneven separation efficiency.

Method used

By combining superparamagnetic bio-derived magnetic nanobeads with a particle size of 50-100 nm with multiplex PCR technology, aerobic and anaerobic bacteria can be enriched separately or together. Specific primers and probes are designed for multiplex PCR detection, simplifying the operation process and avoiding the use of complex equipment.

Benefits of technology

It enables rapid, accurate, and sensitive detection of multiple microorganisms in low-concentration samples, with a detection limit of 50 copies/mL, shortening the detection time to within 4.5 hours, and is simple and environmentally friendly to operate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905413A_ABST
    Figure CN120905413A_ABST
Patent Text Reader

Abstract

The invention relates to the fields of biotechnology, molecular biology and clinical diagnosis, in particular to a method for efficiently enriching aerobic bacteria and anaerobic bacteria by utilizing a mixture of multiple microorganism enrichment magnetic bead reagents and combining with a multiplex polymerase chain reaction (PCR) technology so as to improve the detection efficiency of a low-concentration microorganism sample. The method is suitable for pathogenic microorganism detection in medical examination.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the fields of biotechnology, molecular biology and clinical diagnosis, and particularly relates to a method for efficiently enriching aerobic bacteria and anaerobic bacteria using a mixture of magnetic bead reagents of multiple microorganisms, and combining with multiplex polymerase chain reaction (PCR) technology. BACKGROUND

[0002] Traditional microbial detection relies on culture method, which is time-consuming (2-7 days) and low in sensitivity, and cannot meet the demand of rapid screening. Existing immunomagnetic bead technology is mostly targeted at single microorganism, and there are problems such as antibody cross-reaction and uneven magnetic field separation efficiency in mixed magnetic bead application. In existing technology, magnetic beads have been widely used in the separation and enrichment of biological samples, especially in the field of microbial detection. However, the application of immunomagnetic beads for specific microorganisms in broad-spectrum enrichment is limited, and there is a lack of systematic study on the compatibility of single magnetic beads and mixed magnetic beads in subsequent PCR detection. Therefore, it is particularly important to develop an immunomagnetic bead reagent that can achieve broad-spectrum enrichment and ensure compatibility with PCR detection.

[0003] In microbiological research and practical application, the detection of low-concentration microbial samples has always been a challenge. Traditional methods such as culture method are time-consuming and cannot cover all types of microorganisms; while molecular biology-based methods such as PCR have high sensitivity and specificity, but their detection rate is often limited by the number of target microorganisms in the sample. Especially in complex matrix or high background noise samples, direct PCR analysis may lead to false negative results. Therefore, how to effectively enrich target microorganisms and improve the sensitivity of subsequent molecular biology analysis becomes a key problem.

[0004] Bacteria are roughly divided into two categories: aerobic bacteria and anaerobic bacteria. Aerobic bacteria need oxygen to grow and reproduce, while anaerobic bacteria do not need oxygen or even have difficulty surviving in an aerobic environment. Due to the wide existence of these two types of bacteria in nature and human body, their existence form and living environment differ greatly, which puts higher requirements on their effective enrichment. Existing technologies are mostly designed for single type or limited types of microorganisms, and it is difficult to meet the demand of simultaneous detection of multiple types of microorganisms in complex samples. In addition, different types of bacteria may require different enrichment conditions, which further increases the difficulty of technology implementation. SUMMARY

[0005] The present application aims to provide a method and kit for detecting low-concentration samples by combining microbial mixed enrichment magnetic beads with multiplex PCR technology, which can efficiently enrich aerobic bacteria and anaerobic bacteria by using a variety of microbial enrichment magnetic bead reagent mixtures, and can improve the detection efficiency of low-concentration microbial samples by combining with multiplex polymerase chain reaction (PCR) technology, so as to solve the problems of low sensitivity, complex operation and inability to simultaneously detect multiple microorganisms in the prior art, and achieve rapid, accurate and sensitive detection of multiple microorganisms in low-concentration samples.

[0006] The first aspect of the present application is to provide a method for detecting the above-mentioned multiple microorganisms, comprising the following steps: The magnetic beads are selected from superparamagnetic biological nanometer magnetic beads with a particle size of 50-100 nm, which have good magnetic responsiveness and dispersibility, and are easy to manipulate and separate.

[0007] The aerobic bacteria genus includes, but is not limited to, one or more of Escherichia, Staphylococcus, Klebsiella, Acinetobacter, Streptococcus, Pseudomonas, Enterococcus, Proteus and other aerobic bacteria genera; The anaerobic bacteria genus includes, but is not limited to, one or more of Prevotella, Peptoniphilus, Peptostreptococcus, Veillonella, Bifidobacterium, Clostridium, Bacteroides, and Lactobacillus.

[0008] In one specific embodiment, the aerobic bacteria genus is divided into an independent multiplex PCR system for detection, In another specific embodiment, the anaerobic bacteria genus is divided into an independent multiplex PCR system for detection, In a preferred embodiment, the aerobic bacteria genus and the anaerobic bacteria genus are both subjected to a multiplex PCR for detection.

[0009] Enrichment process 1) Commercially available magnetic beads are taken together in an amount of 20-200 μl, and are placed in EP tubes. The supernatant is removed by magnetic separation equipment. The tubes are sequentially labeled 1-8.

[0010] 2) 1 mL of the sample to be enriched is added to EP tube 1, and a pipette is repeatedly sucked and hit (at least 10 times) or a vortex device is used for mixing (for 15 s); 3) The EP tube is placed on a constant-temperature mixing device, the incubation temperature is set to 37℃, the mixing speed (1200 r) is adjusted to uniformly disperse the enrichment magnetic beads in the solution, and the incubation time is set to 30 min; 4) After the reaction, the sample is separated by magnetic attraction for 30-60 s, and part of the supernatant is removed to the required liquid volume for subsequent experiments, such as 200-500 μl of supernatant for PCR.

[0011] 5) Place the supernatant removed in step 4 into EP tube 2 and repeatedly pipette (at least 10 times) or mix using a vortex mixer (15 seconds). Repeat steps 3-5 several times.

[0012] Cleaning process 1) Following step 3 of the enrichment process, after the reaction is complete, the sample is separated by magnetic attraction for 1-2 minutes, and all supernatant is removed; (the removed supernatant can be used in step 5) 2) Add 1 mL of PBS buffer or saline along the tube wall to rinse, gently blow twice, fix the EP tube on the magnetic separation device, and remove all supernatant after it is completely magnetically attracted again. 3) Repeat the above steps 2-3 times; 4) Add the amount of PBS buffer or physiological saline to the EP tube to resuspend the enriched magnetic beads.

[0013] Precautions 1) If the sample background is relatively clear, only the [Enrichment Process] should be used; 2) If the sample is viscous, such as blood or sputum, use the [Enrichment Process] + [Washing Process]; 3) If the enriched magnetic beads agglomerate before use, they can be simply dispersed by ultrasound before use (ultrasound dispersion conditions: 90w, 10min).

[0014] 4) After enrichment, the reserved supernatant is used for nucleic acid extraction.

[0015] Multiplex PCR procedure 1) Primer design: Design specific primers based on the multiple target gene sequences to be amplified. It is important to ensure that the primers do not contain complementary sequences to avoid primer dimers, and that the primers have similar specificity and annealing temperatures.

[0016] Suitable target genes for the above strains were found in NCBI and primers and probes were designed. The following primer and probe combinations were selected through screening processes such as primer and probe specificity BLAST and Tm value.

[0017] Table 1. Primer and probe combinations for multiplex PCR Escherichia coli upstream primer F-AAGCGTGGTGATGTGGAGTA (SEQ ID NO: 1) downstream primer R-CGCTTCGAAACCAATGCCTA (SEQ ID NO: 2) probe FAM-ACTGCTGCTGTCGGCTTTAACCTCT-BHQ1 (SEQ ID NO: 3) Staphylococcus aureus upstream primer F-TGCTGGTGGTACATCAAATGC (SEQ ID NO: 4) downstream primer R-GTGCGGTATATGCTGCGTAA (SEQ ID NO: 5) probe HEX-CCCATTGCACTGCATAACTTCCGGCA-BHQ1 (SEQ ID NO: 6) Klebsiella oxytoca upstream primer F-CAGAAGAAGCACCGGCTAAC (SEQ ID NO: 7) downstream primer R-CACCTGAGCGTCAGTCTTTG (SEQ ID NO: 8) probe Cy5-CAGACCGCCTGCGTGCGCTT-BHQ2 (SEQ ID NO: 9) Acinetobacter baumannii upstream primer F-TTGATTTAACTGCGCTGCGA (SEQ ID NO: 10) downstream primer R-TATTTCGTTGGCGTGGTGAC (SEQ ID NO: 11) probe FAM-ACCCACCGTAGGTACAGGCGC-BHQ1 (SEQ ID NO: 12) Streptococcus pneumoniae upstream primer F-CAGGCTGGCAGAAGAATGAC (SEQ ID NO: 13) downstream primer R-GTACTTGACCCAGCCTGTCT (SEQ ID NO: 14) probe HEX-TGCTTCCTCCAGCGGTCTGCA-BHQ1 (SEQ ID NO: 15) Pseudomonas aeruginosa upstream primer F-ATGGAAATGCTGAAATTCGGC (SEQ ID NO: 16) downstream primer R-CTTCTTCAGCTCGACGCGACG (SEQ ID NO: 17) probe Cy5-CTCGACGCGACGTTGAT-BHQ2 (SEQ ID NO: 18) Enterococcus faecalis upstream primer F-CATGATCACTGGTGCTGCTC (SEQ ID NO: 19) downstream primer R-TCATCGCCTGGGAAATCGTA (SEQ ID NO: 20) probe FAM-TGCTGCTGATGGTCCTATGCCTCA-BHQ1 (SEQ ID NO: 21) Proteus mirabilis upstream primer F-AATACCGTGGACGAGCATCT (SEQ ID NO: 22) downstream primer R-TCATCGCCTGGGAAATCGTA (SEQ ID NO: 20) probe FAM-TGCTGCTGATGGTCCTATGCCTCA-BHQ1 (SEQ ID NO: 21) R-CGCTATCACCCGCTAATGTG (SEQ ID NO: 23) Probe HEX-ACGCACTTGGCAGTGTGCACA-BHQ1 (SEQ ID NO: 24) M. melaninogenica Forward primer F-ACGGCCCTATGGGTTGTAAA (SEQ ID NO: 25) Reverse primer R-CTTCGCGATCGGAGTTCTTC (SEQ ID NO: 26) Probe Cy5-ATTCCGTGCCAGCAGCCGCG-BHQ2 (SEQ ID NO: 27) S. anaerobius Forward primer F-GGCCACATTGGAACTGAGAC (SEQ ID NO: 28) Reverse primer R-TGAGCCGTAGCCTTTAACCA (SEQ ID NO: 29) Probe FAM-CTACGTGCCAGCAGCCGCGG-BHQ1 (SEQ ID NO: 30) V. irregularis Forward primer F-TGCAGTATGGTCTCATGCCA (SEQ ID NO: 31) Reverse primer R-ATAGCGGGCTGACCGATAAA (SEQ ID NO: 32) Probe HEX-TGGGCAGCATCGCGAACACC-BHQ1 (SEQ ID NO: 33) B. bifidum Forward primer F-TTTCATCGAAACGCCGTACC (SEQ ID NO: 34) Reverse primer R-ATGACGTCACCGGAATCGTA (SEQ ID NO: 35) Probe Cy5-CGCCATTCGGAGCCGGTGCC-BHQ2 (SEQ ID NO: 36) C. perfringens Forward primer F-GGCTTTAGCATTAACAGCACCT (SEQ ID NO: 37) Reverse primer R-TCACTTGTTGACGAAAGTTTGTT (SEQ ID NO: 38) Probe FAM-TGTTCCTCGCCATTGAGTAGTTTCCCA-BHQ1 (SEQ ID NO: 39) B. fragilis Forward primer F-GGTGATCTATGTGGGCGGTA (SEQ ID NO: 40) Reverse primer R-CCGCATAAGTCTGCATGGTC (SEQ ID NO: 41) Probe HEX-TGCCAGGCTGTGTGCTTATGCTCCC-BHQ1 (SEQ ID NO: 42) Internal control Forward primer GAAGGTGAAGGTCGGAGTC Reverse primer GAAGATGGTGATGGGATTTC Probe FAM-CAAGCTTCCCGTTCTCAGCC-BHQ1 2) Preparing template DNA: Extract DNA from the sample to be tested to serve as the template for the PCR reaction. The sample is the supernatant reserved after enrichment with magnetic beads. Appropriate DNA extraction methods and kits must be used to obtain a high-quality DNA template.

[0018] Table 2 PCR reaction system Component Volume / concentration 2x TaqMan Universal Mix 12.5 μL Forward primer (0.4 μM each) 0.5 μL each (7.5 μL total) Reverse primer (0.4 μM each) 0.5 μL each (7.5 μL total) Probe (0.2 μM each) 0.25 μL each (3.75 μL total) Template DNA 2 μL ddH2O qPCR mix 3) Multiplex PCR: Table 3 PCR reaction procedure 25 μL Step Temperature Time 95°C Pre-denaturation 10 minutes 95°C Denaturation 30 seconds 58°C Annealing 30 seconds 72°C Extension 30 seconds 72°C Final extension 5 minutes 4°C ∞ 4) PCR product detection: ③ Fluorescent quantitative PCR detection: if a fluorescent dye or a fluorescently labeled probe is added in the reaction system, the change of the fluorescent signal in the PCR process can be monitored in real time by a fluorescent quantitative PCR instrument, so as to quantitatively analyze the target gene. A series of standard samples with known concentrations are set, fluorescent quantitative PCR amplification is carried out, and the fluorescent signal intensity corresponding to different concentrations of standard samples is obtained. The logarithm of the initial copy number of the standard sample is taken as the abscissa, and the corresponding cycle threshold (Ct value) is taken as the ordinate, and a standard curve is drawn. Then the same PCR amplification is carried out on the sample to be tested, and the corresponding initial copy number is obtained on the standard curve according to the Ct value, so as to realize the quantitative analysis of the unknown sample. The Ct value is inversely proportional to the initial template amount, that is, the more the initial template amount, the smaller the Ct value; on the contrary, the less the initial template amount, the greater the Ct value. This is because in the exponential growth period of PCR reaction, the growth of fluorescent signal is directly related to the template amount, and by detecting the cycle number of the fluorescent signal reaching the threshold value, the amount of the initial template can be reflected.

[0019] A second object of the present application is to provide a kit for simultaneously detecting the above-mentioned microorganisms, which comprises the above-mentioned primers and probes, sample extraction reagents, multiplex digital PCR detection reagents, negative control samples and internal reference genes. The sample extraction reagents are commercial kits, including but not limited to nucleic acid fragments of corresponding strains obtained by using a bacterial nucleic acid extraction kit (Tiangen, item number: DP302-02), and the operation steps are described in the kit instruction manual. The multiplex digital PCR detection reagents include PCR Mix reaction solution and ultrapure water. The negative control sample is water.

[0020] A third object of the present application is to provide the application of the above-mentioned kit. The specific primers and probe combination provided by the present application can be used for direct identification of common human pathogenic bacteria in clinical samples such as blood, pleural effusion, ascites, cerebrospinal fluid, urine, etc. The specific target nucleic acid fragments of Escherichia coli, Staphylococcus aureus, Klebsiella oxytoca, Acinetobacter baumannii, Streptococcus pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Proteus mirabilis, Prevotella melaninogenica, Anaerobic Peptostreptococcus, Veillonella dispar, Bifidobacterium bifidum, Clostridium perfringens and Bacteroides fragilis, etc. can be quickly and accurately detected from the clinical samples, without the need for bacterial culture, greatly shortening the identification time of pathogenic bacteria and improving the positive detection of low copy number nucleic acid fragments of pathogenic bacteria.

[0021] Advantages High sensitivity: Microbial mixed enrichment magnetic beads can enrich microorganisms in low concentration samples, greatly improving the concentration of microorganisms in the sample, and combining the high amplification efficiency of multiplex PCR technology, the detection sensitivity is greatly improved. The multiplex PCR for the above-mentioned microorganisms can detect 50 copies / ml of target bacteria.

[0022] Simultaneous detection of multiple microorganisms: Multiplex PCR technology can simultaneously amplify the nucleic acids of multiple microorganisms in one reaction system, combined with the non-specific adsorption of microbial mixed enrichment magnetic beads to multiple microorganisms, which can realize the simultaneous detection of multiple microorganisms in the sample, and overcome the deficiency that immunomagnetic separation technology can only specifically separate one target microorganism at a time.

[0023] Simple and fast operation: The entire detection process is relatively simple and does not require complex instruments and equipment. The use of microbial mixed enrichment magnetic beads avoids complex operations such as high-speed centrifugation, reducing the number of operation steps and time. At the same time, the optimized multiplex PCR reaction system and detection method can complete the detection in a relatively short time, such as the detection time of pathogenic bacteria can be shortened to 4.5 hours or less.

[0024] Green and environmentally friendly: The entire detection process does not involve the use of toxic organic solvents, in line with the concept of green and environmentally friendly. BRIEF DESCRIPTION OF DRAWINGS

[0025] Hold Figure 14 of the present application 14 PCR amplification results DETAILED DESCRIPTION

[0026] The nucleic acid aptamer for simultaneously identifying multiple malignant tumor cells, thyroid cancer cells, and its application provided by the present application will be further described in detail and completely in conjunction with the following examples. The examples described below are exemplary and are only used to explain the present application, and cannot be understood as limiting the present application.

[0027] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0028] Example 1 Specificity and sensitivity of multiplex detection According to the related strains obtained from the ATCC bacterial library or commercially available, the related culture methods of the strain instruction manual were used for amplification culture, and the bacterial nucleic acid extraction kit (brand: Tian Gen, product number: DP302-02) was used to obtain the nucleic acid fragments of the corresponding strains.

[0029] The specificity of the above primer probe was tested on a digital PCR platform, as shown in Table 4. For example, the specific primer probe for E. coli was used to amplify the genomic templates of E. coli, S. aureus, K. oxytoca, A. baumannii, S. pneumoniae, P. aeruginosa, E. faecalis, P. mirabilis, P. melaninogenicum, A. lactolyticus, V. dispar, B. bifidum, C. perfringens, B. fragilis and other control strains, respectively. The corresponding primer probe for each strain is shown in Table 1, and PCR experiments were performed in sequence.

[0030] The PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3.

[0031] Table 4: Test results of specificity Figure 1 Strain name Detection result + Escherichia coli + Staphylococcus aureus + Klebsiella oxytoca + Acinetobacter baumannii + Streptococcus pneumoniae + Pseudomonas aeruginosa + Enterococcus faecalis + Proteus mirabilis + Prevotella melaninogenica + Peptostreptococcus anaerobius + Veillonella dispar + Bifidobacterium bifidum + Clostridium perfringens + Bacteroides fragilis - Mycoplasma pneumoniae - Enterobacter cloacae - Staphylococcus hominis - Cryptococcus neoformans - Haemophilus parainfluenzae - Streptococcus pyogenes - + indicates specific band amplification, and - indicates no.

[0032] The results show that the corresponding primer probe only obtains a positive amplification signal in the corresponding strain template experiment, and the other groups show negative results. This indicates that the kit has high specificity and can accurately and specifically detect the above target microorganisms, i.e., it has high detection specificity.

[0033] Sensitivity detection: On the digital PCR platform, first, the copy number calibration experiment of the mixed strain template group was performed to determine the detection limit.

[0034] The strain mixture was tested at 100 copies / mL, 50 copies / mL, 30 copies / mL and 20 copies / mL, respectively, and each concentration gradient was tested 20 times.

[0035] The experimental detection results are shown in Table 4. Staphylococcus epidermidis Figure 1 As shown in Table 4, among the 14 target strains in the kit, the detection limit of 50 copies / ml, 20 groups of positive signals can be completely detected. That is, the detection limit of the multiplex PCR is 50 copies / mL.

[0036] Example 2: Detection of pathogenic bacteria in clinical blood samples Sample processing and enrichment: Collect 5 mL of blood samples from patients with bacterial infections, and add them to reaction tubes containing 20-200 μL of microorganism enrichment magnetic beads. Incubate at 37°C with 120 rpm shaking for 30 minutes. Then place the reaction tube in a magnetic field, discard the supernatant, and wash the magnetic beads with PBS-Tween buffer 4 times.

[0037] Multiplex PCR reaction: The cell lysis of the enriched magnetic bead-microorganism complex was performed to prepare the DNA template. The microbial nucleic acid extraction used a Genorad extraction kit, item number: DP302-02, and the operation steps are described in the kit instructions. The multiplex PCR reaction system is constructed, wherein the PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3.

[0038] The results show that, in 50 clinical samples, 32 positive cases of the above bacterial infection exist, and 18 cases are negative, 31 positive cases are detected by the kit of the application, and 19 cases are negative, which are the same as the results of clinical diagnosis, so the accuracy of the application is 49 / 50=98%.

[0039] The above results show that the primers and the method of the application can be used for pathogen detection, and the detection result is accurate and reliable.

[0040] The above describes preferred embodiments of the application in detail. It should be understood that those skilled in the art can make many modifications and changes without creative labor according to the concept of the application. Therefore, any technical solution obtained by logical analysis, reasoning or limited experiment on the basis of the prior art according to the concept of the application should be within the protection scope determined by the claims.

Claims

1. A primer probe combination for multiplex PCR, characterized by, The primer probe combination is shown as SEQ ID NO: 1-42.

2. The primer probe combination of claim 1, which can detect one or more of E. coli, S. aureus, K. oxytoca, A. baumannii, S. pneumoniae, P. aeruginosa, E. faecalis, P. mirabilis, P. melaninogenicum, A. succinolyticus, V. dispar, B. bifidum, C. perfringens, B. fragilis.

3. The primer probe combination of claim 1, wherein, The fluorescent groups at both ends of the probe can be selected from FAM, HEX, TET, ROX, Cy5, Cy3, VIC, JOE, TAMRA, and the quenching group can be selected from BHQ-1, BHQ-2, BHQ-3, TAMRA, DABCYL, Iowa Black.

4. A pathogenic bacteria detection kit, characterized by, The primer probe combination of any one of claims 1-3.

5. The kit of claim 4, wherein Further comprising PCR Mix and nucleic acid extraction reagents.

6. The kit of claim 4, wherein Further comprising negative controls and internal reference genes.

7. A method for detecting low concentration samples by combining microorganism enrichment magnetic beads with multiplex PCR technology, comprising the following steps: (1) Magnetic bead enrichment: adding the sample to be detected into a reaction tube containing 20-200 μL of microorganism enrichment magnetic beads, incubating at 37°C under 120 rpm oscillation for 30 minutes. Then placing the reaction tube in a magnetic field, discarding the supernatant, and washing the magnetic beads with PBS-Tween buffer 4 times; (2) DNA extraction: using a commercially available kit to extract nucleic acids; (3) Multiplex PCR detection: configuring the primer probe combination of claim 1 into a suitable PCR reaction system for PCR reaction; (4) Result determination.

8. The method of claim 6, which can comprise a washing process after the magnetic bead enrichment process.

9. Use of the primer probe combination of any one of claims 1-3 or the kit of any one of claims 4-6 in the preparation of a pathogenic bacteria detection kit.

10. The use of claim 9, further comprising a process of enriching microorganisms by magnetic beads before extracting nucleic acids from the sample.