Clostridium and its use in the fermentative production of alcohols

Abstract

The application relates to a Clostridium and application thereof in alcohol fermentation production, and belongs to the technical field of industrial microorganisms. The Clostridium is a carbon monoxide-eating Clostridium strain Clostridium carboxidivorans GG6, which is preserved in the China General Microbiological Culture Collection Center and has a preservation number of CGMCC No. 34975 and a preservation time of June 23, 2025. The carbon monoxide-eating Clostridium GG6 is obtained through enrichment of a coal chemical plant tail gas flue deposit by a rich culture medium, evolution by a screening culture medium and separation of single bacteria. The strain produces acetic acid, ethanol, butyric acid and butanol by fermentation with synthesis gas (CO / H2 / CO2) as raw gas, and the biomass OD 600 >=6, wherein the produced ethanol concentration is >=10 g / L, and the produced butanol concentration is >=2.5 g / L, which helps to promote commercial implementation of gas fermentation production of butanol.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of industrial microorganisms, and in particular to a Clostridium and its application in fermentation for producing alcohol. BACKGROUND

[0002] Both ethanol and butanol are important bulk chemicals, which can be directly used as fuel additives, and are raw materials for preparing aviation kerosene (SAF). In the traditional yeast fermentation process for producing ethanol and solvent Clostridium fermentation process for producing butanol, the cost of raw materials such as starch, molasses, and straw sugar accounts for more than half of the total production cost, and there is a problem of competing with people for food. In the industrial processes of coal chemical industry, steel, metallurgy, coking, and the gasification process of biomass or solid waste, a large amount of carbon-containing gas (such as CO2, CO, CH4) which has not been converted into high value is produced. Using these carbon-containing gases as a substitute for carbon source in fermentation is a more sustainable and low-carbon footprint choice.

[0003] Acetogenic bacteria are a class of anaerobic microorganisms that can grow autotrophically by producing acetate through the Wood-Ljungdahl pathway using syngas components (CO, CO2 and H2). Some strains can also produce ethanol, butyric acid, butanol, lactic acid, 2,3-BDO and other partial products. In addition, the bacterial protein obtained by centrifugation and drying of the fermentation bacteria can also replace soybean meal for livestock and aquaculture. Therefore, the gas fermentation technology of producing higher value-added chemicals by acetogenic bacteria fermentation of syngas and co-producing bacterial protein has attracted attention. Among them, Clostridium autoethanogenum uses steel and iron alloy industrial tail gas containing CO, CO2 and H2 to co-produce ethanol and bacterial protein, which has realized commercial application and is a supplement to the existing ethanol fermentation production technology. Some acetogenic bacteria, such as C. carboxidivorans P7 and P20, and C. muellerianum P21, produce longer carbon chain butyric acid, butanol, etc. in addition to acetate and ethanol. Butyric acid can be used in the breeding industry to improve intestinal health, enhance immunity, and improve feed utilization. The acetone-butanol-ethanol (ABE) fermentation of solvent-producing Clostridium is a traditional butanol fermentation process, but it has been discontinued due to its low economic efficiency due to high raw material cost and low substrate conversion rate.

[0004] The above-mentioned Clostridium gas fermentation technology provides a new way for the fermentation production of butanol, but the existing laboratory strains have poor tolerance to syngas, and the biomass (0.5 g / L dry weight, OD 600 How to improve the growth and fermentation performance of existing laboratory strains or screen new strains with fast growth rate and good robustness is the key to promoting the commercial application of gas fermentation technology for producing butanol. SUMMARY

[0005] The technical problem solved by the present application: In view of the problems of low biomass, insufficient ethanol and butanol yield of existing gas fermentation butanol-producing strains, the present application provides a Clostridium and its application in fermentation production of alcohol. The strain has high biomass in synthesis gas fermentation, and has high ethanol yield and butanol yield, which helps to promote the commercialization of gas fermentation production of butanol.

[0006] Technical solution: In a first aspect, the present application provides a Clostridium carboxidivorans GG6, which has a preservation number of CGMCC No. 34975.

[0007] The present application enriches and sorts a Clostridium carboxidivorans GG6 from the flue gas chimney deposits of a coal chemical plant. Through experiments, it is found that the strain has high biomass in synthesis gas fermentation, and has high ethanol and butanol yield.

[0008] As a preferred, the Clostridium carboxidivorans GG6 is rod-shaped, gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, single or paired arrangement.

[0009] As a preferred, the nucleotide sequence of 16S rDNA of the Clostridium carboxidivorans GG6 is shown in SEQ ID NO: 1.

[0010] In a second aspect, the present application provides a microbial agent containing the above-mentioned Clostridium carboxidivorans GG6.

[0011] The microbial agent of the Clostridium carboxidivorans GG6 of the present application can be liquid or solid.

[0012] As a preferred, the Clostridium carboxidivorans GG6 can be prepared into a bacterial suspension by culture, or the bacterial suspension can be further prepared into a solid microbial agent for subsequent alcohol gas fermentation production.

[0013] In a third aspect, the present application provides the application of the above-mentioned Clostridium carboxidivorans GG6 or the above-mentioned microbial agent in alcohol production by gas fermentation.

[0014] As a preferred, the product of gas fermentation production also includes acid, the acid is butyric acid and acetic acid, the alcohol is ethanol and butanol, the raw material of gas fermentation includes CO, CO2 and H2, and the fermentation conditions are: the fermentation temperature is 30-37℃, and the pH is 5.0-6.0.

[0015] As a preferred, the volume fractions of CO, CO2 and H2 are 10%-70%, 2%-30% and 5%-70% respectively.

[0016] As a preferred, the volume ratio of CO, CO2 and H2 is 30:5:65.

[0017] In a fourth aspect, the present application provides a method for producing alcohol by fermentation, wherein the Clostridium carboxydivorans GG6 or the bacterial agent is inoculated into a rich Clostridium medium, and then anaerobically cultured to the logarithmic phase, and then transferred into a nutrient-limited Clostridium medium, and then anaerobically cultured to the logarithmic phase in the presence of CO, CO2 and H2 synthesis gas, and then transferred into a bioreactor (e.g., a stirred reactor) filled with synthesis gas, and then continuously fed with CO, CO2 and H2 synthesis gas during the fermentation process, and then cultured at a temperature of 30-37°C and a pH of 5.0-6.0 for 24-96 h to obtain end products of acetic acid, ethanol, butyric acid and butanol.

[0018] Preferably, the rich Clostridium medium comprises yeast extract 5 g / L, tryptone 10 g / L, potassium chloride 1 g / L, sodium acetate 1 g / L, glucose 5 g / L, fructose 5 g / L, L-arginine 0.5 g / L, and L-cysteine 0.5 g / L.

[0019] Preferably, the nutrient-limited Clostridium medium comprises NH4Cl 1.0 g / L, KH2PO4 1.5 g / L, K2HPO4 0.5 g / L, MgCl2·6H2O 0.2 g / L, CaCl2·2H2O 0.02 g / L, 100x trace element stock solution 1 ml / L, 1000x vitamin stock solution 1 ml / L, and cysteine 0.5 g / L, wherein the 100x trace element stock solution comprises nitrilotriacetic acid 10.0 g / L, (NH4)2SO4·FeSO4·6H2O 4.0 g / L, MnSO4 5.0 g / L, ZnSO4·7H2O 1.0 g / L, CuCl2·2H2O 0.1 g / L, NiCl2·6H2O 0.1 g / L, CoCl2·6H2O 1.0 g / L, Na2SeO4 0.1 g / L, Na2MoO4·2H2O 0.1 g / L, and Na2WO4·2H2O 0.1 g / L, and the 1000x vitamin stock solution comprises calcium pantothenate 50.0 mg / L, lipoic acid 50.0 mg / L, vitamin B6 100 mg / L, thiamine 50.0 mg / L, vitamin B2 50 mg / L, biotin 20.0 mg / L, folic acid 20.0 mg / L, p-aminobenzoic acid 50.0 mg / L, nicotinic acid 50.0 mg / L, and vitamin B12 50.0 mg / L.

[0020] In particular, the present application provides end products of the Clostridium carboxydivorans GG6 after 96 h of fermentation with synthesis gas (30% CO, 5% CO2, 65% H2), wherein the biomass OD 600≥6, ethanol production concentration ≥10 g / L, acetic acid production concentration ≤3 g / L, butyric acid production concentration ≤1.2 g / L, butanol production concentration ≥2 g / L.

[0021] Beneficial effects: The present application enriches and sorts a Clostridium carboxidivorans strain GG6 from the tail gas flue sediment of a coal chemical plant. Compared with the reported experimental strain, the strain has a high biomass (OD 600 ≥6) during syngas fermentation, and at the same time has a high ethanol production (≥10 g / L) and butanol production (≥2 g / L), which helps to promote the commercialization of gas fermentation to produce butanol.

[0022] Biological material preservation instructions:

[0023] The Clostridium carboxidivorans GG6 provided by the present application is preserved in the China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, No. 3, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; preservation number: CGMCC No. 34975; preservation date: June 23, 2025. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The figure shows the microscopic cell morphology of Clostridium carboxidivorans GG6 in the embodiment of the present application;

[0025] Figure 2 The figure shows the liquid chromatogram of the product of the gas fermentation liquid of Clostridium carboxidivorans GG6 in the embodiment of the present application;

[0026] Figure 3 The figure shows the curve of the biomass (OD 600 ) of Clostridium carboxidivorans GG6 in the gas fermentation in the fermenter in the embodiment of the present application changing with time;

[0027] Figure 4 The figure shows the curve of the product of Clostridium carboxidivorans GG6 in the gas fermentation in the fermenter in the embodiment of the present application changing with time;

[0028] Figure 5 The figure shows the curve of the product of the control strain Clostridium carboxidivorans P7 in the gas fermentation in the fermenter in the embodiment of the present application changing with time. DETAILED DESCRIPTION

[0029] The following specific examples illustrate the embodiments of the present application, and the given examples are only for illustrating the present application, and are not intended to limit the scope of the present application.

[0030] Unless otherwise indicated, the materials, chemical reagents, instruments and equipment used in the present application can be purchased commercially or prepared by existing methods, and the technical means used in the examples are conventional means used by those skilled in the art.

[0031] The present application provides a Clostridium carboxidivorans GG6, the preservation number of which is CGMCC No. 34975, and the preservation time of which is June 23, 2025.

[0032] The Clostridium carboxidivorans GG6 is rod-shaped, gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs.

[0033] In some embodiments, the nucleotide sequence of the 16S rDNA of the Clostridium carboxidivorans GG6 is shown in SEQ ID NO: 1.

[0034] In some embodiments, the Clostridium carboxidivorans GG6 has a biomass OD 600 ≥ 6, produces ethanol at a concentration of ≥ 10 g / L, and produces butanol at a concentration of ≥ 2 g / L.

[0035] The implementation process of the present application is further described in detail below in combination with examples and drawings. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application.

[0036] Example 1 Isolation of Clostridium strain from sediment

[0037] In an anaerobic glove box, 2 g of tail gas flue sediment from a coal chemical plant (Xinxiang Zhongxin Chemical Industry Co., Ltd., Xinxiang, Henan) was dissolved in a centrifuge tube containing 25 ml of sterile water, shaken and mixed, 1 ml of the sediment suspension was inoculated into a blue cap bottle containing 50 ml of a rich Clostridium culture medium (YTDF medium), and cultured anaerobically at 37°C for 72 h. Then, 1 ml of the culture was inoculated into fresh YTDF medium, and cultured anaerobically at 37°C for 48 h to obtain a rich culture. The rich culture was transferred to a serum bottle containing 20 ml of a nutrient-limited Clostridium culture medium (PETC medium), and 1 bar of synthetic gas (30% CO, 5% CO2, 65% H2, % by volume) was filled into the serum bottle. The serum bottle was cultured at 37°C with 100 rpm shaking for 48 h, and the culture was continuously transferred into the same serum bottle culture medium for 3 times to obtain a synthetic gas growth culture. The culture was diluted 10-5 times and plated on a PETC solid plate containing 1.5 wt% agar, and the plate was cultured in an anaerobic tank filled with synthetic gas for 96 h to obtain single colonies. The single colonies were picked and subjected to four-zone streaking purification, which was repeated for 3 times to obtain a pure culture strain, which was named Clostridium carboxidivorans GG6.

[0038] The YTDF culture medium components include: 5 g / L yeast extract, 10 g / L tryptone, 1 g / L potassium chloride, 1 g / L sodium acetate, 5 g / L glucose, 5 g / L fructose, 0.5 g / L L-arginine, 0.5 g / L L-cysteine, and the pH is adjusted to 6.0.

[0039] The PETC culture medium components include: NH4Cl, 1.0 g / L; KH2PO4, 1.5 g / L; K2HPO4, 0.5 g / L; MgCl2·6H2O, 0.2 g / L; CaCl2·2H2O, 0.02 g / L; trace element stock solution (100x): 1 ml / L; vitamin stock solution (1000x): 1 ml / L; cysteine: 0.5 g / L; 20% NaOH to adjust pH to 6.0. Among them, the trace element stock solution (100x) formula is: nitrilotriacetic acid, 10.0 g / L; (NH4)2SO4·FeSO4·6H2O, 4.0 g / L; MnSO4, 5.0 g / L; ZnSO4·7H2O, 1.0 g / L; CuCl2·2H2O, 0.1 g / L; NiCl2·6H2O, 0.1 g / L; CoCl2·6H2O, 1.0 g / L; Na2SeO4, 0.1 g / L; Na2MoO4·2H2O, 0.1 g / L; Na2WO4·2H2O, 0.1 g / L, after preparation, adjust pH to 6.0. Filter sterilization. Store at 4°C. The vitamin stock solution (1000x) formula is: calcium pantothenate, 50.0 mg / L; lipoic acid, 50.0 mg / L; vitamin B6, 100 mg / L; thiamine, 50.0 mg / L; vitamin B2, 50 mg / L; biotin, 20.0 mg / L; folic acid, 20.0 mg / L; p-aminobenzoic acid, 50.0 mg / L; nicotinic acid, 50.0 mg / L; vitamin B12, 50.0 mg / L.

[0040] Example 2 Identification of carboxydotrophic Clostridium GG6

[0041] (1) Morphological identification

[0042] Microscopic observation showed that the cell body of carboxydotrophic Clostridium GG6 in Example 1 was rod-shaped, gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs. The microscopic morphology of carboxydotrophic Clostridium GG6 is shown in Figure 1 .

[0043] (2) 16S rDNA identification

[0044] Clostridium carboxydivorans GG6 was inoculated into YTDF medium and cultured anaerobically at 37 °C for 24 h. 1 ml of the culture was centrifuged and the genome of GG6 was extracted using a bacterial genome extraction kit. The genome 16S rDNA of GG6 was amplified using primers 27F and 1492R, primer 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2), primer 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 3). The PCR amplification system (total 50 μL): 2x PCR premix 25 μL, primer F (10 μmol / L) 1 μL, primer R (10 μmol / L) 1 μL, bacterial genome 2 μL, add pure water to 50 μL. The amplification program: 94 °C pre-denaturation for 5 min, 98 °C denaturation for 10 s, 55 °C annealing for 45 s, 72 °C extension for 1.5 min, a total of 30 cycles; 72 °C post-extension for 10 min; 4 °C termination reaction. 16S rDNA sequencing: the PCR product was detected by gel electrophoresis and sent to Shanghai Sangon Biological Co., Ltd. for sequencing. The 16S rDNA sequencing obtained the 16S rDNA sequence of Clostridium carboxydivorans GG6 as shown in SEQ ID NO: 1.

[0045] 16s rDNA sequence of Clostridium carboxydivorans GG6:

[0046]

[0047] Example 3: Detection of metabolites from Clostridium carbon monoxide-ingesting GG6

[0048] C. monoxide-eating Clostridium glaucum GG6 was inoculated into YTFD medium tubes and anaerobically cultured at 37℃ for 36 h. The fermentation products were then analyzed. After centrifugation at 12000 rpm, the supernatant was filtered through a 0.22 μm membrane and analyzed by HPLC (Agilent 1260). The chromatographic column was Bio-Rad HPX-87H (300 × 7.8 mm, 9 μm), the mobile phase was 5 mM sulfuric acid aqueous solution, the flow rate was 0.6 ml / min, the column temperature was 55℃, a differential detector was used, and the injection volume was 10 μL. Results are as follows: Figure 2 As shown, the main components of the fermentation products are acetic acid, ethanol, butyric acid, and butanol.

[0049] Example 4: Gas fermentation of Clostridium carbon monoxide-eating GG6 in a fermenter

[0050] Clostridium carbon monoxide-eating strain GG6 and the laboratory control strain Clostridium carbon monoxide-eating strain P7 (DSMZ 15243) were inoculated into YTFD medium tubes and cultured anaerobically at 37°C until the logarithmic growth phase. After reaching this phase, the culture was transferred to PETC medium serum bottles, which were then filled with 1 bar of syngas (30% CO, 5% CO2, 65% H2) and cultured until the logarithmic growth phase. The culture was then transferred to 3L stirred-tank reactors. Each 3L reactor contained 2L of PETC medium pre-added with approximately 1g / L acetic acid, and the pH was adjusted to 5.5 with ammonia. A 5% inoculum was inoculated, and syngas (30% CO, 5% CO2, 65% H2) was continuously aerated during fermentation. The aeration rate was 30 ml / min for the first 24 hours, gradually increasing to 150 ml / min and maintaining a stable rate. The pH was maintained at approximately 5.2 with ammonia during fermentation. During the 96-hour batch gas fermentation, the highest cell biomass of Clostridium carbon monoxide-eating strain GG6 reached OD200. 600 =6.33, while the laboratory control strain, Clostridium carbon monoxide-eating, P7, had the highest cell biomass, reaching OD. 600 =2.4 (e.g.) Figure 3 (As shown). The final products of *Clostridium carbon monoxide-eating* GG6 had an ethanol concentration of 10.4 g / L, an acetic acid concentration of 2.1 g / L, a butyric acid concentration of 1.2 g / L, and a butanol concentration of 2.5 g / L (as shown). Figure 4 As shown); the final product concentrations of the laboratory control strain *Clostridium carbon monoxide-eating* P7 were 1.8 g / L ethanol, 2.7 g / L acetic acid, 0.8 g / L butyric acid, and 0.4 g / L butanol (as shown). Figure 5 (As shown).

[0051] It should be noted that the above-mentioned embodiments are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing embodiments, it should be understood by those skilled in the art that the technical solutions recorded in the foregoing embodiments can be modified, or some or all of the technical features can be replaced by equivalent replacements; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A carbon monoxide-eating Clostridium ( Clostridium carboxidivorans GG6, characterized in that, The preservation number is CGMCC No. 34975.

2. Clostridium carboxidivorans GG6 according to claim 1, characterized in that, The Clostridium carboxidivorans GG6 is rod-shaped, gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, arranged singly or in pairs.

3. The Clostridium carboxydivorans GG6 according to claim 1, characterized in that, The nucleotide sequence of 16S rDNA of the Clostridium carboxidivorans GG6 is shown as SEQ ID NO:

1.

4. A microbial agent comprising the Clostridium carboxidivorans GG6 of claim 1.

5. Use of the Clostridium carboxidivorans GG6 of claim 1 or the microbial agent of claim 4 in the production of ethanol and butanol by gas fermentation.

6. Use according to claim 5, characterized in that, The products produced by gas fermentation also include acids, which are butyric acid and acetic acid, the raw materials of gas fermentation include CO, CO2 and H2, and the fermentation conditions are: the fermentation temperature is 30-37℃, and the pH is 5.0-6.

0.

7. Use according to claim 6, characterized in that, The volume fractions of the CO, CO2 and H2 are 10%-70%, 2%-30% and 5%-70% respectively.

8. A method for the fermentative production of an alcohol, characterized in that The Clostridium carboxidivorans GG6 of claim 1 or the microbial agent of claim 4 is inoculated into a nutrient-rich Clostridium culture medium, anaerobically cultured in the presence of CO, CO2 and H2 synthesis gas to the logarithmic phase, then transferred into a bioreactor filled with synthesis gas, the reactor is loaded with a nutrient-limited Clostridium culture medium, and after inoculation, CO, CO2 and H2 synthesis gas is continuously fed during the fermentation process, and the culture is carried out at a temperature of 30-37℃ and a pH of 5.0-6.0 for 24-96 h, to obtain the end products acetic acid, ethanol, butyric acid and butanol; The nutrient-rich Clostridium culture medium comprises: yeast extract 5 g / L, tryptone 10 g / L, potassium chloride 1 g / L, sodium acetate 1 g / L, glucose 5 g / L, fructose 5 g / L, L-arginine 0.5 g / L, L-cysteine 0.5 g / L; the nutrient-limited Clostridium culture medium comprises: NH4Cl, 1.0 g / L; KH2PO4, 1.5 g / L; K2HPO4, 0.5 g / L; MgCl2·6H2O, 0.2 g / L; CaCl2·2H2O, 0.02 g / L; 100x trace element stock solution, 1 ml / L; 1000x vitamin stock solution, 1 ml / L; cysteine, 0.5 g / L; wherein, the 100x trace element stock solution comprises: nitrilotriacetic acid, 10.0 g / L; (NH4)2Fe(SO4)2·6H2O, 4.0 g / L; MnSO4, 5.0 g / L; ZnSO4·7H2O, 1.0 g / L; CuCl2·2H2O, 0.1 g / L; NiCl2·6H2O, 0.1 g / L; CoCl2·6H2O, 1.0 g / L; Na2SeO4, 0.1 g / L; Na2MoO4·2H2O, 0.1 g / L; Na2WO4·2H2O, 0.1 g / L; the 1000x vitamin stock solution comprises: calcium pantothenate, 50.0 mg / L; lipoic acid, 50.0 mg / L; vitamin B6, 100 mg / L; thiamine, 50.0 mg / L; vitamin B2, 50 mg / L; biotin, 20.0 mg / L; folic acid, 20.0 mg / L; p-aminobenzoic acid, 50.0 mg / L; nicotinic acid, 50.0 mg / L; vitamin B12, 50.0 mg / L.

Images