CD4 + T monoclonal cell culture medium, culture method and application of CD4 + T monoclonal cell culture medium

Abstract

The invention provides a CD4 + T monoclonal cell culture medium, a culture method and application of the CD4 + T monoclonal cell culture medium. The culture medium comprises N-acetylcysteine and Trolox. According to the invention, the long-standing technical problem that natural CD4 + T cells are difficult to directly and stably form a monoclonal line is successfully solved. Through a density gradient dilution method and a culture medium formula, the formation of a monoclonal cell line with uniform and stable genetic background by efficient amplification starting from a single CD4 + T cell is realized for the first time. The CD4 + T cell is high in monoclonal formation efficiency and good in monoclonal growth state, and the preparation efficiency of the gene editing cell strain is greatly improved. According to the invention, a cell line with hCCR5-delta 32 CD4 + T cell point mutation is successfully constructed by using a monoclonal cell culture method, and important scientific research reference data is provided for treatment of diseases related to the CCR5 gene.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a CD4+ T monoclonal cell culture medium and culture method and their applications. Background Technology

[0002] CD4 + T cells are a key type of T lymphocyte in the immune system, named for the CD4 molecule they express on their surface. + T cells, as a key component of the immune system, are known as the "commanders" of the immune system. They play a crucial role in the body's immune regulation by coordinating the actions of other immune cells and non-immune cells. CD4 + T cells help B cells produce antibodies, enhance and maintain the immune response of CD8 T cells, regulate macrophage function, and coordinate immune responses to various pathogens. CD4 + T cells are important cells in the adaptive immune system for maintaining antigen memory. When CD4+ cells... + When the number of T cells decreases or their function is impaired, the body becomes more susceptible to disease. In HIV infection, when the number of CD4+ cells in the blood decreases... + A decrease in the number of T cells significantly increases the probability of HIV infection. Therefore, research targeting this cell type is crucial. To date, research targeting CD4 cells... + Most T cell monoclonal culture systems utilize virus-mediated immortalization, genetic engineering, and cell lines that specifically express a certain type of antigen. Their natural CD4+... + T cells cannot directly form stable monoclonal lines, which leads to many problems surrounding the natural CD4+. + Research experiments on T cells could not be carried out. Therefore, a method targeting the natural CD4+ was sought. + It is essential to develop a simple and universally applicable monoclonal system for T cells.

[0003] The CCR5 gene belongs to the chemokine receptor family and is a seven-transmembrane G protein-coupled receptor. CCR5 is mainly expressed by T cells and macrophages. When it binds to chemokine ligands, it increases intracellular calcium ion levels by activating downstream G proteins and other signaling molecules, thereby transducing signals. CCR5 is an important co-receptor for HIV entry into host cells, and its deficiency is associated with HIV infection tolerance; therefore, CCR5 is an important target for HIV treatment. Studies have shown that a 32bp deletion at the 553bp position of the CDS sequence in the CCR5 protein can cause the protein to lose its ability to recognize HIV, thus achieving a therapeutic effect. Traditional treatment methods involve transplanting CRISPR / CAS9-edited polyclonal CD4+ cell lines into human patients to achieve therapeutic effects. However, the editing efficiency of polyclonal cells is difficult to achieve 100%, resulting in poor clinical treatment outcomes, and CD4+ cell lines are also affected. + Purification and sorting of T cells is also a challenging problem, hence the need for CD4... + The development of monoclonal T-cell systems is crucial. Gene editing techniques can be used to obtain CCR5-Δ32 monoclonal cell lines, providing a foundation for clinical treatment from the outset and improving overall CD4 count. + The editing ratio of T cells and the avoidance of introducing non-positive cell samples provide a new approach for T cell therapy. Summary of the Invention

[0004] In view of this, the present invention proposes a CD4 + T monoclonal cell culture medium, culture methods and their applications.

[0005] The technical solution of this invention is implemented as follows:

[0006] Firstly, the present invention provides a CD4 + T monoclonal cell culture medium, including N-acetylcysteine ​​(NAC) and Trolox.

[0007] NAC is a cysteine ​​precursor that can promote glutathione (GSH) synthesis and alleviate GSH depletion caused by cell culture in vitro. Furthermore, the thiol group (-SH) of NAC can directly react with free radicals (such as ·OH, O2). - The NAC response reduces oxidative stress damage to lipids, proteins, and DNA, thereby regulating T cell activation and function. Most importantly, NAC can block the JNK / p38 MAPK pathway and inhibit caspase pathway activation, thus suppressing apoptosis-related signaling pathways and delaying apoptosis during cell culture.

[0008] Trolox is a water-soluble vitamin E analog that primarily targets oxidative damage to membrane systems. Through its phenolic hydroxyl group, it can capture lipid free radicals (such as LO· and LOO·), preventing lipid peroxidation of cell membranes and organelle membranes (such as mitochondrial membranes), maintaining membrane integrity, and thus maintaining cell integrity and increasing its viability. Furthermore, Trolox can reduce mitochondrial ROS leakage, maintain ATP synthesis efficiency, and prevent apoptosis caused by energy depletion.

[0009] To improve the survival rate of monoclonal cells, this invention adds FBS (fetal bovine serum) to the cell culture medium, and also additionally adds the cell cofactors N-acetylcysteine ​​(NAC) and Trolox. These two have a strong synergistic effect in antioxidant capacity and inhibition of apoptosis signaling, which can reduce oxidative damage and apoptosis in cells, thereby promoting CD4+ cell turnover. + The proliferative capacity of T cells.

[0010] Based on the above technical solution, the culture medium further includes N-acetylcysteine ​​at a final concentration of 1-20 mM and Trolox at a final concentration of 100-200 μM.

[0011] Based on the above technical solutions, the culture medium further includes DMEM containing 15wt% FBS and double antibodies.

[0012] Based on the above technical solutions, the dual antibodies further include penicillin and streptomycin.

[0013] Secondly, the present invention provides a method using the aforementioned CD4 + CD4+ in T monoclonal cell culture medium + The T monoclonal cell culture method includes the following steps:

[0014] S1. Using a gradient dilution method, CD4 + T cell suspension with the aforementioned CD4 + T monoclonal cell culture medium was serially diluted to 100 cells / mL;

[0015] S2, CD4 diluted in step S1 + T cell suspension was inoculated into cell culture plates, and 100 μL of the CD4+ was added to each well. + T monoclonal cells were cultured in culture medium, and single cells were sorted from wells, expanded in culture, and CD4 were obtained. + T monoclonal cells.

[0016] Based on the above technical solution, step S2 further includes: adding 100 μL of the CD4 to each well. +After culturing T monoclonal cells in medium for 24 hours, pick out wells with only one cell and label them. Perform half medium replacement every 5 days and culture for about 10 days.

[0017] The labeled, well-growing cells were transferred to new 96-well cell culture plates, dispersed, and supplemented with fresh CD4+. + T monoclonal cells were cultured in culture medium for large-scale cultivation.

[0018] The cells were then transferred to 48-well and 24-well cell culture plates. After reaching confluence in the 24-well cell culture plates, monoclonal cell identification was performed. The cells were then further expanded to 12-well cell culture plates and eventually to T25 cell culture flasks to obtain a monoclonal cell line.

[0019] Thirdly, the present invention provides a method using the aforementioned CD4 + CD4 obtained by T monoclonal cell culture method + T monoclonal cells.

[0020] Fourthly, the present invention provides the aforementioned CD4 + Applications of T monoclonal cells in research on T cell therapy or gene editing.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] (1) This invention successfully solved the problem of natural CD4 + The long-standing technical challenge of directly and stably forming monoclonal lines from T cells has been overcome. Through density gradient dilution and specific culture medium formulation, this technique has, for the first time, enabled the formation of monoclonal lines from single CD4 cells. + T cells initiate and rapidly expand to form a stable monoclonal cell line with a uniform genetic background.

[0023] (2) The CD4 of the present invention + T cells exhibit high monoclonal formation efficiency and good monoclonal growth status, significantly improving the efficiency of gene-edited cell line preparation.

[0024] (3) This invention successfully constructed hCCR5-Δ32CD4 using a single-clonal cell culture method. + T-cell point mutation cell lines provide important scientific reference data for the treatment of diseases related to the CCR5 gene. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a schematic diagram of the target sequence in Example 4. The yellow part is the missing 32bp, the red part is the PAM site, "ctgtaatttctatcagtaga" is the sgRNA sequence, and the arrow indicates the Cas9 cleavage site.

[0027] Figure 2 CD4 of Example 4 + The optimal system for T cell electroporation was established. A represents the electroporation efficiency at different voltages with the same pulse duration; B represents the electroporation efficiency at different pulse durations with the same voltage.

[0028] Figure 3 CCR5-Δ32CD4 in Example 4 + T cell monoclonal sorting and expansion culture;

[0029] Figure 4 CCR5-Δ32CD4 in Example 4 + Editing results of T cell monoclonal sub-cell line comparison;

[0030] Figure 5 The STR analysis chart for Example 1;

[0031] Figure 6 CD4 obtained in Example 1 + T monoclonal cells;

[0032] Figure 7 For CD4 in Comparative Example 2 + The effect of T-cell monoclonal culture. Detailed Implementation

[0033] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0034] In the following specific implementation, Fetal Bovie Serum (FBS) was purchased from Gibco, with product number 12484028;

[0035] High-sugar DMEM was purchased from Hyclone, item number 2149399;

[0036] The bispecific antibody (P / S) was purchased from Beyotime Biotechnology, catalog number C0222;

[0037] N-acetylcysteine ​​was purchased from Bide, product number 38520-57-9;

[0038] Trolox (6-hydroxy-2,5,7,8-tetramethyltryptane-2-carboxylic acid) was purchased from Yeasen, catalog number 53188-07-1.

[0039] The serum from Sijiqing was purchased from Zhejiang Tianhang Biotechnology Co., Ltd., with product number 11011-8611.

[0040] During cell passage and medium change, the trypsin digestion solution (containing 0.25% trypsin) was purchased from Hyclone, catalog number 2322962; the 0.1M PBS buffer was purchased from Hyclone, catalog number AF29561133.

[0041] In the following specific implementation method, the cell genome extraction method adopts the following approach:

[0042] (1) Take a certain amount of cell suspension (maximum extraction volume is 5×10). 6 Centrifuge at 2000 rpm (400×g) for 5 min, discard the supernatant, add 200 μL of GTL, and vortex until the sample is completely resuspended.

[0043] (2) Add 20 μL Proteinase K.

[0044] (3) Add 200 μL Buffer GL, vortex to mix thoroughly, and incubate in a 56°C water bath for 10 min.

[0045] (4) Briefly centrifuge to remove water droplets from the inner wall of the tube cap. Add 200 μL of anhydrous ethanol and vortex to mix thoroughly. Briefly centrifuge.

[0046] Note: A sol-like product may form after adding Buffer GL and anhydrous ethanol. In this case, vigorous shaking or vortexing is recommended.

[0047] (5) Add all the solution obtained in the previous step to the adsorption column (Spin Columns DM) that has been loaded into the collection tube. If the solution cannot be added all at once, it can be added in multiple batches. Centrifuge at 12000 rpm (~13400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0048] (6) Add 500 μL of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0049] (7) Add 500 μL of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0050] Note: If you need to further improve DNA purity, you can repeat step 7.

[0051] (8) Centrifuge at 12000 rpm for 2 min and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to dry it completely.

[0052] Place the adsorption column in a new centrifuge tube (self-provided), add 30-50 μL of sterile water to the middle of the adsorption column, incubate at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20℃.

[0053] Example 1

[0054] This embodiment provides a CD4 + The T monoclonal cell culture method includes the following steps:

[0055] Prepare the culture medium: DMEM high-glucose medium containing 15wt% FBS, 1% (w / v) P / S, N-acetylcysteine ​​with a final concentration of 10mM, and Trolox with a final concentration of 150μM. The volume ratio of P / S to DMEM high-glucose medium containing 15wt% FBS is 1:100.

[0056] Collect CD4 cells in good growth condition + T cells were centrifuged at 800 rpm for 3 min, the supernatant was removed, and the cells were resuspended in 1 mL of culture medium. After counting the cells with a cell counter, the cells were diluted to 100 cells / mL using a serial dilution method. A total of 10 mL of culture medium was added, and then 100 μL of culture medium was added to each well of a 96-well cell culture plate. The plates were then incubated in a 37°C CO2 incubator for 24 h.

[0057] Under a microscope, the wells containing single cells were selected and marked on the second day. In subsequent culture, the growth status of the cells in these wells was observed and the survival rate was calculated.

[0058] Cell growth was recorded every 5 days in 96-well cell culture plates, and the medium was replaced in half.

[0059] When the cells have grown to about 10 days, transfer them to a new 96-well cell culture plate, disperse them, add fresh culture medium, and once the cells have grown to confluence, transfer them to 48-well and 24-well cell culture plates.

[0060] Once the cells reach 80% confluence in 24-well cell culture plates and are identified as monoclonal cells, they are further expanded to 12-well cell culture plates, and eventually to T25 cell culture flasks, ultimately yielding CD4+ cells. + T monoclonal cells.

[0061] Example 2

[0062] This embodiment provides a CD4 + The T monoclonal cell culture method differs from that in Example 1 in the following ways:

[0063] In the preparation of the culture medium, the final concentration of N-acetylcysteine ​​was 1 mM and the final concentration of Trolox was 100 μM.

[0064] Example 3

[0065] This embodiment provides a CD4 + The T monoclonal cell culture method differs from that in Example 1 in the following ways:

[0066] In the preparation of the culture medium, the final concentration of N-acetylcysteine ​​was 20 mM and the final concentration of Trolox was 200 μM.

[0067] Example 4

[0068] This embodiment provides a CCR5-Δ32CD4+ T cell monoclonal cell line, comprising the following steps:

[0069] 1. Construction of the knockout vector

[0070] Based on the Homo sapiens CCR5 (NCBI Gene ID: 1234) genome sequence information, suitable target information was identified (e.g., Figure 1 As shown in Table 1, a CRISPR / Cas9 gene editing vector was constructed using enzyme digestion and ligation. Sticky ends from the digested vector were introduced before the sgRNA, and then the primers were annealed to form a double strand containing the sticky ends. The sgRNA adapter primer design is shown in Table 1, where cagtcatagttaagaccttcttaaaggtctgt represents the deleted 32bp.

[0071] Prepare the reaction system in 200 μL centrifuge tubes according to Table 1. The reaction conditions are: 98℃ for 3 min, 85℃ for 3 min, 75℃ for 2 min, 65℃ for 2 min, 55℃ for 2 min, and 25℃ for 5 min. This allows sgRNA to bind into small double-stranded fragments with sticky ends.

[0072] Table 1. Design of sgRNA adapter primers

[0073]

[0074]

[0075] Using BBSI and T4 ligase, a ligation-by-digestion system (as shown in Table 2) was employed to ligate the vector and sgRNA. The reaction mixture was prepared in 200 μL centrifuge tubes according to Table 2 and mixed thoroughly on ice. The reaction conditions were: 37℃ for 1 h 30 min, 80℃ for 10 min, and 25℃ for 5 min. This process successfully ligated the sgRNA into the editing vector.

[0076] Table 2. Edge-cutting and edge-connecting reaction system

[0077]

[0078] The above-mentioned ligation product was then transferred into competent cells:

[0079] (1) Thaw E.coli DH5α competent cells on ice, add the ligation product from the previous step to 100 μL of competent cells, gently tap the tube wall a few times to mix, and place on ice for 15–30 min.

[0080] (2) Heat shock at 42℃ for 90s, followed by ice bath for 3min.

[0081] (3) Add about 500 μL of antibiotic-free LB medium and incubate at 37°C and 200 rpm for 30 min with shaking.

[0082] (4) After a short centrifugation, discard the supernatant, resuspend the cells in 500 μL of fresh LB medium, and then take 100 μL of the bacterial solution and spread it evenly on an Amp resistant plate. Invert the plate and incubate overnight at 37°C.

[0083] (5) Select single clones for colony PCR verification, and send positive clones to Beijing Qingke Biotechnology Co., Ltd. for first-generation sequencing.

[0084] Inoculate the correctly sequenced vector into a culture tube, take 10 mL of LB medium containing Amp resistance and culture overnight to expand the culture. The next day, use an endotoxin-free plasmid extraction kit to extract the plasmid, ensuring a concentration greater than 600 ng / μL. Store at -20℃ for subsequent experiments.

[0085] 2. CD4 + Establishment of optimal electroporation conditions for T cells

[0086] Collect CD4 cells in good growth condition + T cells were centrifuged at 800 rpm for 3 minutes, the supernatant was discarded, and the cells were resuspended and counted at a rate of 1×10⁻⁶. 6 Grouping: 20 μL of electroporation buffer and 2 μg of mCherry plasmid were added to each group. The effects of different voltages and pulse durations on electroporation efficiency were tested. The electroporation mode was Legacy mode. Group settings:

[0087] Fixed pulse time adjustment voltage: 580V / 20ms, 540V / 20ms, 500V / 20ms, 480V / 20ms, 460V / 20ms, 420V / 20ms;

[0088] Fixed voltage adjustment pulse times: 480V / 20ms, 460V / 20ms, 480V / 15ms, 480V / 12ms, 460V / 15ms, 460V / 12ms

[0089] Cell status and red fluorescence density were observed 48 hours after electroporation. The results are as follows: Figure 2 As shown, by Figure 2 It can be seen that the fluorescence ratio is highest under the condition of 460V / 20ms, indicating that this condition is CD4. + The best way to deliver exogenous genes to T cells.

[0090] 3. CD4 + T monoclonal cell culture

[0091] Prepare the culture medium: DMEM high-glucose medium containing 15wt% FBS, 1% (w / v) P / S, N-acetylcysteine ​​with a final concentration of 10mM, Trolox with a final concentration of 150μM, and the volume ratio of P / S to DMEM high-glucose medium containing 15wt% FBS is 1:100.

[0092] Collect CD4 cells in good growth condition + T cells were centrifuged at 800 rpm for 3 min, the supernatant was removed, and the cells were resuspended in 1 mL of culture medium. After counting the cells with a cell counter, the cells were diluted to 100 cells / mL using a serial dilution method. A total of 10 mL of culture medium was added, and then 100 μL of culture medium was added to each well of a 96-well cell culture plate. The plates were then incubated in a 37°C CO2 incubator for 24 h.

[0093] Under a microscope, the wells containing single cells were selected and marked on the second day. In subsequent culture, the growth status of the cells in these wells was observed and the survival rate was calculated.

[0094] Cell growth was recorded every 5 days in 96-well cell culture plates, and the medium was replaced in half.

[0095] When the cells have grown to approximately 10 days, transfer them to a new 96-well cell culture plate, disperse them, add fresh culture medium, and once the cells have reached confluence, transfer them to 48-well and 24-well cell culture plates (e.g., ...). Figure 3 AD).

[0096] Once the cells reach 80% density in a 24-well cell culture plate, 2 / 3 of the cells are taken for genomic DNA extraction. The remaining cells are transferred to a new 24-well cell culture plate, and the extracted genomic DNA is amplified by PCR using KOD one.

[0097] The amplification primers were CCR5-ZK-F / R, located on both sides of the CCR5-Δ32 sequence. The amplification conditions were: 98℃ pre-denaturation for 2 min, followed by 98℃ denaturation for 15 s, 56℃ annealing for 20 s, 68℃ extension for 30 s, for 30 cycles, and then 68℃ final extension for 5 min.

[0098] The amplified PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for first-generation sequencing.

[0099] Based on the sequencing results, select cell clones with the CCR5-Δ32 mutation (e.g., Figure 4 ), to carry out expanded culture, and successively passaged into 12-well cell culture plates (such as... Figure 3 E), 6-well cell culture plates, T25 cell culture flasks (e.g.) Figure 3 F), and cryopreserved, ultimately obtaining CCR5-Δ32-deficient CD4+. + T monoclonal cell lines.

[0100] Depend on Figure 3 It is evident that the culture medium of the present invention can successfully obtain CD4 cells with CCR5-Δ32 deletion. + T monoclonal cell lines.

[0101] Comparative Example 1

[0102] The difference between this comparative example and Example 1 is that:

[0103] The culture medium does not contain 10 mM N-acetylcysteine ​​or 150 μM Trolox.

[0104] Comparative Example 2

[0105] The difference between this comparative example and Example 1 is that the culture medium in this comparative example is: high-glucose medium DMEM containing 10 wt% *Ilex chinensis* serum and 1% (w / v) P / S, with the volume ratio of P / S to high-glucose medium DMEM containing 15 wt% FBS being 1:100.

[0106] Performance testing

[0107] For the CD4 used in Example 1 + STR identification and analysis were performed on monoclonal cells obtained from T cell-derived monoclonal cell culture, and the results are as follows: Figure 5 As shown, the CD4 used throughout the experiment can be guaranteed. + The T cells were of reliable origin, and it can be verified that the monoclonal cells obtained in Example 1 were indeed CD4+ T cells.

[0108] Cell counting was performed on the final T25 cell culture flasks from Example 1, and the total number of monoclonal cells was approximately 5–7 × 10⁻⁶. 6 One, such as Figure 6 As shown.

[0109] The monoclonal cell culture effect was detected during the culture process of Comparative Example 2, and the results are as follows: Figure 7 As shown, by Figure 7 It can be seen that CD4 is cultured using conventional culture medium. + T monoclonal cells began to clump together after 5 days of culture, and the clumping became severe after 10 days, which limited the sorting of monoclonal cells.

[0110] The survival rates of monoclonal cells cultured in Examples 1-3 and Comparative Examples 1 and 2 were statistically analyzed, and the results are shown in Table 3. Table 3 shows that the CD4+ provided by this invention... + The T-cell culture method resulted in a significantly higher monoclonal cell survival rate than that obtained using comparative methods 1 and 2.

[0111] Comparing Comparative Example 1 and Example 1, it can be seen that when N-acetylcysteine ​​is lacking, intracellular GSH synthesis is insufficient, the ability to scavenge reactive oxygen species decreases, and reactive oxygen species accumulate, which may lead to cellular DNA damage and mitochondrial apoptosis, thereby affecting cell growth. When Trolox is lacking, cell membrane lipid peroxidation cannot be inhibited, resulting in decreased cell membrane fluidity and activation of apoptosis signals. The lack of both leads to a sharp decline in the survival rate of monoclonal cells.

[0112] Comparing Comparative Example 2 and Example 1, it can be seen that the conventional culture medium lacks component design for monoclonal cell culture and has insufficient antioxidant capacity, which leads to a decrease in the survival rate of monoclonal cells.

[0113] Table 3 shows the monoclonal cell viability obtained in the examples and comparative examples.

[0114]

[0115]

[0116] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A CD4 + T monoclonal cell culture medium, characterized in that... Including N-acetylcysteine ​​and Trolox.

2. A CD4 as described in claim 1 + T monoclonal cell culture medium, characterized in that... The culture medium comprises N-acetylcysteine ​​at a final concentration of 1–20 mM and Trolox at a final concentration of 100–200 μM.

3. A CD4 as described in claim 1 + T monoclonal cell culture medium, characterized in that... The culture medium also includes DMEM containing 15 wt% FBS and double antibiotics.

4. A CD4 as described in claim 3 + T monoclonal cell culture medium, characterized in that... The bispecific antibodies include penicillin and streptomycin.

5. A CD4 culture medium using any one of claims 1 to 4 + The T monoclonal cell culture method is characterized by... Includes the following steps: S1. Using a gradient dilution method, CD4 + T cell suspension with the aforementioned CD4 + T monoclonal cell culture medium was serially diluted to 100 cells / mL; S2, CD4 diluted in step S1 + T cell suspension was inoculated into cell culture plates, and 100 μL of the CD4+ was added to each well. + T monoclonal cells were cultured in culture medium, and single cells were sorted from wells, expanded in culture, and CD4 were obtained. + T monoclonal cells.

6. A CD4 using claim 5 + CD4 obtained by T monoclonal cell culture method + T monoclonal cells.

7. The CD4 as described in claim 6 + Applications of T monoclonal cells in research on T cell therapy or gene editing.

Images