RNA aptamer targeting translation termination factor eRF1 and application thereof to improving drought tolerance of rice

Abstract

The application discloses an RNA aptamer targeting a translation termination factor eRF1 and application thereof to improving drought resistance of rice. The application screens a high-affinity aptamer Dart1 which is specific to eRF1 of rice and has a nucleotide sequence as shown in SEQ ID NO. 1 from an RNA library containing a 40 nt random region, and the aptamer can inhibit the terminator release activity of eRF1 and improve translation termination read-through, can significantly improve the survival rate of plants under drought conditions, and can exhibit growth recovery, increased chlorophyll content, reduced electrolyte leakage and enhanced expression of drought resistance-related genes. The aptamer regulation strategy provided by the application has the advantages of high specificity, reversibility and no need to permanently change the genome, and provides a novel and efficient molecular tool for rapidly improving drought resistance of crops, and is suitable for breeding and field application of crops such as rice.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and plant stress physiology, specifically relating to an RNA aptamer that targets the translation termination factor eRF1 and its application in improving drought resistance in rice. Background Technology

[0002] Drought stress is one of the most significant environmental pressures threatening rice production globally. Oryza sativa As an important food crop, rice is highly sensitive to water supply. Under water-deficient conditions, rice plants will exhibit growth stagnation, leaf wilting and curling, and a reduced photosynthetic rate, which can lead to yield reduction or even crop death in severe cases. Drought stress triggers a series of molecular reactions, including osmotic imbalance and oxidative damage: soil water deficiency leads to a decrease in cell water potential, cell dehydration damages membrane structures, and reduces enzyme activity; simultaneously, stomata close to reduce water loss, but this results in reduced CO2 absorption, and excessive photosynthetic electron transfer leads to the accumulation of reactive oxygen species (ROS), causing oxidative stress damage to cells. Long-term drought stress significantly inhibits rice tillering and heading, resulting in reduced seed setting rate and a decrease in thousand-grain weight.

[0003] The translation phase of protein synthesis plays a crucial regulatory role in plant stress responses. Besides transcriptional regulation, translational regulation rapidly impacts protein yield, enabling plants to quickly adapt to adverse environments. The translation process comprises three phases: initiation, elongation, and termination. Translation termination is mediated by the eukaryotic release factor eRF1. eRF1 is a highly conserved protein. When a ribosome encounters a stop codon (UAA / UAG / UGA), eRF1 enters the ribosomal A site to recognize the termination signal and, in conjunction with another factor, eRF3 (a GTPase), hydrolyzes the peptidyl-tRNA bond, releasing a nascent polypeptide chain and thus terminating translation. In short, eRF1 acts as a "genetic code stop signal interpreter," ensuring that proteins terminate at the correct location.

[0004] Under normal conditions, eRF1 maintains the accuracy and efficiency of translation termination, which is crucial for cellular protein homeostasis. However, under environmental stress, plant cells may readjust their translation strategies: preferentially synthesizing stress-resistance-related proteins and reducing the synthesis of general growth-related proteins. Studies have shown that under conditions such as salt stress, plants regulate the activity of certain translation initiation factors to selectively translate specific mRNAs. Accordingly, regulating the translation termination step may also become a point of entry for influencing protein synthesis profiles. For example, if the activity of eRF1 can be slightly inhibited, making translation termination less efficient, it may lead to readthrough of some mRNAs, where ribosomes skip the normal stop codon and continue translation. This controllable "readthrough" phenomenon has the potential to alter the generation of certain proteins, such as fusion or extended proteins, or trigger the restart of translation, thereby changing the protein composition of cells. Of particular note is the existence of a nonsense-mediated mRNA decay pathway (NMD) in eukaryotic cells: when mRNA contains a premature stop codon (PTC), factors such as eRF1 and UPF1 form a complex that triggers the degradation of the mRNA. Many stress-response gene transcripts carry PTCs due to alternative splicing and other reasons, making them susceptible to NMD regulation. Appropriate inhibition of eRF1 function under stress conditions may weaken the NMD pathway, allowing some easily degradable mRNAs closely related to abiotic stress to be preserved and translated, thereby enhancing the stress defense response. Literature reports that certain environmental stresses (such as high salinity and UV stress) can lead to decreased NMD efficiency, resulting in plants accumulating more stress-resistance transcripts.

[0005] RNA aptamers are single-stranded nucleic acid (DNA or RNA) sequences that can specifically bind to target molecules. They are typically obtained by screening random libraries using the exponentially enriched ligand phylogenetic evolution technique (SELEX). Compared to protein ligands such as antibodies, nucleic acid aptamers have many unique advantages: short design and screening cycles, the ability to be chemically synthesized artificially or expressed in transgenic cells, small molecular weight for easy penetration of target sites, reversible binding, and high affinity. Furthermore, the specificity of aptamers can be finely regulated by adding negative or mutant targets during the selection process, thus avoiding non-specific effects. In plant research, the application of aptamer technology is still in its early stages, but there have been successful cases. For example, recent research using RNA aptamers to target the eukaryotic translation initiation factor eIF4A significantly improved the salt tolerance of transgenic rice. Similarly, another study using aptamers to regulate the elongation factor eEF1A also enhanced the salt stress resistance of rice. These works demonstrate that expressing specific RNA aptamers in plant cells can directly regulate key nodes in the translation process, thereby improving the plant's stress resistance phenotype. To date, there have been no reports of using RNA aptamers to directly target the translation termination factor eRF1 to improve plant drought resistance.

[0006] Compared to traditional transgenic strategies (such as overexpression of stress-resistant proteins), aptamers do not directly encode proteins, thus placing a smaller metabolic burden on cells and avoiding immune responses or toxicity caused by the production of exogenous proteins. Aptamers function by interacting with endogenous proteins; theoretically, with proper design, the activity of target proteins can be precisely regulated without altering their expression levels or gene sequences. This mechanism makes aptamer technology highly flexible: aptamer effects can be modulated by controlling the timing of expression or using inducible promoters; and, if necessary, conditional regulation can be achieved by adding structural elements to the aptamer gene that inactivate it under specific conditions. All these characteristics make RNA aptamers a promising new tool for plant stress physiology research and crop improvement. Summary of the Invention

[0007] Addressing the shortcomings and deficiencies of existing technologies, this invention aims to provide an RNA aptamer targeting the translation termination factor eRF1 and its application in improving drought resistance in rice. The RNA aptamer targeting eRF1 provided by this invention opens up new avenues for improving drought resistance in crops such as rice. Specifically, eRF1 is considered a promising new target for drought resistance regulation: by artificially regulating eRF1, specifically binding to eRF1 and moderately inhibiting its activity, the translation process can be reprogrammed without completely disrupting protein synthesis. This can delay translation termination and NMD (Neuro-Modulation Delay), giving plants greater flexibility to cope with drought stress and enabling crops to better adjust their metabolism under water scarcity.

[0008] The first objective of this invention is to provide an RNA aptamer with the nucleotide sequence shown in SEQ ID NO. 1; the RNA aptamer is capable of specifically binding to the rice-derived eukaryotic translation termination factor eRF1 protein and inhibiting its termination release activity.

[0009] A second objective of this invention is to provide a recombinant expression vector containing a DNA sequence encoding the aforementioned RNA aptamer.

[0010] Preferably, the 5' end of the DNA sequence of the RNA aptamer is supplemented with a Hammerhead ribozyme element and the 3' end is supplemented with an HDV ribozyme element.

[0011] A third objective of this invention is to provide the application of the described RNA aptamer or the described recombinant expression vector in improving the drought resistance of rice.

[0012] Preferably, the application is the use of the RNA aptamer or the recombinant expression vector to improve rice survival rate, promote rice growth, increase rice chlorophyll content, and reduce ion leakage under drought stress.

[0013] Preferably, the application involves using the RNA aptamer Dart1 or the recombinant expression vector to enhance the expression of drought-responsive genes, thereby improving the drought resistance of rice.

[0014] Preferably, the drought response gene is OsDREB2A , OsLEA3 and OsP5CS1 .

[0015] A fourth objective of this invention is to provide a method for preparing transgenic cells, including the step of transferring the cells into the recombinant expression vector.

[0016] A fifth objective of this invention is to provide a method for preparing drought-resistant rice, comprising the step of transferring the rice into the recombinant expression vector described in any one of the claims.

[0017] The beneficial effects of this invention are:

[0018] Applying RNA aptamers to target the translation termination factor eRF1 is a novel technical approach. This invention demonstrates that utilizing the eRF1-targeting aptamer Dart1 can improve drought resistance in rice, providing an innovative approach for crop drought-resistant breeding and molecular agriculture.

[0019] Compared with existing drought-resistant breeding techniques, this invention utilizes a novel strategy of regulating translation termination using RNA aptamers to enhance drought resistance in rice without introducing exogenous drought-resistant proteins. This method avoids the complexity of multi-gene modification, requiring only a single aptamer sequence to significantly enhance drought tolerance. Furthermore, because the regulatory effect is concentrated in the translation stage, the aptamer plants exhibit good growth performance under normal conditions without significant negative impacts on yield. This invention opens up new avenues for drought-resistant breeding and has significant scientific and practical value. Attached Figure Description

[0020] Figure 1 This is a flowchart of the aptamer screening method (SELEX). A is the SELEX experimental flowchart; B is the principal component analysis (PCA) results of the dominant sequences in the 25th round of the enrichment pool, with different colored dots representing different sequence clusters.

[0021] Figure 2 This diagram illustrates the binding kinetics and effects of aptamers on eRF1. A shows the results of dot-blot experiments comparing the binding capacity of Dart1 to eRF1; B is a fluorescence polarization binding curve; C is a schematic diagram of the construction of the dual reporter gene vector used; and D shows the reporter enzyme activity results after adding different aptamers to a cell-free translation system.

[0022] Figure 3This is a localization analysis diagram of the interaction between aptamers and eRF1 under drought conditions. Among them, A is the experimental results of colocalization between eRF1 and aptamers in rice mesophyll protoplasts under normal and drought simulated conditions (with the addition of 20% PEG-6000 to simulate osmotic stress); B is the quantitative analysis results of colocalization signal intensity; C is the pull-down experiment and western blot detection results of Dart1.

[0023] Figure 4 This is a diagram showing the experimental results of transient expression of the Dart1 aptamer improving drought resistance in rice seedlings. A shows a phenotypic comparison of rice seedlings after 20 days of drought treatment following transient expression of the Dart1 aptamer; the left side shows wild-type control rice seedlings, and the right side shows rice seedlings transiently transformed with the Dart1 aptamer using the Agrobacterium tumefaciens infiltration method. B shows the RT-PCR analysis results of transiently transformed Dart1 aptamer rice seedlings. C shows a comparison of physiological indicators between transiently transformed Dart1 aptamer rice seedlings and wild-type rice seedlings. D shows the qRT-PCR results of drought stress-related genes. Detailed Implementation

[0024] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0025] Example 1: Screening of RNA aptamers targeting eRF1

[0026] Materials and Methods: In this embodiment, the rice variety Nipponbare (Nipponbare) was selected. Oryza sativa The rice eRF1 protein (ssp. japonica cv. Nipponbare) was used as the target. The sequence shown in SEQ ID NO. 3, confirmed by RAP-DB and NCBI databases, is the encoding nucleotide sequence of the major homologous gene of rice eRF1, encoding a protein with the amino acid sequence shown in SEQ ID NO. 2 (436 amino acids in total length, approximately 49.1 kDa), showing high homology with the Arabidopsis eRF1-1 gene (approximately 85% similarity at the amino acid level). This cDNA sequence is located on chromosome 1 in the genome, with gene numbers LOC_Os01g71270 / Os01g0939500 / AGIS_Os01g062610. Sufficient amounts of rice eRF1 protein were obtained through prokaryotic expression and affinity purification. The rice eRF1 gene encoding the nucleotide sequence shown in SEQ ID NO. 3 was cloned into the E. coli protein expression vector pColdI to construct a fusion protein containing a 6×His tag, which was then induced to express in E. coli BL21(DE3). via Ni 2+ -NTA affinity column purification yielded recombinant eRF1 protein with a purity >90%, which was used for subsequent SELEX screening. The flowchart is shown below. Figure 1As shown, the steps of each cycle are illustrated: the RNA library is incubated with immobilized eRF1 protein to allow the aptamer to bind to the target protein. After the unbound sequence is washed away, the RNA sequence bound to eRF1 is washed away, enriched by reverse transcription and PCR amplification, and then enters the next round of screening. A total of 25 rounds of screening were carried out, and the selection pressure was continuously increased (such as gradually reducing the amount of eRF1 and increasing the washing strictness).

[0027] Initial randomized nucleic acid libraries were constructed: Two single-stranded DNA libraries were prepared using synthetic oligonucleotides (synthesized by Shanghai Sangon Biotech). Library 1 (a library containing a 40 nt random region forming a hairpin structure, with a T7 promoter at the left end for in vitro transcription) has the following sequence structure: 5'-GTATAATACGACTCACTATAGGGAGGCTCTCGGGACGAC-N 40 -GTCGTCCCGATGCTGCAATCGTAA -3' (SEQ ID No. 5), where TAATACGACTCACTATAG is the T7 promoter sequence, N 40 This represents 40 random bases, with a fixed sequence at the 3' end (for PCR amplification). The structure of library 2 is: 5'-GTATAATACGACTCACTATAGGGAGACGCAACTGAATGAA -N 26 - CTGCTTCGGCAG -N 26 -TCCGTAACTAGTCGCGTCAC -3' (SEQ ID No. 6), containing two random regions N 26 (26 random bases), separated by a fixed sequence, designed to form a stem-loop structure. Each library contains approximately 1 × 10⁻⁶ bases. 15 Different sequences were obtained. The library was transcribed in vitro using the T7 promoter to obtain an RNA library, and RNA fragments of the correct length were recovered by urea denaturing PAGE as the initial screening pool (Round 0).

[0028] SELEX process (such as) Figure 1As shown in A): The recombinant eRF1 protein was coupled to agarose beads (the amino groups of the protein were covalently immobilized using NHS-agarose). During each round of screening, the immobilized eRF1 beads and the RNA library were incubated in binding buffer for 30 minutes (room temperature, binding buffer containing 20 mM HEPES (pH 7.4), 100 mM NaCl, 5 mM MgCl2, 1 mM DTT, with the remainder being 0.01% Tween 20 aqueous solution). After incubation, the beads were gently centrifuged, the supernatant was discarded, and the beads were washed sequentially with binding buffer and high-salt buffer (500 mM NaCl aqueous solution) to remove unbound and low-affinity sequences. Then, the mixture was heated to 95°C to denature and elute the RNA aptamers for 10 minutes. The RNA in the supernatant was collected and immediately precipitated with an equal volume of isopropanol. The eluted RNA was reverse transcribed into cDNA and the corresponding sequence was amplified by PCR (primers were targeted at the immobilized sequence region). The PCR product was then transcribed in vitro to obtain the next round of RNA library. The entire cycle took approximately 4–5 hours.

[0029] In the initial three rounds, to increase sequence diversity, competitive elution was not employed; instead, the selection pressure was gradually increased by increasing the washing intensity. Starting from the fourth round, a control blockade was introduced: equal amounts of bovine serum albumin (BSA) and total E. coli protein were added to the incubation step as non-specific competition to reduce false positive sequences. After the eighth round, a gradient reduction in the target protein amount (from an initial 30 µg to 5 µg) was attempted to screen for higher affinity binders. A total of 25 rounds of screening were performed, and the process was terminated when significant band enhancement was observed in the PCR products and sequencing showed sequence convergence.

[0030] Screening results: After 25 rounds, the PCR amplification products showed a single band, indicating a significant reduction in library complexity. The PCR products were then subjected to Illumina high-throughput sequencing and bioinformatics analysis. Figure 1 The results showed that the frequency of some sequences increased significantly starting from the 7th round, and by the 25th round, the top 10 most abundant sequences accounted for more than 45% of the total readings. Figure 1 Figure B shows the principal component analysis (PCA) results of the dominant sequences in the 25th round of enrichment pool. Different colored dots represent different sequence clusters, showing significantly enriched dominant sequence clusters, indicating that highly enriched candidate aptamer sequences were successfully obtained. Cluster analysis of the enriched sequences classified them into 5 main clusters, with the largest cluster accounting for approximately 30%, containing highly similar sequences (…). Figure 1 (B in the original text). The sequence with the most obvious enrichment was selected and named Dart1. The nucleotide sequence of aptamer Dart1 is shown in SEQ ID NO. 1.

[0031] Example 2: Identification of the binding activity of candidate aptamer Dart1 to eRF1

[0032] Materials: Dart1 obtained from screening in Example 1 was prepared by in vitro transcription and purified by PAGE. The preparation method of rice eRF1 recombinant protein was the same as in Example 1.

[0033] Dot blot assay: To rapidly compare the binding activity of the Dart1 aptamer to eRF1, this embodiment employs a dot blot method. 1 nM of Dart1 aptamer RNA was denatured at 95°C and then annealed on ice (to ensure correct conformation). 1 µL (approximately 10 pmol) was spotted onto a nitrocellulose membrane. After air-drying the nitrocellulose membrane, it was immersed in different concentrations of eRF1 protein solutions prepared with binding buffer (eRF1 concentrations of 1 nM, 2.5 nM, 5 nM, 10 nM, 100 nM, and 200 nM), and incubated at room temperature for 1 hour to allow the aptamer on the nitrocellulose membrane to bind to eRF1. The nitrocellulose membrane was then removed and quickly washed in binding buffer to remove unbound protein. Next, the membrane was processed according to standard Western blot procedures: first, the membrane was blocked with 5% skim milk powder for 1 hour, then incubated with mouse anti-eRF1 monoclonal antibody (ABclonal A5920, 1:1000 dilution) for 2 hours, washed with TBST, and incubated with horseradish peroxidase-labeled anti-mouse secondary antibody (ABclonal AS115, 1:5000) for 1 hour. An extraneous random sequence RNA (N40) was added as a control. Finally, the membrane was developed with ECL chemiluminescence buffer, and the results were captured using a gel imaging system.

[0034] Result: Dart1 produced a strong speckled signal ( Figure 2 The A group showed a more significant affinity for the control group. This result indicates that Dart1 has a better ability to bind to eRF1.

[0035] Dissociation constant determination: The interaction between aptamers Dart1 and eRF1 was determined using fluorescence polarization (FP) assay. The 5′ end of the aptamer (Dart1) labeled with 6-FAM was prefolded in binding buffer (20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2, 0.01% Tween-20) (heated at 70°C for 5 min, then annealed on ice for 10 min), with a final Dart1 concentration of 10 nM in each well. Different concentrations of recombinant eRF1 protein (1 nM–100 nM, 2-fold gradient) were added to black flat-bottomed 96-well plates and incubated at 25°C for 15 min. Anisotropy / polarization values ​​(Ex 485 nm, Em 528 nm) were measured using a fluorescence plate reader with a polarizer. After subtracting the binding buffer blank and confirming no significant change in total fluorescence intensity, the anisotropy / polarization values ​​were determined. Figure 2 (B) in the text. For example... Figure 2The anisotropy curve shown in B is fitted with the eRF1 concentration. A one-point binding model is used, and a quadratic equation considering ligand depletion is employed (GraphPad Prism 9, global fitting, n = 3 independent repetitions) to obtain the dissociation constant. K d The molecular weight is approximately 1.2 nM. This further confirms that Dart1 is an aptamer with high affinity.

[0036] Example 3: In vitro functional analysis of aptamer Dart1 for translation termination

[0037] Objective: To evaluate the effect of Dart1 aptamer on translation termination efficiency in extracellular translation systems.

[0038] Experimental Design: A dual-luciferase reporter mRNA was constructed using a plasmid from the Promega dual-luciferase reporter system as a template. An early stop codon was introduced via PCR. The plasmid tandemly encodes Renilla luciferase (RLuc) and Firefly luciferase (FLuc). The RLuc reading frame is normal, while an early stop codon (UGA or UAA) is inserted before the FLuc reading frame, preventing its normal expression. Only when translation termination is inhibited and readout occurs can the ribosome translate into the FLuc region and generate activity. Specifically, a UGA or UAA stop codon and a small linker sequence are inserted between the Renilla luciferase gene (RLuc) and the Firefly luciferase gene (FLuc). This results in the transcribed mRNA containing: a normal RLuc reading frame at the 5' end, followed by the stop codon, and then the FLuc reading frame (close enough to the stop codon to ensure that translation of FLuc can continue if termination does not occur). Under normal circumstances, the ribosome terminates at the UGA of this designed mRNA, and FLuc is not expressed (i.e., it does not produce activity). If termination is inhibited and readthrough occurs, the ribosome will translate FLuc and produce activity. By measuring the ratio of RLuc to FLuc activity, the translation readthrough rate can be indirectly reflected. The above reporter gene was cloned into the pT7 vector and transcribed in vitro to synthesize mRNA with Cap and poly(A) tails for cell-free translation experiments. A schematic diagram of the construction of the dual reporter gene vector is shown below. Figure 2 As shown in C.

[0039] Cell-free translation system: This experiment used a self-made Rice Cell Extract (RCE) system. The specific method was as follows: Aboveground tissue from 10-12 day old rice seedlings was thoroughly ground in liquid nitrogen, and homogenized with an extraction buffer containing 20 mM HEPES (pH 7.4), 100 mM KCl, 2.5 mM MgCl2, 2 mM DTT, and polyamines. The resulting homogenate was centrifuged and clarified, and the supernatant was collected as the crude extract. To remove residual endogenous RNA, micrococcal nuclease was used for treatment, followed by replacement with buffer (20 mM HEPES-KOH (pH 7.4), 100 mM KCl, 5 mM MgCl2, 1 mM DTT), and stored in glycerol buffer (30% v / v) at –80℃ for subsequent cell-free translation reactions. Rice Cell Extract cells were used as the in vitro translation system, with the addition of an energy regeneration system (ATP, GTP, and creatine phosphokinase / creatine kinase), an amino acid mixture, and an RNase inhibitor.

[0040] Each reaction consisted of 12.5 µL of translation extraction buffer, 1 µg of reporter mRNA, 100 nM aptamer RNA Dart1 (experimental group) or an equal volume of irrelevant random sequence RNA (negative control group, denoted as N40), with the remainder being water. After incubation at 30°C for 1 hour, the reaction was immediately stopped by placing the sample on ice to obtain the reaction products. No chemicals (such as SRI-41315) that could induce ribosomes to cross premature stop codons (PTCs) were added to the reaction system.

[0041] Detection: Take 5 µL of each reaction product and add firefly and Renalis luciferase substrates sequentially using a dual-luciferase reporter system, and measure the FLuc and RLuc luminescence values ​​respectively. Each group has 3 independent replicates.

[0042] The results are as follows Figure 2 As shown in D, the negative control group (Mock) with the addition of irrelevant random sequence RNA (N40) had a very low FLuc / RLuc ratio, while the addition of Dart1 aptamer significantly improved reading efficiency (the difference was statistically significant, p<0.001). Specifically, in the negative control group, the average FLuc / RLuc ratio of the Rluc-UGA-Fluc reporter system was 0.045 ± 0.003, corresponding to a reading efficiency of approximately 5.0 ± 0.8%; the FLuc / RLuc ratio of the Rluc-UAA-Fluc system was 0.038 ± 0.004, with a reading efficiency of approximately 4.0 ± 0.6%, both representing the background level in the system. When 100 nM Dart1 aptamer was added, the UGA reading efficiency significantly increased to 36.0 ± 2.1% (…). p<0.01), while the UAA readability also improved to 30.0 ± 1.8% (p<0.01).

[0043] The formula is: Readability = (FLuc / RLuc) 实验组 / (FLuc / RLuc) 终止无效情况 ×100%. Among them, the experimental group is a detection system containing a stop codon, and the invalid stop codon case refers to the case where the system is completely read without the stop codon.

[0044] Example 4: Construction of Dart1 aptamer plant expression vector

[0045] Objective: To construct a gene vector capable of efficiently expressing the Dart1 aptamer within rice cells.

[0046] Vector selection: The binary plant expression vector pTCK303 was selected as the basic vector. This vector carries the Ubi promoter, NOS terminator and hyg (hygromycin resistance) selection marker.

[0047] Insertion design: The corresponding transcript can be generated by directly inserting the DNA sequence of the Dart1 aptamer (encoding Dart1 RNA, containing the random region sequence of T7 transcription) between the promoter and terminator. However, considering that RNA transcribed by RNA polymerase II usually requires capping and tailing, this embodiment adds stabilizing structures and transcriptional regulatory elements to both ends of the Dart1 sequence: a short leader sequence and a Hammerhead ribozyme element are added to the 5' end to generate a fidelity 5' end; an HDV sequence is added after the 3' end of the aptamer sequence to help generate an active 3' end. The two ribozyme elements will autocatalytically excise after transcription, leaving accurate aptamer RNA. The above element sequences are spliced ​​with the Dart1 coding sequence by overlap PCR, and the synthesized product is about 80 bp long. After adding BamHI / SacI sites to both ends, it is cloned into the vector. The nucleotide sequence inserted between the pTCK303 Ubi promoter and NOS terminator in the vector (as shown in SEQ ID NO. 4) was verified by sequencing to be correct.

[0048] Vector transformation: The recombinant vector (pTCK303-Dart1) expressing the Dart1 aptamer was initially transcribed into rice protoplasts. The constructed pTCK303-Dart1 plasmid was then introduced into Agrobacterium EHA105 strain using electroporation. Recombinant strains were obtained by screening with kanamycin plates. Single colonies were picked and amplified to obtain recombinant Agrobacterium culture for transient transformation in rice.

[0049] Example 5: Localization analysis of the interaction between aptamers Dart1 and eRF1 under drought conditions

[0050] Figure 3 Figure A shows the colocalization results of eRF1 and the aptamer Dart1 in rice mesophyll protoplasts under normal and drought stress (with the addition of 20% PEG-6000 to simulate osmotic stress). The spatial distribution of both within the cell was observed by immunofluorescence (IF) labeling of eRF1 protein (red signal) and fluorescence in situ hybridization (FISH) labeling of Dart1 aptamer RNA (blue signal). In normal control (CK) protoplasts, the red and blue signals showed only weak overlap, with most eRF1 distributed in the cytoplasm, while the aptamer was mainly localized around the nucleus, indicating limited binding of the aptamer to eRF1 under no stress. In contrast, in cells subjected to 20% PEG-6000-induced drought stress, a significant colocalization signal was observed, indicating that a large number of aptamers bound to eRF1. Figure 3 (A in the middle). Figure 3 B in the figure represents the quantitative analysis of colocalization signal intensity: It was found that the colocalization rate of aptamers Dart1 and eRF1 increased by approximately 20% under stress conditions (from 0.4 to 0.6, p < 0.01), indicating that drought stress may cause conformational or intracellular distribution changes in eRF1, making it more easily captured by aptamers. This result suggests that aptamers play a more significant role under drought stress, supporting their characteristic as stress-activated regulatory molecules. Figure 3 Figure C in the figure represents the results of the pull-down experiment of Dart1, which shows that Dart1 can bind more eRF1 under drought stress.

[0051] Example 6: Verification of the improved drought resistance of aptamer Dart1 in transgenic rice

[0052] Transient transformation of rice: The recombinant vector (pTCK303-Dart1) carrying the 35S:Dart1 expression cassette was transformed into Agrobacterium tumefaciens EHA105 and cultured overnight to OD. 600 ≈0.8, after centrifugation, resuspended in induction buffer (10 mM MgCl2, 10 mM MES, pH 5.6, containing 100 µM acetylsylcholine) to OD. 600 ≈0.6. The roots and base of 14-day-old plants were immersed in the bacterial solution, and a negative pressure of -60 to -70 kPa was applied for 3 to 5 minutes. After removing the negative pressure, the plants were co-cultured in the dark for 4 hours. Subsequently, the plants were rinsed twice with induction buffer containing 200 to 250 mg / L ceftiofur to remove residual bacterial solution, and the surface liquid was drained. The control group (CK group) was treated under the same conditions using plasmid-free EHA105 throughout the entire process to control for background effects.

[0053] Plant seedling environment control: The material described in this embodiment is rice ( Oryza sativa cv. NipponbareT0 generation seedlings obtained from transient transformation were used in two groups: a blank control (CK) and a Dart1 treatment (Dart1). To verify the introduction and expression of Dart1 in the T0 generation seedlings, qRT-PCR was used for detection. Successfully transformed T0 seedlings were selected for drought stress experiments. The environment was kept constant throughout the seedling stage and drought stress treatment: light / dark temperatures were set at 30℃ / 25℃, relative humidity at 50%, light intensity at approximately 25000 Lux, and light / dark cycles of 12h / 12h. Seven-day-old disease-free seedlings with uniform growth were routinely cultured under the same conditions until 14 days of age before entering the experiment. To reduce position effects, plants were randomly rearranged after each operation; each CK and Dart1 treatment group contained 15 seedlings, with three independent biological replicates (45 seedlings per group).

[0054] Drought stress: Four hours after transient transformation (root infection), 14-day-old seedlings from both the CK and Dart1 groups were simultaneously transferred to 1 / 2 MS + 20% (w / v) PEG-6000 stress solution under environmental parameters identical to those used in seedling cultivation (light / dark 30℃ / 25℃, relative humidity 50%, light intensity approximately 25000 Lux, light / dark 12 h / 12 ​​h). To reduce position effects, seedlings were randomly rearranged after each operation during treatment; both groups consisted of 15 seedlings per group, with 3 independent biological replicates (45 seedlings per group in total). Time points and measurements: 24 hours after stress, the second fully expanded leaf was collected for qRT-PCR to confirm Dart1 expression. At the end of 7 days of continuous stress, stem length, root length, fresh weight, dry weight, total chlorophyll content (80% acetone extraction, A645 / A663), and electrolyte leakage rate (C1 / C×100%) were measured. Immediately after day 7, the plant was rehydrated. Survival rate was calculated 3 days after rehydration (day 10) based on whether the plant could stand upright again and had new leaves unfolding. Results are expressed as mean ± SD. One-way ANOVA (α = 0.05) was used to compare the difference in Dart1 expression relative to the control (CK). Specific expression determination and index measurements are shown below.

[0055] Dart1 Introduction and Expression Confirmation: To ensure the verifiability of the method, stratified molecular confirmation was performed on the Dart1 group, with the CK group serving as a negative control. Specifically, qRT-PCR was performed: the second fully expanded leaf after 24 hours of stress was collected, and total RNA was extracted by grinding in liquid nitrogen. After removing DNA, reverse transcription was performed. The amplification program was 95℃ for 3 min; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles. The melting curve showed a single peak. (The last sentence appears to be incomplete and possibly refers to a different process.) -ΔΔCt Relative expression was calculated. The upstream and downstream primer sequences used to determine Dart1 expression are shown below:

[0056] qDart1-F: GGACGACTTCAGCCACGAT (SEQ ID NO. 7);

[0057] qDart1-R:TACGATTGCAGCATCGGGA (SEQ ID NO. 8).

[0058] Data interpretation and compliance: All evaluation indicators were statistically compared only between the Dart1 and CK groups; drought stress was only modeled using 20% ​​PEG-6000 for 72 consecutive h; environmental conditions were consistent before and after treatment; plants were randomly distributed and replicated in equal numbers to ensure the reliability of the results and the feasibility of the patent.

[0059] Measurement indicators:

[0060] Survival rate: When the drought treatment ended (day 7), watering was resumed, and the percentage of plants that were able to stand upright and unfold new leaves 3 days later (i.e. day 10 of the treatment) was counted as the survival rate.

[0061] Physiological indicators: At the end of 7 consecutive days of drought stress (15% PEG-6000), samples were collected and measured simultaneously with the control group (CK):

[0062] 1. Survival rate (%): Calculate the number of surviving plants per treatment / total number of plants × 100% (counting whole pots / boxes).

[0063] 2. Stem length (cm): Measured on the main stem of the plant, from the base of the leaf sheath to the tip of the second fully unfolded leaf (vernier calipers).

[0064] 3. Root length (cm): from the root-stem junction to the tip of the main root (ruler / caliper).

[0065] 4. Fresh weight and dry weight (mg): The fresh weight is measured after harvesting the whole seedling (above-ground parts + roots) and absorbing the surface water; the dry weight is measured after drying at 70℃ to constant weight.

[0066] 5. Total chlorophyll content (μg / mL): Take the second fully expanded leaf (from the same leaf position of each plant, mix and sample), extract with 80% acetone aqueous solution, measure A645 and A663, and calculate total chlorophyll according to Arnon formula.

[0067] 6. Ion (electrolyte) leakage rate (%): After rinsing the second fully expanded leaf, a leaf disc with a diameter of 0.5 cm was taken with a punch and placed in ionized water at 25℃ for 2 h to measure the initial conductivity C1; then the total conductivity C2 was measured in a 100℃ water bath for 10 min; the calculation formula is as follows: Ion leakage rate = C1 / C2 × 100%.

[0068] Molecular indicators: Ten days after drought treatment, new leaves from transgenic and control (wild-type) plants were collected, and total RNA was extracted for qRT-PCR detection of some typical drought response genes. OsDREB2A, OsLEA3, OsP5CS1The expression of Actin gene ( ). OsACT1 The relative expression level was calculated using the standard curve method as an internal reference. qRT-PCR detection. OsDREB2A, OsLEA3, OsP5CS1 The upstream and downstream primers used for expression are shown below.

[0069] q OsDREB2A -F (SEQ ID NO. 9):ATCAAGTGGTGGAAGGAGCA;

[0070] q OsDREB2A -R (SEQ ID NO. 10): ATCTCAGCCACCCACTTACC;

[0071] q OsLEA3 -F (SEQ ID NO. 11): AAGGAGGCGACGAAGGAGAA;

[0072] q OsLEA3 -R (SEQ ID NO. 12): GGCAGAGTCCTTGGTGTACT;

[0073] q OsP5CS1 -F (SEQ ID NO. 13):TGAAGCGCGTCATCATCAAG;

[0074] q OsP5CS1 -R (SEQ ID NO. 14):TTGACAAGCTTTCCGGTACCT;

[0075] q OsACT1 -F (SEQ ID NO. 15): GTCCTCTTCCAGCCTTCCTT;

[0076] q OsACT1 -R (SEQ ID NO. 16): CTCATCCTGTCAGCAATGCC.

[0077] Figure 4 Photo A shows a phenotypic comparison of rice seedlings at the three-leaf stage after transient expression of the Dart1 aptamer under drought conditions for 7 days: the left side shows wild-type control seedlings (CK), and the right side shows seedlings transiently transfected with the Dart1 aptamer using the Agrobacterium tumefaciens infiltration method. Under normal water supply conditions, there was no significant difference in growth between the two types; however, after 7 days of drought treatment (watering was stopped), the control seedlings (CK) showed severe wilting and yellowing leaves, while the seedlings expressing the Dart1 aptamer maintained relatively upright and green leaves.

[0078] Figure 4B in the figure represents the results of RT-PCR analysis, which detected the Dart1-specific sequence. Strong Dart1 RNA expression was detected 24 hours after transformation, while no signal was detected in the control, confirming the expression of Dart1 in transiently transformed seedlings.

[0079] Figure 4 The C quantified the physiological indicators of seedlings after the above drought treatment: the results showed that, compared with the control (CK), the root length of the Dart1 expression group increased by about 20%, the aboveground fresh weight increased by about 25%, and the survival rate, stem length, whole plant dry weight and total chlorophyll content were all significantly higher than those of the control; at the same time, the electrolyte leakage rate was significantly reduced, indicating better membrane integrity and homeostasis maintenance (all of the above are n = 30, p <0.05). The values ​​in the figure are presented on a log2 scale, and the statistical significance is calculated based on the original data.

[0080] Figure 4 In the figure, D represents the qRT-PCR results of drought stress-related genes. The expression levels of related genes in Dart1 aptamer seedlings and wild-type seedlings under drought stress were compared after 10 days of treatment. The results showed that the Dart1 aptamer group had relatively higher expression of drought stress-related genes, confirming that Dart1 aptamer exerted a binding inhibitory effect in seedlings. These transient expression experiments demonstrate that the Dart1 aptamer can enhance the drought resistance of rice seedlings.

[0081] Summary: This example demonstrates that, under prolonged drought stress, Dart1 aptamer-transformed rice exhibits significantly better drought resistance than the wild type. Figure 4 The data showed higher survival rates, less phenotypic damage, more stable physiological indicators, and more fully relevant molecular responses to drought stress. These data strongly demonstrate that the Dart1 aptamer can indeed enhance drought resistance in living plants, and suggest that its mechanism is related to enhancing the expression of stress-resistance genes and reducing eRF1 activity.

Claims

1. An RNA aptamer targeting the translation termination factor eRF1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that, The DNA sequence containing the RNA aptamer of claim 1 is provided; the 5' and 3' ends of the DNA sequence of the RNA aptamer are provided with stabilizing structures and transcriptional regulatory elements.

3. The recombinant expression vector according to claim 2, characterized in that, The RNA aptamer's DNA sequence has a T7 promoter and a Hammerhead ribozyme element added to the 5' end, and an HDV ribozyme element added to the 3' end.

4. The application of the recombinant expression vector according to claim 2 in improving the drought resistance of rice.

5. The application according to claim 4, characterized in that, The recombinant expression vector of claim 2 is used to improve rice survival rate, promote rice growth, increase rice chlorophyll content, and reduce ion leakage under drought stress.

6. The application according to claim 4, characterized in that, The recombinant expression vector of claim 2 enhances the expression of drought-responsive genes, thereby improving the drought resistance of rice; the drought-responsive gene is... OsDREB2A , OsLEA3 and OsP5CS1 .

7. A method for preparing transgenic cells, characterized in that, Includes the step of transferring into the recombinant expression vector as described in any one of claims 2-3.

8. A method for preparing drought-resistant rice, characterized in that, Includes the step of transferring into the recombinant expression vector as described in any one of claims 2-3.

Images