Application of rice gene osfmo1 against brown planthopper

Abstract

This disclosure provides an application of the rice gene OsFMO1, which enhances resistance to brown planthoppers, belonging to the field of biotechnology. The application includes knocking out the OsFMO1 gene to improve rice resistance to brown planthoppers. The nucleotide sequence of the OsFMO1 gene is shown in SEQ ID NO: 1 in the sequence listing. This disclosure provides an application of the rice gene OsFMO1, which enhances rice resistance to brown planthoppers by knocking out the OsFMO1 gene, and the improvement effect is significant, demonstrating great potential for agricultural application.

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, and in particular to the application of a rice gene, OsFMO1, which provides resistance to brown planthoppers. Background Technology

[0002] Rice (Oryza sativa) is one of the world's most important food crops, with more than half of the population relying on it as a staple food. Brown planthopper (Nilaparvata lugens) Brown planthoppers are a specialized rice-feeding insect that primarily sucks sap from the phloem of rice plants using its stylet. They cause significant loss of nutrients and water, leading to wilting, lodging, and reduced grain filling rates. In severe cases, they can cause "planthopper fire" phenomena. Furthermore, brown planthoppers spread large amounts of bacteria and viruses, further threatening rice production. Brown planthoppers infest large areas of rice annually in my country, causing the greatest losses among various rice pests and diseases.

[0003] Cultivating brown planthopper-resistant rice varieties is an effective way to control the reproduction of brown planthoppers and is currently the most environmentally friendly green control method. It is highly compatible with other control measures such as healthy cultivation, pesticide control, and biological control. Planting brown planthopper-resistant rice varieties can avoid the impact of brown planthoppers on rice, thereby reducing the economic burden on farmers. However, due to the emergence of new brown planthopper populations, the resistance of early resistance genes is gradually overcome by the brown planthoppers, weakening the resistance of these early genes. Therefore, discovering new brown planthopper-resistant genes is of great significance.

[0004] Public content

[0005] To address the problems of existing technologies, this disclosure provides an application of the rice gene OsFMO1, which enhances resistance to brown planthoppers in rice. The technical solution is as follows:

[0006] This disclosure provides an application of the rice resistance gene OsFMO1 to brown planthopper, the application including: knocking out the gene OsFMO1 to improve the resistance of rice to brown planthopper, the nucleotide sequence of the gene OsFMO1 is shown in SEQ ID NO: 1 in the sequence listing.

[0007] Specifically, the amino acid sequence of the protein encoded by the gene OsFMO1 is shown in SEQ ID NO: 2 in the sequence listing.

[0008] Specifically, the application includes knocking out the OsFMO1 gene in rice using CRISPR / Cas9 gene editing technology.

[0009] Specifically, the rice variety in question is Nipponbare.

[0010] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides an application of the rice resistance gene OsFMO1 to brown planthoppers. This application includes knocking out the OsFMO1 gene to improve the resistance of rice to brown planthoppers, and the improvement effect is significant, with great potential for agricultural application. Attached Figure Description

[0011] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0012] Figure 1 This is a comparison diagram of the gene sequence of plants after the OsFMO1 gene mutation provided in this embodiment of the present disclosure. In the diagram, N represents the control group N, OsFMO1-KO-1 represents the experimental group OsFMO1-KO-1, and OsFMO1-KO-2 represents the experimental group OsFMO1-KO-2.

[0013] Figure 2 The embodiments disclosed herein provide photographic comparison images of plants in the seedling stage after feeding by brown planthoppers. In the figures, N represents the control group N, OsFMO1-KO-1 represents the experimental group OsFMO1-KO-1, and OsFMO1-KO-2 represents the experimental group OsFMO1-KO-2.

[0014] Figure 3 This embodiment of the present disclosure provides a statistical chart of the resistance level scores of brown planthoppers in seedlings after feeding on them. In the chart, N represents the control group N, OsFMO1-KO-1 represents the experimental group OsFMO1-KO-1, and OsFMO1-KO-2 represents the experimental group OsFMO1-KO-2. Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to the accompanying drawings.

[0016] Example

[0017] This disclosure provides an application of the rice brown planthopper resistance gene OsFMO1, which includes: knocking out the OsFMO1 gene to improve the brown planthopper resistance of rice, wherein the nucleotide sequence of the OsFMO1 gene is shown in SEQ ID NO: 1 in the sequence listing.

[0018] Specifically, the amino acid sequence of the protein encoded by the gene OsFMO1 is shown in SEQ ID NO: 2 in the sequence listing.

[0019] Specifically, the application includes knocking out the OsFMO1 gene in rice using CRISPR / Cas9 gene editing technology.

[0020] Furthermore, the rice material is Nipponbare.

[0021] In this embodiment, the target sequence of the gene OsFMO1 was selected, and the target (OsFMO1-T) was designed using the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The sequence of the target OsFMO1-T is shown as SEQ ID NO: 3 in the sequence listing, specifically: GCGGCGTGCCT GCGCGAGCGCGG.

[0022] The U6b promoter and sgRNA fragment were amplified from the pYLsgRNA-OsU6b plasmid using the high-fidelity enzyme KOD-plus via PCR (Polymerase Chain Reaction). Specifically, using the pYLsgRNA-OsU6a plasmid as a template, a first round of PCR amplification was performed using the first forward primer and the first reverse primer to obtain the first amplified product containing the OsFMO1-T U6b promoter. Using the pYLsgRNA-OsU6a plasmid as a template, a second round of PCR amplification was performed using the second forward primer and the second reverse primer to obtain the second amplified product containing the OsFMO1-T sgRNA fragment.

[0023] In this embodiment, the first forward amplification primer (UF) is as shown in SEQ ID NO: 4 in the sequence listing, specifically: CTCCGTTTTACCTGTGGAATCG; the first reverse amplification primer (OsFMO1-U6bT) is as shown in SEQ ID NO: 5 in the sequence listing, specifically: CGCTCGCGCAGGCACGC CGCAACACAAGCGGCAGC.

[0024] The second forward amplification primer (OsFMO1-gT) is shown in SEQ ID NO: 6 in the sequence listing, specifically: CGGCGTGCCTGCGCGAGCGGTTTTAGAGCTAGAA; the second reverse amplification primer (gR-R) is shown in SEQ ID NO: 7 in the sequence listing, specifically: CGGAGGAAAATTCCATC CAC.

[0025] The amplification system for the first round of PCR amplification, in 50 μL increments, includes: 5 μL of 10× buffer; 5 μL of 2 mM dNTP; 1.5 μL of the first forward primer at a concentration of 10 μM; 1.5 μL of the first reverse primer at a concentration of 10 μM; 1 μL of pYLsgRNA-OsU6b plasmid; 1 μL of KOD-Plus-Neo polymerase at a concentration of 1 U / μL; and 35 μL of ddH2O.

[0026] The amplification program for the first round of PCR amplification was as follows: pre-denaturation at 98℃ for 2 min; followed by 30 cycles, each cycle consisting of: denaturation at 98℃ for 10 s, annealing at 55℃ for 15 s, and extension at 68℃ for 40 s.

[0027] The second round of PCR amplification system, in 50 μL increments, includes: 5 μL of 10× buffer; 5 μL of 2 mM dNTP; 1.5 μL of 10 μM second forward primer; 1.5 μL of 10 μM second reverse primer; 1 μL of pYLsgRNA-OsU6b plasmid; 1 μL of 1 U / μL KOD-Plus-Neo polymerase; and 35 μL of ddH2O.

[0028] The amplification program for the second round of PCR amplification was as follows: pre-denaturation at 98℃ for 2 min; followed by 30 cycles, each cycle consisting of: denaturation at 98℃ for 10 s, annealing at 55℃ for 15 s, and extension at 68℃ for 40 s.

[0029] The first amplification product was recovered and purified to obtain the purified U6b promoter.

[0030] The second amplification product was recovered and purified to obtain the purified sgRNA fragment.

[0031] The purified U6b promoter, purified sgRNA fragment, and target OsFMO1-T were linked together using overlap extension PCR technology to construct an sgRNA expression cassette controlled by the U6b promoter.

[0032] The amplification process of overlap extension PCR includes: a first round of reaction amplification and a second round of reaction amplification.

[0033] The amplification system for the first round of reaction included: 5 μL of 10× buffer; 3 μL of 25 mM MgSO4; 5 μL of 2 mM dNTPs; 50 ng of U6b promoter; 50 ng of sgRNA fragment; and ddH2O added to a total volume of 50 μL.

[0034] The amplification program for the first round of reaction was as follows: 94℃ for 2 min of pre-denaturation; 98℃ for 10 s, 50℃ for 60 s, 68℃ for 45 s, for a total of 10 cycles, to obtain the first amplification product.

[0035] The amplification system for the second round of reaction amplification included: 50 μL of the first amplification product; 5 μL of 10× buffer; 3 μL of 25 mM MgSO4; 5 μL of 2 mM dNTPs; 3 μL of the first forward primer; 3 μL of the second reverse primer; 2 μL of KOD Plus Neo; and 27 μL of ddH2O.

[0036] The amplification program for the second round of reaction amplification was as follows: 94℃ for 2 min of pre-denaturation; 98℃ for 10 s, 55℃ for 30 s, 68℃ for 1 min, for a total of 18 cycles.

[0037] After the overlap extension PCR reaction was completed, the amplification product was obtained, and 2 μL of the amplification product was analyzed by agarose gel electrophoresis. The target product (sgRNA expression cassette) was recovered by gel excision, and the target product was approximately 700 bp. The sgRNA expression cassette was ligated into the pYLCRISPR / Cas9Pubi-H vector using the Golden Gate ligation method. The pYLCRISPR / Cas9Pubi-H vector was produced and donated by Academician Liu Yaoguang's team using existing technology.

[0038] The reaction system for the sgRNA expression cassette ligation reaction included: 1.5 μL of 10×CutSmart Buffer; 1.5 μL of 10 mM ATP; 60–80 ng of pYLCRISPR / Cas9Pubi-H vector; 10–15 ng of the target product (sgRNA expression cassette); 10 U of Bsa I-HF; 35 U of T4 DNA ligase; and ddH2O to a final volume of 15 μL.

[0039] Specifically, the amplification program for the sgRNA expression cassette ligation reaction included: 37℃ for 5 min; 10℃ for 5 min, 20℃ for 5 min; and finally 37℃ for 5 min, for a total of 10–15 cycles. This yielded the OsFMO1 gene knockout vector.

[0040] The OsFMO1 gene knockout vector was transformed into Agrobacterium competent cells EH105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. Then, the OsFMO1 gene RNA editing vector was transformed into the recipient material Nipponbare rice using Agrobacterium-mediated transformation, thereby obtaining rice knockout lines of the OsFMO1 gene. The specific method is as follows:

[0041] 1. Callus induction:

[0042] Remove the seed coat from the seeds of Nipponbare rice. Select 15g of mature, plump seeds.

[0043] After rinsing the seeds four times with distilled water, they were then shaken on a shaker with 75% ethanol for 2–5 minutes, rinsed four more times with distilled water, and finally treated with 0.15% mercuric chloride at 130 rpm for 12 minutes. The mercuric chloride-treated seeds were then washed four times with sterile distilled water, transferred to filter paper, and dried on a clean surface for later use.

[0044] The dried seeds were transferred to N6 induction medium using tweezers and sealed with sealing film. Callus tissue was obtained after approximately 4 weeks of dark incubation at 28°C.

[0045] 2. Succession:

[0046] The pale yellow, relatively dense callus tissue was picked and placed in a fresh N6 induction medium and cultured in the dark at 28°C for 10 days to obtain subcultured callus tissue.

[0047] 3. Immersion:

[0048] The concentration of the OsFMO1 gene knockout rice lines was adjusted to OD600 = 0.8–1.0 before infecting subcultured callus tissue. After 15 min of inoculation, the callus tissue was carefully transferred to sterilized filter paper. After drying on a clean bench, it was transferred to 1 / 2 N6 solid medium (containing 1 / 1000 AS). It was incubated in the dark at 20°C for two days.

[0049] 4. Sterilization

[0050] Remove the stained callus tissue from the dark incubator, place it on sterilized filter paper, and dry it on a laminar flow hood for 15 minutes. Transfer the callus tissue from the filter paper to 250 mL of sterile water and wash it four times.

[0051] Wash the callus twice each with sterile water containing 1 / 1000 cephalosporin and sterile water containing 1 / 500 cephalosporin. Transfer the callus to new sterile filter paper with a spoon and dry it in a laminar flow hood for three hours.

[0052] 5. Screening

[0053] The dried callus tissue was transferred to a selection medium containing 250 mg / L cephalosporin and 50 mg / L hygromycin. It was then incubated in the dark at 28°C for 30 days.

[0054] 6. Differentiation

[0055] The callus tissues that grew well and were dense on the screening medium were transferred to the differentiation medium and cultured at 28°C under light for 40 days.

[0056] 7. Rooting and hardening off seedlings

[0057] Green seedlings growing on differentiation medium were transferred to rooting medium and cultured at 28°C under light for 15 days. After 15 days, the seedlings were removed from the rooting medium and placed in centrifuge tubes containing sterile water for culture, with the sterile water being changed continuously. After one week, the seedlings were transplanted into the field. Once the seedlings matured, T1 generation seeds could be obtained. After two generations of self-pollination, T2 generation seeds could be obtained.

[0058] In this embodiment, two homozygous knockout lines, the T2 generation of OsFMO1-KO-1 and OsFMO1-KO-2, were selected as the experimental group. Nipponbare rice was used as the control group (N). Sequencing primers OsFMO1-F (SEQ ID NO: 8), specifically ATGGCGGC GAGGGTGGTGT, and OsFMO1-R (SEQ ID NO: 9), specifically AGTC GACGAACTGGCGGCGGT, were designed on both sides of the target site. DNA amplification and sequencing were performed on the transgenic plants, combined with... Figure 1 It can be seen from the nucleic acid sequence comparison that, compared with the transgenic recipient variety Nipponbare, the OsFMO1-KO-1 strain has a 2-base deletion in the target region, and the OsFMO1-KO-2 strain has a 4-base deletion in the target region.

[0059] Resistance to brown planthoppers was identified in the T2 generation of transgenic homozygous lines edited with the OsFMO1 gene. T2 generation seeds from the control group N and two experimental groups (OsFMO1-KO-1 and OsFMO1-KO-2) were sown in disposable circular plastic cups (10 cm in diameter), with 15 seeds sown in each cup. When the plants reached the two-leaf stage, 2nd-3rd instar brown planthopper nymphs were introduced at a density of 8 nymphs per seedling, and the plants were covered with a mesh net. Damage from brown planthopper feeding was observed daily in the control group N and the two experimental groups, and photographs were taken and recorded. Figure 2 As shown, after the test material was inoculated with brown planthoppers, most of the plants in the control group showed a death phenotype. The resistance score for the brown planthoppers was calculated, and the resistance score of the control group plants was 8.8. Figure 3 As shown. See also Figure 2 It can be seen that only a few plants in the two experimental groups (OsFMO1-KO-1 and OsFMO1-KO-2) withered or their leaves turned yellow. Figure 3 As shown, the resistance scores for the two experimental groups were 5.07 and 4.35, respectively. The lower the resistance score, the stronger the plant's resistance to brown planthoppers. Figure 3 The data provided are the mean and standard deviation of three independent biological replicates. Figure 2 and Figure 3 It can be seen that knocking out the OsFMO1 gene can significantly enhance the plant's resistance to brown planthopper, indicating that knocking out the OsFMO1 gene can improve the resistance of rice to brown planthopper.

[0060] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. A gene for rice resistance to brown planthopper OsFMO1 Its application in improving rice resistance to brown planthopper is characterized by, The application is: knocking out genes using CRISPR / Cas9 gene editing technology. OsFMO1 The gene is used to improve rice's resistance to brown planthoppers. OsFMO1 The nucleotide sequence is shown in SEQ ID NO: 1 in the sequence listing, and the gene knockout is described by CRISPR / Cas9 gene editing technology. OsFMO1 The target sequence is shown in SEQ ID NO: 3 in the sequence listing.

2. The application according to claim 1, characterized in that, The gene OsFMO1 The amino acid sequence of the encoded protein is shown in SEQ ID NO: 2 in the sequence listing.

3. The application according to claim 1, characterized in that, The rice variety in question is Nipponbare.

Images