Application of pagSCL28a gene in regulating poplar growth and development

By regulating the expression of the poplar PagSCL28a gene and inhibiting the thickening of secondary cell walls, precise regulation of poplar growth and development was achieved, solving the problem of improving poplar wood quality and growth traits, and increasing timber yield and quality.

CN120924593BActive Publication Date: 2026-01-02ZHEJIANG FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511469473.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-01-02
Estimated Expiration
2045-10-15

AI Technical Summary

Technical Problem

Current technologies lack a systematic understanding of the regulatory mechanisms of SR protein family members in poplar wood cell differentiation and secondary cell wall deposition, resulting in a lack of key gene targets that can be used to precisely regulate poplar wood quality and growth traits.

Method used

By regulating the expression level of the PagSCL28a gene, the thickening of the secondary cell wall of poplar was inhibited, the height, stem diameter and leaf area of ​​poplar were reduced, and the lignin deposition in the xylem was increased. The overexpression vector of the PagSCL28a gene was used for genetic transformation of poplar to achieve precise regulation of poplar growth and development.

Benefits of technology

It significantly inhibits secondary cell wall thickening, reduces poplar tree height and stem diameter, increases xylem lignin deposition, provides targeted improvement of poplar wood quality and growth traits, enhances timber yield and quality, and strengthens stress resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924593B_ABST
    Figure CN120924593B_ABST
Patent Text Reader

Abstract

This invention discloses PagSCL28a The application of genes in regulating the growth and development of poplar trees belongs to the field of agricultural bio-genetic engineering technology. PagSCL28a The application of genes in regulating the growth and development of poplar trees, the PagSCL28a The nucleotide sequence of the gene is shown in SEQ ID NO:1. And using the described... PagSCL28a The method for genetically breeding transgenic poplar trees includes the following steps: S1, cloning poplar trees PagSCL28a Gene; S2, will PagSCL28a Genes were constructed into plant expression vectors to obtain recombinant vectors; in step S3, the recombinant vectors obtained in step S2 were transformed into poplar tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic plants were obtained through screening. This invention provides a new option for regulating the growth and development of poplar trees, and provides key molecular targets and technical means for improving poplar timber yield, optimizing quality, and enhancing stress resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of agricultural bioengineering technology, and particularly relates to PagSCL28a Application of a gene in regulating growth and development of a poplar. BACKGROUND

[0002] Alternative splicing is a key post-transcriptional regulatory mechanism in eukaryotes, which produces diverse transcripts and proteins through variable processing of pre-mRNA, significantly enriching the diversity of transcriptome and proteome, and plays an important role in multiple processes of plant growth and development. As the core regulatory elements of this mechanism, SR protein family, which is rich in serine / arginine, is particularly crucial, which participates in the splicing regulation of pre-mRNA through RNA recognition motifs and serine / arginine-rich domains, and has been confirmed to be involved in various biological processes such as seed germination, root growth, leaf morphogenesis, etc.

[0003] The secondary growth of woody plants, especially the development of secondary xylem, is the core of its radial growth, which directly determines the physical and mechanical properties of wood and economic value. As an important fast-growing timber tree species and a model species for woody plant research, the improvement of wood quality and biomass of poplar has always been the focus of forestry research. However, the specific regulatory mechanisms of SR protein family members, especially SCL subfamily members, in the process of secondary growth such as xylem cell differentiation and secondary cell wall deposition are still lacking in systematic cognition. Existing researches mostly focus on the functions of SR proteins in herbaceous plants, and the molecular mechanisms of how these proteins regulate the development of secondary xylem through alternative splicing in woody plants have not been clearly defined, which leads to a lack of key gene targets that can be used to precisely regulate the wood quality and growth traits of poplar. Therefore, in-depth analysis of the mechanism of SR protein family members in poplar in the process of growth and development and secondary cell wall formation is of great significance for perfecting the theoretical system of plant secondary growth regulation and providing new molecular targets for the improvement of poplar wood quality and sustainable development of the industry. SUMMARY

[0004] The application aims to provide PagSCL28a Application of a gene in regulating growth and development of a poplar, which provides a new choice for regulating growth and development of a poplar, and clarifies PagSCL28a The gene can specifically regulate the development of xylem and secondary cell wall thickening of a poplar, which provides a key molecular target and technical means for improving the yield, quality and stress resistance of poplar wood.

[0005] To solve the above technical problems, the technical scheme adopted by the application is as follows:

[0006] PagSCL28a Application of a gene in regulating growth and development of a poplar, wherein the PagSCL28aThe nucleotide sequence of the gene is shown as SEQ ID NO:1.

[0007] The application also provides a transgenic poplar plant as described above. PagSCL28a The application also provides an application of the gene in regulating the thickening of the secondary cell wall of the poplar.

[0008] Preferably, the thickening of the secondary cell wall of the poplar is inhibited by regulating the expression level of the gene. PagSCL28a Preferably, the thickening of the secondary cell wall of the poplar is inhibited by regulating the expression level of the gene.

[0009] Preferably, the thickening of the secondary cell wall of the poplar is inhibited by overexpressing the gene. PagSCL28a Preferably, the thickening of the secondary cell wall of the poplar is inhibited by overexpressing the gene.

[0010] Preferably, the thickening of the secondary cell wall of the poplar is inhibited by overexpressing the gene. PagSCL28a Preferably, the thickening of the secondary cell wall of the poplar is inhibited by overexpressing the gene, the height, stem diameter and leaf area of the poplar are reduced, and the lignin deposition in the xylem is increased.

[0011] The application also provides a method for cultivating a transgenic poplar plant as described above. PagSCL28a The application also provides a method for cultivating a transgenic poplar plant as described above.

[0012] S1, cloning a poplar gene; PagSCL28a S1, cloning a poplar gene;

[0013] S2, constructing the poplar gene into a plant expression vector to obtain a recombinant vector; PagSCL28a S2, constructing the poplar gene into a plant expression vector to obtain a recombinant vector;

[0014] S3, transforming the recombinant vector obtained in S2 into a poplar tissue culture seedling through an agrobacterium-mediated method to obtain a transgenic plant through screening.

[0015] Preferably, the cloning of the poplar gene in S1 is specifically performed as follows: PagSCL28a Preferably, the cloning of the poplar gene in S1 is specifically performed as follows:

[0016] Total RNA of the poplar is extracted and reverse transcribed into cDNA as a template, and primers PagSCL28a -F and PagSCL28a -R are used for PCR amplification to obtain the poplar gene. PagSCL28a -F and PagSCL28a -R are used for PCR amplification to obtain the poplar gene.

[0017] The nucleotide sequence of the primer PagSCL28a -F is shown as SEQ ID NO:2, and the nucleotide sequence of the primer PagSCL28a -R is shown as SEQ ID NO:3.

[0018] The application also provides an overexpression vector for regulating the growth and development of the poplar, wherein the overexpression vector comprises the poplar gene. PagSCL28a The application also provides an overexpression vector for regulating the growth and development of the poplar, wherein the overexpression vector comprises the poplar gene.

[0019] The application also provides a strain for regulating the growth and development of the poplar, wherein the strain comprises the overexpression vector.

[0020] This invention also provides a method for regulating the quality of poplar wood by changing... PagSCL28a Gene expression levels regulate the elongation of poplar wood fiber cells and the thickening of secondary walls.

[0021] Compared with the prior art, the present invention has the following advantages and technical effects:

[0022] 1. This invention provides PagSCL28a The application of genes in regulating the growth and development of poplar trees is clearly stated in this invention. PagSCL28a The gene can specifically regulate the development of poplar xylem and the thickening of secondary cell walls. Overexpression of this gene can significantly inhibit the thickening of secondary cell walls, reduce poplar height, stem diameter and leaf area, and increase xylem lignin deposition.

[0023] 2. The PagSCL28a Gene regulation has clear targeting and operability. By constructing overexpression vectors, its expression level can be precisely controlled to achieve targeted improvement of poplar wood quality and growth traits.

[0024] 3. This invention provides key molecular targets and technical means for increasing poplar timber yield, optimizing quality, and improving stress resistance. The transgenic poplars cultivated can meet different forestry production needs and have important practical value for promoting the sustainable development of the poplar industry.

[0025] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0026] Figure 1 for PagSCL28a Analysis of relative expression levels in different tissues of 84K poplar;

[0027] Figure 2 This refers to the genetic transformation process of 84K poplar, in which... Figure 2 In this context, A represents the callus infection process. Figure 2 In this context, B represents the induction of callus bud differentiation. Figure 2 C in the text represents the screening of resistance rooting medium;

[0028] Figure 3 for PagSCL28a Identification of overexpressing plants and analysis of transcriptional levels, among which, Figure 3 In the figure, A represents the detection of DNA levels in overexpressing plants. Figure 3 B in the figure represents the detection of RNA levels in overexpressing plants. represent P <0.05, represent P <0.01, represent P <0.001;

[0029] Figure 4 Figure 1 is a phenotype diagram of the overexpression transgenic lines and WT in soil for 50 days, wherein, PagSCL28a A in Figure 1 is the morphological comparison result, Figure 4 B in Figure 1 is the leaf and stem segment comparison result, Figure 4 C in Figure 1 is the plant height determination result, Figure 4 D in Figure 1 is the ground diameter determination result, Figure 4 E in Figure 1 is the first to eighth leaf area; Figure 4

[0030] Figure 5 Figure 2 is a comparison of the leaf shape and the leaf length-width ratio of the overexpression transgenic lines and WT, wherein, PagSCL28a A in Figure 2 is the plant top view, Figure 5 B in Figure 2 is the fifth unfolded leaf length-width ratio phenotype diagram; Figure 5 C in Figure 2 is the fifth unfolded leaf length-width ratio; Figure 5

[0031] Figure 6 Figure 3 is a comparison of the leaf angle of the overexpression transgenic lines and WT; PagSCL28a

[0032] Figure 7 Figure 4 is a scanning electron microscope diagram of the leaf back epidermis hair of the overexpression transgenic lines and WT; PagSCL28a

[0033] Figure 8 Figure 5 is the stem tissue section analysis result of the overexpression lines and wild type, wherein, PagSCL28a A in Figure 5 is the fifth inter-node toluidine blue staining result, Figure 8 B in Figure 5 is the ninth, thirteenth inter-node toluidine blue and phloroglucinol-hydrochloric acid staining result, Pf, ca and xy are phloem fiber, cambium and xylem respectively, Figure 8 C in Figure 5 is the vessel density analysis result, Figure 8 D in Figure 5 is the radius analysis result, Figure 8 E in Figure 5 is the xylem width analysis result. Figure 8 DETAILED DESCRIPTION The technical solutions of the present application are further described below by means of the accompanying drawings and examples.

[0034] Unless otherwise defined, the technical terms or scientific terms used in the present application shall be understood as the usual meanings understood by those skilled in the art to which the present application belongs.

[0035] Test material source:

[0036]

[0037] ​​​​​Agrobacterium resuspension solution (1000 mL): 4.43 g MS powder, 30 g sucrose, pH = 5.6;

[0038] Co-culture (1000 mL): L449 2.4 g + MES 0.5 g + sucrose 20 g + plant gel 3.2 g, pH = 5.9;

[0039] Differentiation medium (1000 mL): L449 2.4 g + MES 0.5 g + NAA 0.1 mg + 6-BA 0.5 mg + sucrose 20 g + plant gel 3.2 g, pH = 5.9;

[0040] Rooting medium (1000 mL): MS 519 2.2 g + NAA 0.05 mg + IBA 0.02 mg + sucrose 20 g + agar powder 7.8 g, pH = 5.9.

[0041] In the present application, unless otherwise specified, the materials, reagents, enzymes, competent cells, plasmids, etc. and instruments used are conventional test materials in the art, which can be purchased through commercial channels.

[0042] Example 1

[0043] Primer sequence synthesis and sequencing

[0044] According to PagSCL28a Specific primers were designed for gene cloning, expression analysis and vector construction. All primer synthesis and plasmid sequencing tasks were entrusted to a biological company, and the accuracy was verified by sequencing.

[0045] PagSCL28a The gene is the nucleotide sequence shown in SEQ ID NO: 1.

[0046] SEQ ID NO: 1:

[0047] ATGCCAAGGCACAGAAGCCGGAGCAGAAGCTACAGTCCTGGTCGCCGTAGCCGAACCCCTCCTCGGGG CCGTAAGCGATACGATGACGAAGATCTCCACCGTGACACCCGTTCTTACCGTGACCGTCGCTCTCCTGCTCCATCT GGCTTACTCATTCGCAATCTCCCTCTCGATGCCAGGCCTGAAGATCTTAGGGGGCCATTTGAGAAATTTGGTCCTT TGAAAGATATTTATCTGCCCAAGAATTACTACACTGGGGAACCACGAGGGTTTGGATTTGTGAAGTATCGTTACGG TGAAGATGCAGCTGAAGCAAAAAAACGTATGGACCATAAAATCATTGGTGGACGTGAGATAAGAATTGTCTTTGCC GAGGAGAACAGAAAAACACCTCAAGAAATGCGCAGAACTCCTCGTACAAGTGACCGACATGGAGGCAGCCATGGAG GGAGAACACCACCAAGGTCCCCAAGACATCGATATCGTTCCTACTCACGCTCACCTTCACCTGCCAGGCATGATTC GAGGGATCGCGGTGTGAAGGAGGATTATTGCTCTCCACGGAGATCAAGATCCATTTCACGCTCTCGTTCTCCACGA GATGAGAGGGACTTCCAGGTAGACCAGCGGTCGCTAAGTCCATCGGAGAATGGCCGAAACCCCAAGGAAAGGAACC ATGCATCTCGTGGGTCAAGGACTCCGAGGGCCAATAGCCGTTGTCCATCAAGGTCGCATTCACAATCCCATGGTTC TCGCTAA.

[0048] PagSCL28a Gene cloning

[0049] Total RNA was extracted from 84K poplar, and cDNA was obtained using a reverse transcription kit; the designed specific primers were used to amplify PagSCL28aGene full-length sequence. The PCR product was cloned into the pMDC32 vector to construct the overexpression vector. The correctness of the vector was verified by enzyme digestion and sequencing, and the cloning primer was PagSCL28a -F and PagSCL28a -R.

[0050] The nucleotide sequence of primer PagSCL28a -F is shown in SEQ ID NO: 2, and the nucleotide sequence of primer PagSCL28a -R is shown in SEQ ID NO: 3.

[0051] SEQ ID NO: 2: ATGCCAAGGCACAGAAGCC.

[0052] SEQ ID NO: 3: TTAGCGAGAACCATGGGATTGTG.

[0053] The amplification system is shown in Table 1 below.

[0054] Table 1 PCR amplification system

[0055] ;

[0056] PCR amplification procedure: 95°C, 3 min, 1 cycle; 95°C, 15 s, 35 cycles; 55°C, 15 s, 35 cycles, 72°C extension for 1 min, 35 cycles, 72°C extension for 5 min, 1 cycle.

[0057] After PCR product amplification, it needs to be separated by agarose gel electrophoresis and gel recovery. Agarose gel electrophoresis separation: first, weigh 1% agarose and add TAE buffer, heat and dissolve, then cool, add nucleic acid dye (GelRed), pour into the mold and solidify. Then, mix the PCR product with the loading buffer and add it to the gel well, and load 5 μL DNA 2000 bp marker. After electrophoresis, place the gel under a UV transilluminator and observe and record the position and size of the DNA band. Cut the 759 bp cDNA fragment and store it at -20°C for later use.

[0058] Overexpression vector construction: the overexpression vector construction method adopts the Gateway method. This method uses specific recombination sequences (attB, attP, attL and attR) and a recombinase system to realize efficient transfer of target genes from entry vectors to expression vectors. The specific steps are as follows:

[0059] The Gateway adapter sequence includes forward and reverse adapters. The nucleotide sequence of the forward adapter is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse adapter is shown in SEQ ID NO: 5.

[0060] SEQ ID NO: 4: GGGGACAAGTTTGTACAAAAAAGCAGGCTCG.

[0061] SEQ ID NO: 5: GGGGACCACTTTGTACAAGAAAGCTGGGTC.

[0062] The BP reaction system is shown in Table 2 below.

[0063] Table 2 BP reaction system

[0064] ;

[0065] The BP reaction procedure is as follows: the PCR product is inserted into the pDONR207 entry vector by BP (Bacterial Proliferation) reaction to form an entry clone. After incubation at 25°C for 1 hour, the product is transformed into E. coli DH5a competent cells, and the correct entry clone plasmid (pDONR207- is obtained by antibiotic screening and sequencing verification. PagSCL28a ).

[0066] The LR reaction system is as follows Table 3.

[0067] Table 3 LR reaction system

[0068] ;

[0069] The LR reaction procedure is as follows: the verified entry clone is recombined with the pMDC32 expression vector by LR (Ligation Reaction) reaction. The LR reaction uses the LR Clonase II enzyme mixture, and after incubation at 25°C for 1 hour, the product is transformed into E. coli DH5a competent cells, and the correct pMDC32- overexpression vector is obtained by antibiotic screening and sequencing verification. PagSCL28a for subsequent Agrobacterium transformation and plant genetic transformation experiments.

[0070] Plasmid extraction and sequencing:

[0071] Positive monoclonal colonies are picked and inoculated in LB liquid medium containing the corresponding antibiotic and incubated at 37°C overnight. The plasmid is extracted using a plasmid extraction kit (purchased from Tiangen) according to the instructions.

[0072] Agrobacterium transformation

[0073] Agrobacterium transformation: the extracted correct plasmid is added to Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biological Company, and the specific operation is referred to the instructions).

[0074] Agrobacterium-mediated transformation of Populus alba× P. tremula 84K

[0075] (1) Preparation of Agrobacterium infection solution: Agrobacterium single colony was inoculated into LB liquid medium containing corresponding antibiotics, and cultured at 28°C for overnight. The culture was centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. The bacterial pellet was resuspended in MS liquid medium containing 30 μmol / L acetosyringone. 600

[0076] (2) Leaf pre-culture: The 4-week-old Populus alba× P. tremula 84K sterile seedling leaves were cut into small pieces of 0.5 cm×0.5 cm, and inoculated on co-culture medium, and cultured at 25°C in the dark for 2 days.

[0077] (3) Infection and co-culture: The pre-cultured leaf pieces were placed in the Agrobacterium suspension, and infected for 10-15 min with gentle shaking. After infection, the leaves were removed, the excess bacterial solution was absorbed with sterile filter paper, and transferred to the co-culture medium, and cultured at 25°C in the dark for 2 days.

[0078] (4) Selection culture: The co-cultured leaves were transferred to the differentiation medium containing kanamycin (50 mg / L) and timentin (200 mg / mL), and the medium was replaced every 2 weeks to select resistant shoots.

[0079] (5) Rooting culture: When the resistant shoots grew to 3-5 cm, they were cut off and inoculated on the rooting medium containing timentin (200 mg / mL).

[0080] PagSCL28a Gene tissue expression pattern analysis: For 84K plants, 45 cm high soil-grown seedlings were selected as materials. Healthy soil-grown seedlings were selected as experimental materials, and representative tissues such as apical buds, young leaves, old leaves, roots, the first internode (young stem segment), the 3rd, 5th, 7th internodes (upper stem segments), the 9th, 11th, 13th, 15th internodes (mature stem segments) were systematically collected. Total RNA was extracted, and then transferred to a -80°C freezer for long-term storage until subsequent experiments.

[0081] DNA extraction and detection: DNA was extracted according to the CTAB method; RNA was extracted according to the Biotophet RNA extraction kit.

[0082] RNA reverse transcription: The protocol of Evo M-MLV reverse transcription premix kit of Aikuer was followed to ensure the quality and integrity of cDNA. The genomic DNA removal reaction system is shown in Table 4.

[0083] Table 4 Genomic DNA removal reaction system

[0084] ​ ;

[0085] After mixing, the mixture was incubated at 42°C for 3 minutes and then placed on ice. Reverse transcription was then performed, and the reverse transcription system is shown in Table 5.

[0086] Table 5 Reverse Transcription System

[0087] ;

[0088] The cells were placed in a PCR instrument for temperature-controlled reaction. The program was set as follows: 37℃ for 15 min, 85℃ for 5 seconds, and cooled to 4℃. The reverse-transcribed cDNA was promptly stored at -20℃.

[0089] Real-time quantitative PCR: Primer design was aided by an online website (https: / / www.primer3plus.com / ), and specificity was verified (BLAST alignment).

[0090] Target gene ( PagSCL28a ) and internal reference gene ( PagUBQ Primer design, nucleotide sequences as shown in SEQ ID NO:6-SEQ ID NO:9.

[0091] PagSCL28a -qPCR-F:

[0092] SEQ ID NO: 6: 5'-TGACACCCGTTCTTACCGTG-3'.

[0093] PagSCL28a -qPCR-R:

[0094] SEQ ID NO:7: 5'-TTCAGCTGCATCTTCACCGTA-3'.

[0095] PagUBQ -qPCR-F:

[0096] SEQ ID NO:8: 5'-GACTTTGACCGGAAAGACCA-3'.

[0097] PagUBQ -qPCR-R:

[0098] SEQ ID NO:9: 5'-GGAGACGAAGGACAAGGTGA-3'.

[0099] Prepare the PCR reaction mixture: The usual qPCR reaction system is 20 μL, and the specific composition is shown in Table 6 below.

[0100] Table 6 RT-qPCR reaction system

[0101] ;

[0102] RT-qPCR amplification procedure: 95℃, 30s, cycle 1 time; 95℃, 10s, 1 cycle; 60℃, 30s, 40 cycles, 95℃ extension 15s, 40 cycles, melting curve: 60℃, 60s, cycle 1 time; 95℃, 60s, cycle 1 time.

[0103] Data collection and analysis: three biological replicates and four technical replicates were set up for each sample, and 2 -ΔΔCt method was used for relative quantitative analysis.

[0104] Poplar stem tissue section, test scheme as follows:

[0105] Section and collection: the section thickness of the section machine was set to 50μm, and the cut section was carefully collected into a centrifuge tube containing 75% ethanol for subsequent staining and observation.

[0106] Staining and observation: staining solution: 0.1% toluidine blue staining solution (TBO), 1% phloroglucinol staining solution, 0.1% carmine staining solution.

[0107] Microscopic observation of fiber length was carried out by fiber isolation method, and ImageJ software was used to process the fiber cell microscopic image and measure the fiber length.

[0108] The test results are as follows:

[0109] PagSCL28a Tissue-specific expression pattern analysis, results as Figure 1 shown.

[0110] As Figure 1 can be seen, PagSCL28a the expression amount was the highest in the 5th and 9th internodes of silver gland poplar 84K, and the expression amount in the root and the first internode was relatively low.

[0111] PagSCL28a Overexpression plant screening and expression analysis, 84K poplar genetic transformation process as Figure 2 shown.

[0112] As Figure 2 can be seen, PagSCL28a after successfully constructing the overexpression vector 35S: PagSCL28a of the gene, transgenic plants were obtained by Agrobacterium-mediated genetic transformation method, and positive PagSCL28a overexpression transgenic lines were identified by PCR.

[0113] PCR identification of the DNA level of the transgenic lines was performed, and the results are as follows: Figure 3 A in the text. Further analysis of these 10 overexpressing Pag... PagSCL28a Transcriptional analysis of positive transgenic plants was performed based on these quantitative results, as follows: Figure 3 In the B group, the two strains with the highest expression levels were selected. PagSCL28a -OE#18 and PagSCL28a -OE#24 was used as the subject of subsequent experiments.

[0114] Analysis results of overexpression transgenic plants are as follows Figures 4-7 .

[0115] Depend on Figure 4 It can be seen that the two PagSCL28a Phenotypic differences between overexpression lines and wild-type. Overexpression lines PagSCL28a -OE#18 plants were shorter than wild-type plants. Furthermore, the leaves of overexpressing plants were smaller, with a significant reduction in leaf area starting from the fifth unfolded leaf.

[0116] Depend on Figures 5-6 It can be seen that overexpression PagSCL28a The phenotype of more flat leaves and more perpendicular to the stem can be observed in both top and side views of the plant.

[0117] The third mature leaf was selected, and high-resolution imaging of the epidermal structure on the abaxial surface was performed using scanning electron microscopy (SEM, 15 kV). The results are as follows: Figure 7 Overexpression was found PagSCL28a The epidermal hairs on the terminal leaves of both strains were reduced.

[0118] PagSCL28a -OE transgenic plant section analysis, results as follows Figure 8 .

[0119] Depend on Figure 8 As shown in A, TBO staining indicates that the xylem cell walls of the overexpressing lines are more deeply stained, and the lignin content of the secondary cell walls is relatively increased; phloroglucinol-hydrochloric acid staining shows that the cell walls of wild-type xylem vessel fibroblasts are light red, while the stained areas of the overexpressing lines are more deeply red, and the lignin content of the secondary cell walls is relatively increased. Figure 8 (B in the text); Although xylem cell wall staining changed, the number of vessel molecules (per mm² cross-sectional area) did not differ significantly between OE lines and wild types. Figure 8 (C in the text). The stem cross-sectional radius of the overexpressing lines was significantly smaller than that of the wild type (C in the text). Figure 8 (D in the original text). Further statistical analysis revealed that the xylem width of the overexpressing lines was also reduced compared to the wild type; the xylem width of OE#18 and OE#24 decreased by 11% and 7.3% respectively compared to the wild type. Figure 8E) in the presence of E). It is shown PagSCL28a Overexpression can limit the secondary growth process by inhibiting xylem cell expansion.

[0120] Finally, it should be noted that the above examples are intended to illustrate the technical solutions of the present application but not to limit the same, and although the present application has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present application can still be modified or equivalently replaced, and these modifications or equivalent replacements should not make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. PagSCL28a The application of genes in regulating the growth and development of poplar, characterized in that, The PagSCL28a The nucleotide sequence of the gene is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, By overexpressing the PagSCL28a gene, the height, stem diameter and leaf area of poplar were reduced, and xylem lignin deposition was increased.

3. A method of breeding a transgenic poplar tree, characterized by, The use according to claim 1 PagSCL28a gene, the method comprising the steps of: S1, Cloning of Poplar PagSCL28a Genes; S2, to PagSCL28a constructing the gene into a plant expression vector to obtain a recombinant vector; S3. The recombinant vector obtained in S2 was transformed into poplar tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic plants were obtained by screening.

4. The method of claim 3, wherein, The S1 of the cloned poplar PagSCL28a The genetic manipulation is specifically The total RNA of poplar was extracted, and reverse transcribed into cDNA as a template, and PCR amplification was carried out by using primers PagSCL28a F and PagSCL28a R to obtain PagSCL28a genes. The primers PagSCL28a The nucleotide sequence of -F is shown in SEQ ID NO:2, and the primer... PagSCL28a The nucleotide sequence of -R is shown in SEQ ID NO:3.