Multiple miRNA one-pot detection method

Abstract

The invention belongs to the technical field of analysis and detection, particularly relates to a multiple miRNA one-pot method detection method, and provides a novel one-pot method and one-step multiple RT-qPCR method to avoid sample loss and cross contamination caused by step-by-step operation. And meanwhile, the kit is compatible with high-fidelity DNA polymerase (HOM-qPCR) and Taq DNA polymerase (TOM-qPCR), so that a dual technical path is realized. The detection sensitivity and specificity are improved, the linear dynamic range is expanded to 7.5 * 10 < 1 >-10 < 8 > copies / reaction, and miRNA with homology higher than 99.99% can be distinguished. The total detection time is shortened to about 90 minutes, which is obviously better than that of the traditional method (more than or equal to 120 minutes).

Description

Technical Field

[0001] This invention belongs to the field of analytical detection technology, specifically relating to a novel one-pot RT-qPCR detection method for multiplex miRNAs that can be driven by both high-fidelity DNA polymerase and Taq DNA polymerase. Background Technology

[0002] MicroRNAs (miRNAs) are a class of non-coding RNA molecules approximately 22 nucleotides in length. They regulate gene expression by targeting and binding to the 3' untranslated region (UTR) of mRNA, participating in key biological processes such as cell proliferation, differentiation, and apoptosis. Abnormal miRNA expression is closely related to various diseases, including cancer, cardiovascular disease, and neurodegenerative diseases. For example, in gastrointestinal cancers, miR-21 and miR-16 have been proven to serve as diagnostic biomarkers, and their serum levels are significantly correlated with tumor stage and prognosis. Due to their tissue-specific expression, high stability, and ease of acquisition from body fluids (such as serum and saliva), miRNAs have broad application prospects in liquid biopsy and are considered core targets for next-generation non-invasive diagnostic tools.

[0003] However, miRNA detection faces multiple technical challenges: (1) Short fragments: miRNAs are only about 22 nt in length, similar to the length of conventional PCR primers, making it difficult to design primers directly and susceptible to interference from secondary structures. (2) Extremely low abundance: miRNA concentrations in body fluids can be as low as femtomolar levels, requiring extremely high detection sensitivity. (3) High sequence homology: miRNAs of the same family (such as miR-17 / 20b / 93) often differ by only 1-2 nucleotides, requiring high specificity for differentiation.

[0004] The current mainstream detection methods and their limitations are as follows:

[0005] (1) Stem-loop RT-qPCR: cDNA is generated by reverse transcription of miRNA using stem-loop primers, and then amplified by qPCR. This method has high specificity, but requires step-by-step operation (reverse transcription and qPCR are separated), takes about 150 minutes in total, and is prone to sample loss and cross-contamination due to multiple operation steps.

[0006] (2) Poly(A) tail RT-qPCR: Poly(A) tails are added to miRNAs using Poly(A) polymerase, followed by reverse transcription using universal primers. This method is low-cost, but has a narrow linear range (approximately 5 orders of magnitude), and the tailing efficiency is affected by the miRNA sequence, which can easily introduce quantitative bias.

[0007] (3) SYBR Green one-step RT-qPCR: Reverse transcription and qPCR are integrated into a single tube, reducing the time to 120 minutes. However, it relies on dye detection, has a high non-specific amplification rate (about 29%), a narrow linear range, and cannot achieve multiplex detection.

[0008] (4) CRISPR / Cas12a binding rolling circle amplification: The CRISPR system improves specificity, but the limit of detection (LOD) is significantly higher than that of RT-qPCR (pimolar level), and it depends on complex enzyme cascade reactions, which is costly.

[0009] (5) Electrochemical sensors made of nanomaterials: These sensors utilize nanomaterials (such as gold nanoparticles) to enhance signals and achieve sensitivity at the femtomolar level. However, they require complex probe modification, are difficult to standardize, and have poor compatibility with multiple detection methods.

[0010] Furthermore, existing technologies generally suffer from the following common problems: they cannot simultaneously support multiple high-fidelity DNA polymerases and Taq DNA polymerases; high-fidelity DNA polymerases lack 5'→3' exonuclease activity, making them unsuitable for multiplex detection based on TaqMan probes. Multiplex detection capabilities are limited: most methods only support single-target detection, failing to meet the clinical need for simultaneous analysis of multiple miRNAs.

[0011] In summary, there is an urgent need to develop a miRNA quantification method that combines high sensitivity, wide dynamic range, and excellent specificity, and enables one-pot, one-step multiplex detection, in order to meet the urgent need for efficient miRNA diagnostic technology. Summary of the Invention

[0012] To address the aforementioned technical problems, this invention provides a novel one-pot, one-step multiplex RT-qPCR method, avoiding sample loss and cross-contamination caused by step-by-step operations. It is simultaneously compatible with both high-fidelity DNA polymerase (HOM-qPCR) and Taq DNA polymerase (TOM-qPCR), achieving a dual technical pathway. This improves detection sensitivity and specificity, extending the linear dynamic range to 7.5 × 10⁻⁶. 1 ~10 8 It can detect copies / reaction and distinguish miRNAs with homology higher than 99.99%. The total detection time is shortened to about 90 minutes, which is significantly better than traditional methods (≥120 minutes).

[0013] The technical solution provided by this invention is as follows:

[0014] This invention provides a one-pot method for detecting multiplex miRNAs, the method comprising the following components: a reverse transcription hairpin blocking system, forward primers, reverse transcriptase, reaction buffer, high-fidelity DNA polymerase, and Taq DNA polymerase.

[0015] Furthermore, the reverse transcription hairpin blocking system includes a hairpin quenching primer and a fluorescent reverse transcription primer. The hairpin quenching primer is 30-45 nt in length and includes a 4-8 bp hairpin structure. The quenching group is labeled at the 3' end of the hairpin quenching primer. The fluorescent reverse transcription primer is 25-35 nt in length and is labeled with a fluorescent group at the 5' end. The hairpin quenching primer and the fluorescent reverse transcription primer form a stable hybrid through complementary sequences, and the fluorescent group is adjacent to the quenching group.

[0016] Furthermore, the complementary sequence is formed by hybridization of the 5' end of the hairpin structure quenching primer and the 5' end of the fluorescent reverse transcription primer, and the complementary sequence length is 18-25 bp.

[0017] Furthermore, the middle region of the complementary sequence includes 1-2 base mismatches.

[0018] Furthermore, the 9-12 bases at the 3' end of the fluorescent reverse transcription primer form a complementary pair with the 3' end of the miRNA for reverse transcription of the miRNA.

[0019] Furthermore, the reaction buffer contains a buffer suitable for reverse transcriptase combined with high-fidelity DNA polymerase and reverse transcriptase combined with Taq DNA polymerase.

[0020] Furthermore, the forward primer is 18-25 nt in length and includes a random sequence and a sequence complementary to the 3' end region of the miRNA cDNA template generated by the reverse transcription hairpin blocking system; the random sequence is 9-13 nt in length, and the sequence complementary to the 3' end region of the miRNA cDNA template generated by the reverse transcription hairpin blocking system is 9-12 nt in length.

[0021] Furthermore, the fluorescent group of the reverse transcription hairpin blocking system is selected from one of FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 or JOE, and the quenching group is selected from one of MGB, BHQ1 or BHQ2.

[0022] Furthermore, multiplex miRNAs were simultaneously reverse transcribed and amplified by qPCR in a single tube using a combination of reverse transcriptase, high-fidelity DNA polymerase, and Taq DNA polymerase. The reaction conditions using high-fidelity DNA polymerase included: reverse transcription at 50°C for 15-30 minutes, incubation at 20-37°C for 0-5 minutes, pre-denaturation at 98°C for 1 minute, followed by 40 cycles, each cycle consisting of 98°C for 10 seconds, 56-60°C for 30 seconds, 72°C for 10 seconds, and an annealing temperature of 57-59°C. The reaction conditions using Taq DNA polymerase included: reverse transcription at 50°C for 15-30 minutes, pre-denaturation at 95°C for 10 minutes, followed by 40 cycles, each cycle consisting of 95°C for 10 seconds, 54-56°C for 30 seconds, 70°C for 10 seconds, and an annealing temperature of 54-56°C.

[0023] Furthermore, the sequences of the forward primers are shown in SEQ ID NO. 19-21, the sequences of the fluorescent reverse transcription primers are shown in SEQ ID NO. 22-23, and the sequences of the hairpin structure quenching primers are shown in SEQ ID NO. 24.

[0024] Beneficial effects

[0025] The reverse transcription hairpin blocking system (RT-HOS) of this invention tightly binds the hairpin-structure quenching primer and the fluorescent reverse transcription primer together through complementary pairing hybridization. Because the complementary sequence is relatively long, it maintains a stable structure during annealing and extension stages, preventing the release of fluorescent signals. Simultaneously, RT-HOS can also be used as a reverse transcription primer, achieving the dual function of a fluorescent probe and a reverse transcription primer. In the presence of both high-fidelity DNA polymerase and reverse transcriptase, the first step involves reverse transcriptase driving RT-HOS at 50°C to complete reverse transcription and generate cDNA. Then, in the second step, high-fidelity DNA polymerase drives the forward primer to bind to and extend the cDNA. Upon extension to the end, strand substitution occurs with the hairpin-structure quenching primer, causing the quenching group to move away from the fluorescent group and release a fluorescent signal. When both Taq DNA polymerase and reverse transcriptase are present, the first step involves reverse transcriptase driving RT-HOS at 50°C to complete reverse transcription and generate cDNA. Then, in the second step, Taq DNA polymerase drives the forward primer to bind to and extend cDNA. When it reaches the end, the hairpin structure quenching primer is cleaved by the 5'-3' exonucleation activity. After the quenching group is removed, a fluorescent signal is released.

[0026] The method described in this invention avoids sample loss and cross-contamination caused by step-by-step operations, while being compatible with both high-fidelity DNA polymerase (HOM-qPCR) and Taq DNA polymerase (TOM-qPCR), achieving a dual technical pathway. It improves detection sensitivity and specificity, extending the linear dynamic range to 7.5 × 10⁻⁶. 1 ~108 It can detect copies / reaction and distinguish miRNAs with homology higher than 99.99%. The total detection time is shortened to about 90 minutes, which is significantly better than traditional methods (≥120 minutes). Attached Figure Description

[0027] Figure 1 This is a schematic diagram of the novel one-pot, one-step miRNA multiplex RT-qPCR method of the present invention. (a) Principle of one-pot multiplex miRNA detection driven by high-fidelity DNA polymerase, TOM-qPCR; (b) Principle of one-pot multiplex miRNA detection driven by Taq DNA polymerase. Reverse transcription hairpin quenching system (RT-HOS), hairpin quencher primer, and fluorescent reverse transcription primer.

[0028] Figure 2 The effect of different hybrid lengths in the reverse transcription hairpin-closed system (RT-HOS) on the detection results is shown. (a) Schematic diagram of hybridization stability simulation of RT-HOS of different lengths. Raw curves (b) and amplification curves (c) of miR-16 detection by RT-HOS of different lengths in HOM-qPCR. Raw curves (d) and amplification curves (e) of miR-16 detection by RT-HOS of different lengths in TOM-qPCR.

[0029] Figure 3 This study illustrates the effect of hairpin structure length in the hairpin quencher and different annealing temperatures on the detection results. Amplification curves (a) and corresponding Ct values ​​(b) of miR-16 detected in HOM-qPCR with different hairpin structure lengths. Amplification curves (c) and corresponding Ct values ​​(d) of miR-16 detected in TOM-qPCR with different hairpin structure lengths. Amplification curves (e) and corresponding Ct values ​​(f) of miR-16 detected in HOM-qPCR at different annealing temperatures. Amplification curves (g) and corresponding Ct values ​​(h) of miR-16 detected in TOM-qPCR at different annealing temperatures.

[0030] Figure 4 The effect of different reaction procedures on HOM-qPCR.

[0031] Figure 5 This is the original amplification curve of TOM-qPCR under annealing conditions at 58℃.

[0032] Figure 6 For single-tube multiplex simultaneous detection of HOM-qPCR (a, c, e) and TOM-qPCR (b, d, f), 7.5 × 10⁻⁶ samples were used.1 ~10 8 Amplification curves corresponding to miR-16, miR-21, and cel-miR-39 in copies / reaction.

[0033] Figure 7 For HOM-qPCR (a, c) and TOM-qPCR (b, d) single-tube multiplex simultaneous detection, 7.5 × 10⁻⁶ cells / mL. 1 ~10 8 Ct values ​​and standard curves for miR-16, miR-21, and cel-miR-39 in copies / reaction.

[0034] Figure 8 The effectiveness of HOM-qPCR and TOM-qPCR in differentiating homologous miRNAs was demonstrated. (a) miR-93-specific HOM-qPCR detected miR-93, miR-17, and miR-20b, respectively. (b) miR-93-specific TOM-qPCR detected miR-93, miR-17, and miR-20b, respectively. (c) miR-17-specific HOM-qPCR detected miR-93, miR-17, and miR-20b, respectively. (d) miR-17-specific TOM-qPCR detected miR-93, miR-17, and miR-20b, respectively. (e) miR-20b-specific HOM-qPCR detected miR-93, miR-17, and miR-20b, respectively. (f) miR-20b-specific TOM-qPCR detected miR-93, miR-17, and miR-20b, respectively. (g) The Ct values ​​and detection rates of miR-93, miR-17 and miR-20b were detected by different HOM-qPCR and TOM-qPCR methods. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.

[0036] Example 1

[0037] Using miR-16 as the detection target, two sets of RT-HOS with complementary sequence lengths of 11bp and 21bp were constructed, respectively, and then used as follows: Figure 1 The HOM-qPCR and TOM-qPCR assays shown below were performed, and the nucleic acid sequences used were as follows:

[0038] SEQ ID NO. 1: Short fluorescent reverse transcription primer FAM-CCTACAGACTACGCCAATAT;

[0039] SEQ ID NO. 2: Short hairpin structure quenching primer TAGTCTGTAGGGTTCGCAAGAAC-BHQ1;

[0040] SEQ ID NO. 3: Long fluorescent reverse transcription primer FAM-CAAGCAATCACCTACAGACTACGCCAATAT;

[0041] SEQ ID NO. 4: Long hairpin structure quenching primer TAGTCTGTAGGTGATTGCTTGGTTCGCAAGAAC-BHQ1;

[0042] SEQ ID NO. 5: Forward primer TACTAGAGCCAATAGCAGCACGTA;

[0043] HOM-qPCR detection system: 7.5 μL 2×Phusion Hotstart II high-fidelity PCR premix, 1 μL 10×miRNA first-strand cDNA synthesis kit reverse transcription buffer (stem-loop structure), 1.5 μL NuHi® eRT reverse transcriptase, 0.3 μM fluorescent reverse transcription primers, 0.3 μM hairpin quenching primers, and 0.2 μM forward primers. Using 5 μL of synthesized miR-16 as a template, DEPC water was added to a final volume of 20 μL. The HOM-qPCR reaction program was as follows: Stage 1: Reverse transcription at 50℃ for 15 min, followed by incubation at 20℃ for 5 min; Stage 2: Pre-denaturation at 98℃ for 1 min; Stage 3: 40 cycles, each cycle consisting of 98℃ for 10 seconds, 60℃ for 30 seconds, and 72℃ for 10 seconds; Stage 4: 10℃ for 1 min.

[0044] TOM-qPCR detection system: 1.8 μL 10× AceTaq buffer (Mg) 2+ Plus), 0.4 μL AceTaq DNA polymerase, 1 μL 10× miRNA first-strand cDNA synthesis kit reverse transcription buffer (stem-loop structure), 1.5 μL NuHi® eRT reverse transcriptase, 0.2 μL dNTPs mixture (25 mM), 0.2 μM fluorescent reverse transcription primer, 0.3 μM hairpin quenching primer, and 0.2 μM forward primer. Using 5 μL of miR-16 as a template, add DEPC water to a final volume of 20 μL. TOM-qPCR reaction program: Stage 1: Reverse transcription at 50℃ for 15 min; Stage 2: Pre-denaturation at 95℃ for 10 min; Stage 3: 40 cycles, each cycle consisting of 95℃ for 10 seconds, 56℃ for 30 seconds, and 70℃ for 10 seconds; Stage 4: 10℃ for 1 min.

[0045] Test results as follows Figure 2 As shown, RT-HOS with a complementary sequence length of 11 bp has a smaller hybridization energy (a), so it is not stable during the annealing and extension stages. Therefore, it cannot form an effective amplification curve and signal in either HOM-qPCR or TOM-qPCR. On the other hand, RT-HOS with a length of 22 bp has a stronger hybridization energy (a), so it has a stable amplification curve signal in both HOM-qPCR and TOM-qPCR.

[0046] Example 2

[0047] Using miR-16 as the detection target, we designed quenching primers with hairpin structures of different lengths and compared their detection effects.

[0048] SEQ ID NO. 5: Forward primer TACTAGAGCCAATAGCAGCACGTA;

[0049] SEQ ID NO. 6: Fluorescent reverse transcription primer FAM-ACGACAATCACCTACAGACTACGCCAATAT;

[0050] SEQ ID NO. 7: 2bp hairpin structure quenching primer TAGTCTGTAGGTGATTGTCGTGTGCAAAC-BHQ1;

[0051] SEQ ID NO. 8: 4bp hairpin structure quenching primer TAGTCTGTAGGTGATTGTCGTGTTCGCAAGAAC-BHQ1;

[0052] SEQ ID NO. 9: 6bp hairpin structure quenching primer TAGTCTGTAGGTGATTGTCGTGTTCAGGCAACTGAAC-BHQ1;

[0053] SEQ ID NO. 10: 8bp hairpin structure quenching primer TAGTCTGTAGGTGATTGTCGTGTTCAGTAGCAATACTGAAC-BHQ1;

[0054] The HOM-qPCR and TOM-qPCR reaction systems are the same as those in Example 1.

[0055] Test results as follows Figure 3 As shown in (ad), hairpin structures of different lengths can effectively amplify signals, but the 4bp hairpin structure quenching primer in HOM-qPCR has the best quenching effect, while the 6bp hairpin structure quenching primer in TOM-qPCR has the best quenching effect.

[0056] Example 3

[0057] Using miR-16 as the detection target, the efficacy of HOM-qPCR and TOM-qPCR was tested at different annealing temperatures.

[0058] SEQ ID NO. 5: Forward primer TACTAGAGCCAATAGCAGCACGTA;

[0059] SEQ ID NO. 11: Fluorescent reverse transcription primer FAM-CAGGAAACAGCTATGACCGACAATGTCGCCAATAT;

[0060] SEQ ID NO. 12: Hairpin structure quenching primer ACATTGTCGGgCATAGCTGgTTCCTG-GTTCGCAAGAAC-BHQ1 (lowercase letters indicate complementary sequence mismatch positions);

[0061] HOM-qPCR detection system: 7.5 μL 2×Phusion Hotstart II high-fidelity PCR premix, 1 μL 10×miRNA first-strand cDNA synthesis kit reverse transcription buffer (stem-loop structure), 1.5 μL NuHi® eRT reverse transcriptase, 0.3 μM fluorescent reverse transcription primers, 0.3 μM hairpin quenching primers, and 0.2 μM forward primers. Using 5 μL of synthesized miR-16 as a template, DEPC water was added to a final volume of 20 μL. The HOM-qPCR reaction program was as follows: Stage 1: Reverse transcription at 50℃ for 15 min, then at 20℃ for 5 min; Stage 2: 98℃ for 1 min; Stage 3: 40 cycles, each cycle consisting of 98℃ for 10 seconds, 56 / 58 / 60℃ for 30 seconds, and 72℃ for 10 seconds; Stage 4: 10℃ for 1 min.

[0062] TOM-qPCR detection system: 1.8 μL 10× AceTaq Buffer (Mg 2+Plus), 0.4 μL AceTaq DNA polymerase, 1 μL 10× miRNA first-strand cDNA synthesis kit reverse transcription buffer (stem-loop structure), 1.5 μL NuHi® eRT reverse transcriptase, 0.2 μL dNTPs mixture (25 mM), 0.2 μM fluorescent reverse transcription primer, 0.3 μM hairpin quenching primer, and 0.2 μM forward primer. Using 5 μL of miR-16 as a template, add DEPC water to a final volume of 20 μL. TOM-qPCR reaction program: Stage 1: Reverse transcription at 50℃ for 15 min; Stage 2: Pre-denaturation at 95℃ for 10 min; Stage 3: 40 cycles, each cycle consisting of 95℃ for 10 seconds, 54 / 55 / 56℃ for 30 seconds, and 70℃ for 10 seconds; Stage 4: 10℃ for 1 min.

[0063] Test results as follows Figure 3 As shown in the figure, HOM-qPCR showed amplification signals at annealing temperatures of 56℃, 58℃, and 60℃, with 58℃ showing the best results. TOM-qPCR showed amplification signals at annealing temperatures of 54℃, 55℃, and 56℃, with 55℃ showing the best results.

[0064] Example 4

[0065] To compare the effects of different processing steps in the reverse transcription stage on HOM-qPCR, the nucleic acid sequences used were the same as in Example 3. Specifically, after the 15-minute reverse transcription stage, the cells were incubated for 0 minutes, 5 minutes at 37°C, and 5 minutes at 20°C, respectively. The remaining procedures were the same as in Example 3. The detection results are as follows: Figure 4 As shown, the signal obtained after reverse transcription and incubation at 20°C for 5 minutes is optimal, demonstrating that this step helps stabilize the RT-HOS sequence.

[0066] Example 5

[0067] To verify the effect of annealing conditions at higher temperatures on TOM-qPCR, the nucleic acid sequences used were the same as in Example 3. The reaction conditions for TOM-qPCR were as follows: TOM-qPCR reaction program: Stage 1: Reverse transcription at 50℃ for 15 min; Stage 2: Pre-denaturation at 95℃ for 10 min; Stage 3: 40 cycles, each cycle consisting of 95℃ for 10 seconds, 58℃ for 30 seconds, and 70℃ for 10 seconds; Stage 4: 10℃ for 1 min.

[0068] The results are as follows Figure 5 As shown, miR-16 did not exhibit a significant amplification curve, compared to... Figure 3The TOM-qPCR produced good amplification curves when annealed between 54-56 ℃, but no obvious amplification curves were observed when the annealing temperature was further increased to 58 ℃, proving that the optimal annealing temperature for TOM-qPCR is 54-56 ℃.

[0069] Example 6

[0070] Using miR-16, cel-miR-39, and miR-21 as detection targets, triple HOM-qPCR and TOM-qPCR reactions were constructed, and 7.5 × 10⁻⁶ mcg / m ... 1 ~10 8 Templates for copies / reaction.

[0071] SEQ ID NO. 5: miR-16 forward primer TACTAGAGCCAATAGCAGCACGTA;

[0072] SEQ ID NO. 11: miR-16 fluorescent reverse transcription primer FAM-CAGGAAACAGCTATGACCGACAATGTCGCCAATAT;

[0073] SEQ ID NO. 12: miR-16 hairpin structure quenching primer ACATTGTCGGgCATAGCTGgTTCCTG-GTTCGCAAGAAC-BHQ1 (lowercase letters indicate complementary sequence mismatch positions);

[0074] SEQ ID NO. 13: cel-miR-39 forward primer CTTGTAATCACGTCACCGGGTGTA;

[0075] SEQ ID NO. 14: cel-miR-39 fluorescent reverse transcription primer ROX-TGTAAAACGACGGCCAGTACAAATGTCAAGCTGATT;

[0076] SEQ ID NO. 15: cel-miR-39 hairpin structure quenching primer ACATTTGTACgGGCCGTCGgTTTACA-CGATGTCTATCG-BHQ2 (lowercase letters indicate complementary sequence mismatch positions);

[0077] SEQ ID NO. 16: miR-21 forward primer GTGTCATCACCTTCTAGCTTATCAGA;

[0078] SEQ ID NO. 17: miR-21 fluorescent reverse transcription primer CY5-CAAGCTACCAAGCGATCCGTTACCTTCAACATCAGT;

[0079] SEQ ID NO. 18: miR-21 hairpin structure quenching primer GGTAACGGAgCGCTTGGgAGCTTGGACGACTTCTCGTC-BHQ2 (lowercase letters indicate complementary sequence mismatch positions);

[0080] HOM-qPCR detection system: 7.5 μL 2×Phusion Hotstart II High-Fidelity PCR Master Mix, 1 μL 10×miRNA First-Strand cDNA Synthesis Kit Reverse Transcription Buffer (Stem-Loop Structure), 1.5 μL NuHi® eRT Reverse Transcriptionase, 0.3 μM Fluorescent Reverse Transcription Primer, 0.3 μM Hairpin Structure Quenching Primer, and 0.2 μM Forward Primer. 5 μL 7.5×10 1 ~10 8 The copies / reaction method synthesized a mixture of miR-16, cel-miR-39, and miR-21 as a template, and added DEPC water to a final volume of 20 μL. The HOM-qPCR reaction program was as follows: Stage 1: Reverse transcription at 50℃ for 15 min, followed by 5 min at 20℃; Stage 2: 98℃ for 1 min; Stage 3: 40 cycles, each cycle consisting of 98℃ for 10 seconds, 58℃ for 30 seconds, and 72℃ for 10 seconds; and Stage 4: 10℃ for 1 min.

[0081] TOM-qPCR detection system: 1.8 μL 10× AceTaq Buffer (Mg2+ Plus), 0.4 μL AceTaq DNA polymerase, 1 μL 10× miRNA first-strand cDNA synthesis kit reverse transcription buffer (stem-loop structure), 1.5 μL NuHi® eRT reverse transcriptase, 0.2 μL dNTPs mixture (25 mM), 0.2 μM fluorescent reverse transcription primer, 0.3 μM hairpin structure quenching primer, and 0.2 μM forward primer. 5 μL 7.5×10 1 ~10 8 The copies / reaction method synthesized a mixture of miR-16, cel-miR-39, and miR-21 as a template, and added DEPC water to a final volume of 20 μL. The TOM-qPCR reaction program was as follows: Stage 1: Reverse transcription at 50℃ for 15 min; Stage 2: 95℃ for 10 min; Stage 3: 40 cycles, each cycle consisting of 95℃ for 10 seconds, 55℃ for 30 seconds, and 70℃ for 10 seconds; and Stage 4: 10℃ for 1 min.

[0082] Test results as follows Figure 6 and 7 As shown, the three miRNAs at 7.5 × 10 1 ~10 8 Both copy / reaction concentrations showed good amplification curves with no mutual interference, and the corresponding standard curves showed R0. 2 All values ​​exceeded 0.99, demonstrating the feasibility and stability of the one-pot, one-step detection of multiplex miRNAs using HOM-qPCR and TOM-qPCR.

[0083] Example 7

[0084] Using miR-93, miR-17, and miR-20b, which have similar sequences within the same family, as detection targets, the ability of HOM-qPCR and TOM-qPCR to distinguish similar sequences was tested.

[0085] SEQ ID NO. 19: miR-93 forward primer GATCAGTTAGGCTCAAAGTGCTGTT;

[0086] SEQ ID NO. 20: miR-17 forward primer GATCAGTTAGGCTCAAAGTGCTTAC;

[0087] SEQ ID NO. 21: miR-20b forward primer GATCAGTTAGGCTCAAAGTGCTCAT;

[0088] SEQ ID NO. 22: miR-93 fluorescent reverse transcription primer JOE-CAAGCAATCAGGCGATCCGTTATGTCTACCTGCACG;

[0089] SEQ ID NO. 23: Universal fluorescent reverse transcription primers for miR-17 and miR-20b JOE-CAAGCAATCAGGCGATCCGTTATGTCTACCTGCACT;

[0090] SEQ ID NO. 24: Universal hairpin structure quenching primers for miR-93, miR-17 and miR-20b: ACATAACGGAgCGCCTGAgTGCTTGGTTCGCAAGAAC-BHQ1 (lowercase letters indicate complementary sequence mismatch positions).

[0091] The HOM-qPCR and TOM-qPCR reaction procedures are the same as in Example 6, except that the templates are replaced with miR-93, miR-17, and miR-20b.

[0092] The results are as follows Figure 8 As shown, HOM-qPCR and TOM-qPCR, which are specific to miR-93, miR-17, and miR-20b respectively, can detect their own miRNAs, while the detection rate of similar miRNAs is less than 0.01%, which proves that HOM-qPCR and TOM-qPCR have good specificity.

Claims

1. A one-pot method for detecting multiplex miRNAs, characterized in that, The detection method uses the following components: reverse transcription hairpin blocking system, forward primer, reverse transcriptase, reaction buffer, high-fidelity DNA polymerase, and Taq DNA polymerase.

2. The one-pot detection method for multiplex miRNAs according to claim 1, characterized in that, The reverse transcription hairpin blocking system includes a hairpin quenching primer and a fluorescent reverse transcription primer. The hairpin quenching primer is 30-45 nt in length and includes a 4-8 bp hairpin structure. The quenching group is labeled at the 3' end of the hairpin quenching primer. The fluorescent reverse transcription primer is 25-35 nt in length and is labeled with a fluorescent group at the 5' end. The hairpin quenching primer and the fluorescent reverse transcription primer form a stable hybrid through complementary sequences, with the fluorescent group adjacent to the quenching group.

3. The one-pot detection method for multiplex miRNAs according to claim 2, characterized in that, The complementary sequence is formed by hybridization of the 5' end of the hairpin structure quenching primer and the 5' end of the fluorescent reverse transcription primer, and the complementary sequence length is 18-25 bp.

4. The one-pot detection method for multiplex miRNAs according to claim 2, characterized in that, The middle region of the complementary sequence includes 0-2 base mismatches.

5. The one-pot detection method for multiplex miRNAs according to claim 2, characterized in that, The 9-12 bases at the 3' end of the fluorescent reverse transcription primer form a complementary pair with the 3' end of the miRNA, which is used for reverse transcription of the miRNA.

6. The one-pot detection method for multiplex miRNAs according to claim 1, characterized in that, The reaction buffer contains buffers suitable for reverse transcriptase combined with high-fidelity DNA polymerase and reverse transcriptase combined with Taq DNA polymerase.

7. The one-pot detection method for multiplex miRNAs according to claim 1, characterized in that, The forward primer is 18-25 nt in length and includes a random sequence and a sequence complementary to the 3' end region of the miRNA cDNA template generated by the reverse transcription hairpin closure system; the random sequence is 9-13 nt in length and the sequence complementary to the 3' end region of the miRNA cDNA template generated by the reverse transcription hairpin closure system is 9-12 nt in length.

8. The one-pot detection method for multiplex miRNAs according to claim 2, characterized in that, The fluorescent group of the reverse transcription hairpin blocking system is selected from one of FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 or JOE, and the quenching group is selected from one of MGB, BHQ1 or BHQ2.

9. The one-pot detection method for multiplex miRNAs according to claim 2, characterized in that, Simultaneous reverse transcription and qPCR amplification of multiplex miRNAs were achieved in a single-tube reaction using a combination of reverse transcriptase, high-fidelity DNA polymerase, and Taq DNA polymerase. The reaction conditions using high-fidelity DNA polymerase included: reverse transcription at 50°C for 15-30 minutes, incubation at 20-37°C for 0-5 minutes, pre-denaturation at 98°C for 1 minute, followed by 40 cycles of 98°C for 10 seconds, 56-60°C for 30 seconds, 72°C for 10 seconds, and annealing at 57-59°C. The reaction conditions using Taq DNA polymerase included: reverse transcription at 50°C for 15-30 minutes, pre-denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 seconds, 54-56°C for 30 seconds, 70°C for 10 seconds, and annealing at 54-56°C.

10. The one-pot detection method for multiplex miRNAs according to claim 2, characterized in that, The sequences of the forward primers are shown in SEQ ID NO. 19-21, the sequences of the fluorescent reverse transcription primers are shown in SEQ ID NO. 22-23, and the sequences of the hairpin structure quenching primers are shown in SEQ ID NO. 24.

Images