Primer composition for detecting 17 pathogens, detection product and application

By combining multiplex PCR and mass spectrometry detection technologies, 17 primer combinations were designed to solve the problem of the difficulty in efficiently detecting multiple sexually transmitted pathogens in existing technologies. This achieved high-sensitivity and high-throughput pathogen detection, while reducing detection costs and complexity.

CN120924697AActive Publication Date: 2025-11-11NANCHANG AIDIKANG CLINICAL INSPECTION OFFICE CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511088755.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-05
Publication Date
2025-11-11
Estimated Expiration
2045-08-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid, sensitive, and high-throughput detection of various sexually transmitted pathogens, leading to diagnostic delays and inappropriate treatment, which increases the risk of infection transmission and the burden on public health.

Method used

Using multiplex PCR combined with single-base extension and mass spectrometry detection, 17 primer combinations were designed to amplify specific fragments of pathogens via multiplex PCR and determine the pathogen type by detecting characteristic patterns using mass spectrometry. The combination of amplification and extension probes was optimized to avoid interference.

Benefits of technology

It has achieved high sensitivity, specificity and high throughput detection of 17 pathogens, reduced detection costs, simplified data analysis and improved detection accuracy and speed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924697A_ABST
    Figure CN120924697A_ABST
Patent Text Reader

Abstract

The invention discloses a primer composition for detecting 17 pathogens, a detection product and application, and relates to the technical field of biology. The primer composition for detecting the 17 pathogens comprises 17 pairs of amplification primers and 17 extension probes, and the amplification primers and the extension probes are respectively as shown in SEQ ID NO: 1-51; the invention further provides a detection product comprising the primer composition and application of the detection product to simultaneous detection of 17 pathogens with the purpose of non-disease diagnosis. The kit has the beneficial effects that 17 primer groups are designed, DNA fragment products containing specific target sequences of 17 pathogens are amplified simultaneously in multiple PCR, the products are subjected to single-base extension through efficient single-base primers, the 17 pathogens can be detected and identified simultaneously through MALDI-TOF MS mass spectrometry, the detection result is accurate, and the specificity is good.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a primer composition, detection product, and application for detecting 17 pathogens. Background Technology

[0002] Sexually transmitted infections (STIs) are a significant contributor to the global public health and healthcare burden. STIs can lead to fetal / neonatal death, infertility, and genital cancers, and also significantly increase the risk of HIV infection. While many of these infections are preventable and treatable, the mortality and morbidity rates associated with STIs remain high. Many factors contribute to the persistent public health burden of STIs, the most important being delayed treatment due to undiagnosed infections.

[0003] A diverse range of microorganisms can cause sexually transmitted infections (STIs) in humans, including protozoa, viruses, and bacteria. Infections with different STIs often present with similar clinical symptoms, making it difficult to distinguish the pathogen based solely on clinical symptoms. The inability to accurately identify the pathogen causing STIs leads to reliance on experience-based clinical treatment, resulting in unsatisfactory outcomes, increased doctor-patient conflict, and hindering disease control. Traditional methods for detecting STI pathogens include isolation and culture, microscopic examination, enzyme immunoassay, and other serological tests. While these classic methods are essential for identifying emerging infectious diseases, they have limitations when screening large numbers of samples. Identifying pathogens in clinical samples through culture is time-consuming, and some pathogens are difficult to culture; classic serological tests have low sensitivity, often resulting in false negatives due to individual differences. Furthermore, these methods cannot perform multiplex detection of pathogens simultaneously. Over the past two decades, molecular detection has been widely applied to the detection of STI pathogens. Compared to traditional methods, molecular detection technology is faster, more sensitive, and more accurate. Currently, many commercially available kits and systems based on nucleic acid amplification are also available for the detection of STI pathogens. However, these platforms still have many shortcomings, such as high testing costs, low sample throughput, and a limited number of pathogens detected per reaction. Therefore, it is crucial to establish a rapid, sensitive, and high-throughput method for detecting sexually transmitted infection pathogens. At the individual patient level, accurately obtaining information about the infecting pathogen can prevent unintentional further transmission and allow for early treatment. At the clinical treatment level, appropriate antiviral drugs or antibiotics can be selected promptly based on the test results. At the public health level, rapid identification of the pathogen can limit the outbreak to a certain scale in its early stages, shortening the warning time. Summary of the Invention

[0004] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide a primer composition, detection product, and application for detecting 17 pathogens. This invention is the first to propose a method for simultaneously detecting 17 pathogens using multiplex PCR combined with clinical mass spectrometry. It integrates multiplex PCR, single-base extension, and mass spectrometry detection technologies, allowing for template amplification via PCR and detection of minute samples via mass spectrometry. This combination of advantages from both technologies is far superior to using PCR alone to detect specific fragments of pathogens, exhibiting high detection sensitivity.

[0005] This invention provides a method combining PCR, single-base extension, and mass spectrometry to detect characteristic profiles of fragments associated with pathogen typing. Seventeen primer sets are designed for seventeen pathogens. In multiplex PCR, DNA fragments containing specific target sequences from each of the seventeen pathogens are simultaneously amplified. Highly efficient single-base primers are then used to extend these products by one nucleotide at each of the seventeen specific sites, ensuring that the type of extended nucleotide corresponds to the genotype at that site. Subsequently, the extended product was purified and detected by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on the different positions of the peaks corresponding to the different masses of the four bases (A, C, G, T), the molecular weight of the extended product was determined by the mass spectrometry peaks and compared with the pre-calculated theoretical molecular weight of the extended product to determine the type of pathogen to be detected in the extended product. In this invention, the molecular weights of the four bases (A, C, G, T) are known, and the molecular weights of the 17 extended probes are also known, thus enabling the calculation of the theoretical molecular weight of the extended product.

[0006] To address the mutual interference of multiplex PCR products and eliminate unsuitable detection sites, this invention employs optimization screening to determine the optimal combination of amplification products and extension probes. During further optimization of the multiplex PCR system, to ensure that the molecular weights of the extension probes and products are distributed within the ideal mass spectrometry detection window (i.e., 4000–9000 Da), this invention introduces tag sequences into the amplification primers that do not interfere with PCR amplification. This ensures that the final 17 extension products fall within the detection window while remaining distinct, avoiding molecular weight overlap and thus improving detection accuracy and sensitivity. Therefore, the objective of this invention is to provide a primer composition for detecting 17 pathogen characteristic fragments using matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS), along with the detection products and applications. The technical solution of this invention is as follows:

[0007] The first aspect of the present invention provides a primer composition for detecting 17 pathogens, the primer composition comprising 17 pairs of amplification primers and 17 extension probes, the 17 pairs of amplification primers and 17 extension probes being as shown in SEQ ID NO:1~51, respectively, and being used to amplify: 1 ​​protozoan: Trichomonas vaginalis (TV); 2 viruses: herpes simplex virus type 1 (HSV1) and herpes simplex virus type 2 (HSV2); 3 mycoplasmas: Ureaplasma urealyticum (UU), Ureaplasma parvum (UP), and Mycoplasma genitalium (MG); 4 bacteria: Neisseria gonorrhoeae (NG), Chlamydia trachomatis (CT), Gardnerella vaginalis (GV), and Treponema pallidum (TP); and 7 fungi: Candida albicans (CA), Candida krusei (CK), Candida lucida (CL), Candida glabrata (CG), Candida parapsilosis (CP), Candida tropicalis (CT), and Candida doblinii (CD).

[0008] In a preferred embodiment of the present invention, the extended product length of Trichomonas vaginalis is 19 bp and the molecular weight is 5892.9 Da; the extended product length of Herpes simplex virus type 1 is 21 bp and the molecular weight is 6567.3 Da; the extended product length of Herpes simplex virus type 2 is 18 bp and the molecular weight is 5547.5 Da; the extended product length of Ureaplasma urealyticum is 25 bp and the molecular weight is 7661 Da; the extended product length of Ureaplasma parvum is 26 bp and the molecular weight is 8072.2 Da; the extended product length of Mycoplasma genitalium is 20 bp and the molecular weight is 6117 Da; the extended product length of Neisseria gonorrhoeae is 19 bp and the molecular weight is 5752.6 Da; the extended product length of Chlamydia trachomatis is 23 bp and the molecular weight is 7054.5 Da; and the extended product length of Gardnerella vaginalis is... The extended product of *C. syphilis* is 21 bp long with a molecular weight of 6414.1 Da; the extended product of *Treponema pallidum* is 18 bp long with a molecular weight of 5334.5 Da; the extended product of *C. albicans* is 20 bp long with a molecular weight of 5982.9 Da; the extended product of *C. krusei* is 22 bp long with a molecular weight of 6686.4 Da; the extended product of *C. lucida* is 24 bp long with a molecular weight of 7274.8 Da; the extended product of *C. glabrata* is 22 bp long with a molecular weight of 6788.3 Da; the extended product of *C. paraglabra* is 21 bp long with a molecular weight of 6521.1 Da; the extended product of *C. tropicalis* is 24 bp long with a molecular weight of 7352.9 Da; and the extended product of *C. dubrinus* is 26 bp long with a molecular weight of 7965.2 Da.

[0009] A second aspect of the invention provides the use of the primer composition in the preparation of a product for the simultaneous detection of 17 pathogens. Specifically, the product can be a detection kit.

[0010] A third aspect of the present invention is a detection product for simultaneously detecting 17 pathogens, comprising the primer composition. Specifically, the product can be a detection kit.

[0011] In a preferred embodiment of the present invention, the detection product further includes a reaction solution I for PCR amplification, wherein the reaction solution I includes an amplification primer mixture, a PCR reaction buffer, MgCl2, a dNTP / dUTP mixture, uracil-DNA glycosylase, and DNA polymerase.

[0012] In a preferred embodiment of the present invention, the detection product further includes reaction solution II for purifying PCR amplification products, wherein reaction solution II includes SAP buffer and shrimp alkaline phosphatase.

[0013] In a preferred embodiment of the present invention, the detection product further includes a reaction solution III for a single-base extension reaction, wherein the reaction solution III includes an extension probe, an iPLEX reaction buffer, an iPLEX termination mixture, and an iPLEX extension enzyme.

[0014] A fourth aspect of the invention provides the use of the primer composition in the simultaneous detection of 17 pathogens for non-disease diagnostic purposes.

[0015] The fifth aspect of the present invention provides a method for simultaneously detecting 17 pathogens in the fields of environmental hygiene, food safety testing, and import and export inspection and quarantine for non-disease diagnosis purposes, comprising the following steps:

[0016] S1. Using the 17 pairs of amplification primers in the primer composition, the target DNA regions of 17 pathogens are simultaneously amplified in a reaction system to obtain PCR amplification products containing DNA regions containing 17 specific sites.

[0017] S2. Purify the PCR amplification product obtained in step S1;

[0018] S3. Using the 17 extension probes in the primer composition, perform multiple single-base extension on the purified PCR amplification product obtained in step S2 in a reaction system. The 17 extension probes extend one nucleotide at a specific site of the pathogen, and the nucleotide is complementary to the genotype at the specific site, serving as a molecular weight marker.

[0019] S4. Purify the extended product obtained in step S3 to obtain a purified extended product.

[0020] S5. The extended product obtained in step S4 is subjected to molecular weight detection using mass spectrometry, and the type of pathogen to be tested is determined based on the molecular weight difference.

[0021] In a preferred embodiment of the present invention, the PCR amplification system in step S1 includes: 1 μL of amplification primer mixture, 0.5 μL of PCR reaction buffer, 0.4 μL of MgCl2, 0.1 μL of dNTP / dUTP mixture, 0.05 μL of uracil-DNA glycosylase, 0.2 μL of PCR polymerase, 2.0 μL of sample DNA / RNA, and 0.75 μL of HPLC-grade water; the PCR amplification product purification system in step S2 includes: 0.17 μL of SAP Buffer, 0.30 μL of shrimp alkaline phosphatase, and 1.53 μL of HPLC-grade water; the multiple single-base extension system in step S3 includes: 0.94 μL of extension probe, 0.20 μL of iPLEX reaction buffer, 0.20 μL of iPLEX termination mixture, 0.04 μL of iPLEX extension enzyme, and 0.62 μL of HPLC-grade water.

[0022] This invention has at least one of the following beneficial effects:

[0023] This invention proposes a method for multiplex detection of specific fragments related to 17 pathogens using multiplex PCR combined with clinical mass spectrometry, demonstrating significant biological value. Firstly, it offers high sensitivity. This invention integrates multiplex PCR, single-base extension, and mass spectrometry, allowing for template amplification via PCR and detection of minute samples via mass spectrometry. This combination of advantages far surpasses the effectiveness of using PCR alone for detecting specific pathogen fragments, resulting in extremely high sensitivity. Secondly, it offers excellent specificity. Single-base extension, also known as "microsequencing," uses specific probes to identify nucleic acid molecules, offering the high accuracy, specificity, and low false-positive rate of sequencing technology. Unlike sequencing, which extends hundreds of bases, this technique extends only a single base, further reducing the probability of errors. Finally, it is simple, rapid, and cost-effective. By identifying characteristic maps of specific sites related to pathogen typing, it completes the detection of relevant pathogens, overcoming the limitation of previous techniques that could only detect a limited number of pathogens at once, thus reducing costs. The required data analysis is simple, requiring only observation of the spectra, without complex bioinformatics analysis or fluorescent labeling, reducing the system complexity and signal interpretation errors caused by the addition of fluorescent chemical probes. Attached Figure Description

[0024] Figures 1-18 The image shows the test results for 18 samples in Example 2. Detailed Implementation

[0025] Example 1: Design of amplification primers and extension probes

[0026] For each microorganism to be detected, species-specific but intraspecific conserved genes are selected as target genes. Based on the full-length sequence of the microorganism, the target gene sequence is obtained, and the conserved regions of the target genes for each microorganism are determined. Based on the conserved sequences of the selected target genes, amplification primers are designed for each microorganism. A 10-base universal sequence ACGTTGGATG is added to the 5' end of each primer. A single-base extension probe is designed within the conserved sequence region of the amplification region. At the 3' end of the probe, an extension of one designed base is allowed as a genotype-specific sequence marker. Through extensive experiments, this invention has designed a set of highly specific amplification primers and extension probes for 17 reproductive tract-transmitted infectious microorganisms. The sequences of the amplification primers and extension probes for these 17 reproductive tract-transmitted infectious microorganisms are shown in Table 1.

[0027] Table 1

[0028] serial number Detecting pathogens Primer Composition Serial Number Extended product length (bp) Theoretical molecular weight (Da) of the extended product 1 Trichomonas vaginalis Forward primer: CTTGGACTTCTTGCCGTAGT Reverse primer: TCAGTGCACAGGTCTTCAGG Extension probe: CCGAAGGAGTGGAAGATA SEQ ID NO.1SEQID NO.2SEQ IDNO.3 19 5892.9 2 Herpes simplex virus type 1 Forward primer: GTTGGGTTTGTCCTTCTCG Reverse primer: ACCGCCATCAGCCTTACCAC Extension probe: GGCCCGGGGACTGGGGTAGG SEQ ID NO.4SEQID NO.5SEQ IDNO.6 21 6567.3 3 Herpes simplex virus type 2 Forward primer: ACGCTCTCGTAAATGCTTCC Reverse primer: CCACCTCTACCCACAACAGA Extension probe: CGCCGGAGACATTCGAG SEQ ID NO.7SEQID NO.8SEQ IDNO.9 18 5547.5 4 Ureaplasma urealyticum Forward primer: TGAACAAATCGTAGCAGGTG Reverse primer: CCTGCTTCGTTTAATGTATC Extension probe: CAGGTGCTTGTGGTCTTAAGATTC SEQ IDNO.10SEQ IDNO.11SEQ IDNO.12 25 7661 5 microureaplasma Forward primer: TAGTAATAAGTCGTGATGG Reverse primer: GCTTTTGATGTAATGATTAGG Extension probe: ATGAATTAGGATTAAAAACTAATGA SEQ IDNO.13SEQ IDNO.14SEQ IDNO.15 26 8072.2 6 Mycoplasma genitalium Forward primer: CAACACACTTCACCTCCTTA Reverse primer: AAGGATCAATAACTGAAGC Extension probe: CGCACATGGTGAAAGATAA SEQ IDNO.16SEQ IDNO.17SEQ IDNO.18 20 6117 7 Neisseria gonorrhoeae Forward primer: TGCTGTTTCAAGTCGTCCAG Reverse primer: GAGGCATTGAAGCAAAGCGA Extension probe: CGTTCTTGACGCTCCATA SEQ IDNO.19SEQ IDNO.20SEQ IDNO.21 19 5752.6 8 Chlamydia trachomatis Forward primer: CCAAGCCGAGTCTACAGTTA Reverse primer: CGTTGTTAGGTAAAGCTCTG Extension probe: CCTCAGAATATACTCAGTAGAG SEQ IDNO.22SEQ IDNO.23SEQ IDNO.24 23 7054.5 9 Gardnerella vaginalis Forward primer: GCCAAACAAAAAGCCACTC Reverse primer: GGGAGATGAAAATCGTGCTG Extension probe: GCACAAAACAACAACTATTG SEQ IDNO.25SEQ IDNO.26SEQ IDNO.27 21 6414.1 10 Treponema pallidum Forward primer: CGCGATATCGTCTTTCCTGT Reverse primer: AAAACCGGTGCATAACACGC Extension probe: TTCTTCGCTGCTCCATA SEQ IDNO.28SEQ IDNO.29SEQ IDNO.30 18 5334.5 11 Candida albicans Forward primer: GGCAAGATTATTTAGCATGG Reverse primer: CCAAGGGCAAAACTGTATG Extension probe: TTTTCCATGCTCCTGGTTC SEQ IDNO.31SEQ IDNO.32SEQ IDNO.33 20 5982.9 12 Candida cruzie Forward primer: GCCAAATGGCGAACTTGAAC Reverse primer: CCAGAGCCCTCAATGTATGC Extension probe: CTTACGGGAAGTCAACTAGAC SEQ IDNO.34SEQ IDNO.35SEQ IDNO.36 22 6686.4 13 Candida Portugueseis Forward primer: TGCGTTAGTCGAACTGATGG Reverse primer: AGCACGAGCCCAAGCAAGTT Extension probe: CAACCAGGCGGGCATCAAGATCC SEQ ID NO.37SEQ IDNO.38SEQ IDNO.39 24 7274.8 14 Candida glabrata Forward primer: GTCAGGGTTGGGATCTAGTT Reverse primer: GCGTCTTCGCATAATCTCC Extension probe: TGTGGTGGGACCTTACAATAC SEQ IDNO.40SEQ IDNO.41SEQ IDNO.42 22 6788.3 15 Candida glabrata Forward primer: TATTGGTGCTGGTGGATTGG Reverse primer: TGCTGAAAAAGAGCCAGGAG Extension probe: TTGGGTGCTGATGCAGTTTA SEQ IDNO.43SEQ IDNO.44SEQ IDNO.45 21 6521.1 16 Tropical Candida Forward primer: GACAAACCGTGTTAGTAATG Reverse primer: ATCTAGCAGCCCACGGAACA Extension probe: AAGGAATATTGAAATCACAACAA SEQ IDNO.46SEQ IDNO.47SEQ IDNO.48 24 7352.9 17 Candida doblin Forward primer: GTGTATTTGTCGTTCCCCTTTC Reverse primer: GTGTGTTGTGTGCACTAACGTC Extension probe: GTCATGATTGCCTTTGATGTTGACG SEQ IDNO.49SEQ IDNO.50SEQ IDNO.51 26 7965.2

[0029] Example 2: Method for simultaneous detection of 17 reproductive tract pathogens using the primer composition of Example 1

[0030] Eighteen clinical reproductive secretion and urine samples were obtained and named Sample 1 to Sample 18. Nucleic acid was extracted from Samples 1 to Sample 18 using magnetic beads. The method for detecting 17 pathogens using the primer composition described in Example 1 included the following steps: 1) Multiplex PCR amplification: A mixture of dUTPs, UNG enzyme, DNA polymerase, and multiplex PCR primers were added to the PCR reaction system. First, dUTPs were digested to degrade the PCR amplification products. Then, UNG enzyme was inactivated. Subsequently, 45 cycles of PCR amplification were performed to obtain the amplified products of the target genes in the samples to be tested. 2) Shrimp alkaline phosphatase (SAP) treatment: After the multiplex PCR reaction, shrimp alkaline phosphatase (SAP) was used to digest and remove the remaining dNTPs in the reaction system to prevent interference with the subsequent base extension reaction. 3) Base extension reaction: A designed extension probe is added for single-base extension reaction. A modified dideoxynucleotide triphosphate (ddNTP) is used as the reaction substrate, causing the extension probe to extend by one base at a specific single nucleotide site before terminating the reaction. That is, in the second round of amplification, the 3' end of the single-base extension probe is extended by one sequence-specific single nucleotide for molecular weight labeling. 4) Mass spectrometry detection: The purified product is analyzed for molecular weight using mass spectrometry. The type of sexually transmitted microorganism to be tested is determined based on the difference in molecular weight.

[0031] The specific testing methods are as follows:

[0032] 1. PCR Amplification: 1.1 Thawing and Mixing Reagents: Thaw the IPLEX reagents at room temperature beforehand (the reagents can be removed when adding PCR enzymes). Vortex all components in the kit to mix, centrifuge, and set aside. 1.2 Preparing the PCR Premix: Place 1.5 ml centrifuge tubes on ice and prepare the PCR premix according to the table below. Prepare 20% more than the actual sample to be tested or increase the amount according to the specific ratio.

[0033]

[0034] 1.3 Aliquoting of PCR Premix: Select an appropriate PCR plate according to the number of reaction wells, and add 3 μL of PCR premix to each well. 1.4 Adding Test Samples: Prepare the nucleic acid samples in advance, measuring at least 20 ng of sample (A260 / A280: 1.7~2.0), and add 2 μL of sample to each well; the total volume of the PCR reaction system is 5 μL. 1.5 Sealing: Observe the bottom of the 96-well plate to ensure that there is liquid in each sample well and the liquid level is even. Centrifuge at 3200 g for 1 min. 1.6 PCR Reaction Procedure:

[0035]

[0036] 2. Purification: SAP digestion (shrimp alkaline phosphatase digestion)

[0037] 2.1 Thawing and Mixing Reagents: Thaw the SAP purification reagent at room temperature. Vortex all components in the kit to mix, centrifuge, and set aside. 2.2 Preparing the SAP Premix: Place 1.5 ml centrifuge tubes on ice. Calculate the volume of each component according to the table below and prepare the PCR premix. Prepare 20% more than the actual sample volume or increase the volume proportionally.

[0038]

[0039] 2.3 SAP Premix Dispensing: Remove the PCR reaction plate, centrifuge at 3200g for 5 seconds, and add 2µl of SAP premix to each well, bringing the total reaction volume to 7µl. 2.4 Plate Sealing: Observe the bottom of the 96-well plate to ensure there is liquid in each well and the liquid level is even. Centrifuge at 3200g for 1 min. 2.5 SAP Reaction Procedure:

[0040]

[0041] 3. Extension Reaction: 3.1 Thawing and Mixing Reagents: Remove the extension reaction reagents and thaw at room temperature (they can be removed when adding enzyme samples). Vortex all components in the kit to mix, centrifuge, and set aside. 3.2 Premixing: Place 1.5 ml centrifuge tubes on ice, calculate the volume of each component according to the table below, and prepare the PCR premix. Prepare 20% more than the actual sample volume or increase it according to the specific ratio.

[0042]

[0043] 3.3 SAP Premix Dispensing: Remove the PCR reaction plate, centrifuge at 3200g for 5 seconds, and add 2ul of SAP premix to each well, bringing the total reaction volume to 9ul. 3.4 Plate Sealing: Observe the bottom of the 96-well plate to ensure there is liquid in each well and the liquid level is even. Centrifuge at 3200g for 1 min. 3.5 Extension Reaction Procedure

[0044]

[0045] 3.6 Adding ultrapure water to the extension product: After the extension reaction is completed, remove the experimental plate, centrifuge at 3200g for 5s, add 41ul or 21ul of ultrapure water to each reaction well, vortex to mix, and centrifuge at 3200g for 1min.

[0046] 4. Mass Spectrometry Detection: The purified product obtained in step 3.6 is spotted onto a target plate containing the matrix and placed in a mass spectrometer (Agena MassARRAY Module 96) for detection. Detection conditions: a) Ambient temperature: 16-24℃; b) Relative humidity: 30%-75%; no condensation; c) Indoor use; d) Power supply: AC220V 50Hz; Atmospheric pressure: 86.0 kPa~106.0 kPa. The chip is instantaneously excited by a strong laser in the vacuum tube of the mass spectrometer. Accompanying the sublimation of the matrix crystals, nucleic acid molecules desorb and transform into single-charged ions. These single-charged ions gain kinetic energy under an accelerating electric field and fly through the vacuum tube to the detector. The detection results are presented graphically on the server, forming an analytical spectrum with the ion peak intensity as the ordinate and the ion mass as the abscissa. The difference in molecular mass before and after the specific extension probe extension reaction is used to determine the microorganisms in the sample. The software (TyperAnalyzer) automatically analyzes and reports results, exports data, and automatically processes and reports the test results and reliability of each microorganism.

[0047] Test results:

[0048] The test results of samples 1 to 18 are as follows: Figures 1-18 As shown. Among them, Figures 1-17Of the characteristic peaks in the sample, only one is the product peak, while the remaining characteristic peaks are either unconverted extension primers or contrast bases that do not exist in nature. Figure 1 The abscissa of the product peak is 5892.9 Da. Comparing it with the theoretical molecular weight of the extended product, it can be seen that the product peak corresponds to Trichomonas vaginalis, that is, sample 1 contains Trichomonas vaginalis. Figure 2 The abscissa of the product peak is 6567.3 Da. Comparing it with the theoretical molecular weight of the extended product, it can be seen that the product peak corresponds to herpes simplex virus type 1, that is, sample 2 contains herpes simplex virus type 1. Figure 3 The abscissa of the product peak is 5547.5 Da. Comparing it with the theoretical molecular weight of the extended product, it can be seen that the product peak corresponds to herpes simplex virus type 2, that is, sample 3 contains herpes simplex virus type 2. Figure 4 The abscissa of the product peak in the sample is 7661 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Ureaplasma urealyticum, that is, sample 4 contains Ureaplasma urealyticum. Figure 5 The abscissa of the product peak is 8072.2 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Ureaplasma microphylla, that is, sample 5 contains Ureaplasma microphylla. Figure 6 The abscissa of the product peak in the sample is 6117 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Mycoplasma genitalium, that is, sample 6 contains Mycoplasma genitalium. Figure 7 The abscissa of the product peak is 5752.6 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Neisseria gonorrhoeae, that is, sample 7 contains Neisseria gonorrhoeae. Figure 8 The abscissa of the product peak is 7054.5 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Chlamydia trachomatis, that is, sample 8 contains Chlamydia trachomatis. Figure 9 The abscissa of the product peak is 6414.1 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Gardnerella vaginalis, that is, sample 9 contains Gardnerella vaginalis. Figure 10 The abscissa of the product peak is 5334.5 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Treponema pallidum, that is, sample 10 contains Treponema pallidum. Figure 11 The abscissa of the product peak in the sample is 5982.9 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida albicans, and sample 11 contains Candida albicans. Figure 12 The abscissa of the product peak is 6686.4 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida cruzie. Sample 12 contains Candida cruzie. Figure 13 The abscissa of the product peak is 7274.8 Da. Compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida lucida, and sample 13 contains Candida lucida. Figure 14 The abscissa of the product peak is 6788.3 Da. Compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida glabrata, and sample 14 contains Candida glabrata. Figure 15 The abscissa of the product peak is 6521.1 Da. Compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida glabrata, and sample 15 contains Candida glabrata. Figure 16 The abscissa of the product peak is 7352.9 Da. Compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida tropicalis, and sample 16 contains Candida tropicalis. Figure 17 The abscissa of the product peak is 7965.2 Da. When compared with the theoretical molecular weight of the extended product, the product peak corresponds to Candida doblin, which is Candida doblin in sample 17. Figure 18 Of the characteristic peaks in the sample, eight are product peaks, with x-coordinates of 5982.9 Da, 7054.5 Da, 6414.1 Da, 6117 Da, 5752.6 Da, 5334.5 Da, 8072.2 Da, and 7661 Da, respectively. The remaining characteristic peaks are either unconverted extension primers or contrast bases not found in nature. Comparison with the theoretical molecular weights of the extension products reveals that the product peaks correspond to Candida albicans, Chlamydia trachomatis, Gardnerella vaginalis, Mycoplasma genitalium, Neisseria gonorrhoeae, Treponema pallidum, Ureaplasma microspora, and Ureaplasma urealyticum, respectively. Therefore, sample 18 contains eight pathogens.

[0049] Example 3: Preparation of the test kit and tests for accuracy, specificity, sensitivity and repeatability.

[0050] I. Preparation of the Detection Kit: The detection kit in this embodiment contains a total of 19 pairs of amplification primers, of which 17 pairs are the primer combinations in Example 1, and 2 pairs are personal source genes (GAPDH_V1 and Tubb). The detection kit also includes reagents, specifically the PCR amplification reagent, SAP digestion reagent, and extension reaction reagents from Example 2.

[0051] The detection kit is based on the MassARRAY® iPLEX chemistry principle. In a single reaction containing primers for 17 pathogens, the kit amplifies specific regions of each target pathogen through PCR, purification, and extension. It utilizes a matrix-assisted laser desorption / ionization time-of-flight mass spectrometry system, combined with iPLEX Pro chemistry, which employs single-base extension PCR, to identify target pathogens based on their mass differences, enabling high-throughput multiplex SNP detection.

[0052] II. Verification of the accuracy, specificity, sensitivity, and repeatability of the test kit

[0053] (a) Accuracy: Compared with the real-time fluorescence PCR detection method, 32 samples were obtained and detected by the kit of this invention and real-time fluorescence PCR respectively. The detection results are shown in Table 2.

[0054] Table 2

[0055]

[0056] Comparison with real-time fluorescence PCR showed that all 32 results were consistent, with a 100% concordance rate. Furthermore, compared to real-time fluorescence PCR, the kit of this invention was able to detect more pathogens, indicating that the kit of this invention has higher sensitivity.

[0057] (ii) Repeatability: The same group of clinical samples were tested on different dates to verify the batch-to-batch differences. The test results are shown in Table 3.

[0058] Table 3

[0059]

[0060] Therefore, as can be seen from Table 3, the batch repeatability is 100% satisfactory.

[0061] (III) Limit of Detection: A reference plasmid containing 12 targets from Agena was used, diluted to two concentrations: 100 copies / test and 200 copies / test. Each concentration was measured 10 times. At least 9 out of 10 repeated assays showed detection of the target nucleic acid. The results are shown in Table 4.

[0062] Table 4

[0063]

[0064] Therefore, as can be seen from Table 4, the two concentrations of 100 copies / test and 200 copies / test showed 100% detection of each target.

[0065] (iv) Specificity: Four clinical negative samples (named Sample 1-Sample 4) were taken and added with a fixed-value plasmid containing six targets (UU, NG, TP, TV, HSV1, CA) produced by Agena, respectively, to achieve final pathogen concentrations of 200 copies / test and 1000 copies / test. Nucleic acid was extracted according to the nucleic acid extraction procedure for clinical samples. Simultaneously, a plasmid at a concentration of 200 copies / test and human genomic DNA (hapmap) were used as controls, without participating in the extraction and directly amplified. Each sample and each concentration was measured twice in parallel to verify the sample interference ability. The detection results are shown in Table 5.

[0066] Table 5

[0067]

[0068] As can be seen from Table 5, all tested samples were detected normally, indicating that the kit of the present invention has good specificity.

[0069] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A primer composition for detecting 17 pathogens, characterized in that, The primer composition comprises 17 pairs of amplification primers and 17 extension probes, wherein: The amplification primers and extension probes for amplifying Trichomonas vaginalis are shown in SEQ ID NO:1~3; The amplification primers and extension probes for amplifying herpes simplex virus type 1 are shown in SEQ ID NO:4~6; The amplification primers and extension probes for amplifying herpes simplex virus type 2 are shown in SEQ ID NO: 7~9; The amplification primers and extension probes for amplifying Ureaplasma urealyticum are shown in SEQ ID NO:10~12; The amplification primers and extension probes for amplifying Ureaplasma microsporum are shown in SEQ ID NO:13~15; The amplification primers and extension probes for amplifying Mycoplasma genitalium are shown in SEQ ID NO:16~18; The amplification primers and extension probes for amplifying Neisseria gonorrhoeae are shown in SEQ ID NO:19~21; The amplification primers and extension probes for amplifying Chlamydia trachomatis are shown in SEQ ID NO:22~24; The amplification primers and extension probes for amplifying Gardnerella vaginalis are shown in SEQ ID NO:25~27; The amplification primers and extension probes for amplifying Treponema pallidum are shown in SEQ ID NO:28~30; The amplification primers and extension probes for amplifying Candida albicans are shown in SEQ ID NO:31~33; The amplification primers and extension probes for amplifying Candida cruzie are shown in SEQ ID NO:34~36; The amplification primers and extension probes for amplifying Candida lucida are shown in SEQ ID NO:37~39; The amplification primers and extension probes for amplifying Candida glabrata are shown in SEQ ID NO:40~42; The amplification primers and extension probes for amplifying Candida glabrata are shown in SEQ ID NO:43~45; The amplification primers and extension probes for amplifying Candida tropicalis are shown in SEQ ID NO:46~48; The amplification primers and extension probes for amplifying Candida doblin are shown in SEQ ID NO:49~51.

2. The primer composition according to claim 1, characterized in that, The length of the extended product corresponding to Trichomonas vaginalis is 19 bp, and the molecular weight of the extended product is 5892.9 Da. The length of the extended product fragment corresponding to herpes simplex virus type 1 is 21 bp, and the molecular weight of the extended product is 6567.3 Da; The length of the extended product corresponding to herpes simplex virus type 2 is 18 bp, and the molecular weight of the extended product is 5547.5 Da; The length of the extended product corresponding to Ureaplasma urealyticum is 25 bp, and the molecular weight of the extended product is 7661 Da. The length of the extended product corresponding to Ureaplasma microsporum is 26 bp, and the molecular weight of the extended product is 8072.2 Da; The length of the extended product corresponding to Mycoplasma genitalium is 20 bp, and the molecular weight of the extended product is 6117 Da. The length of the extended product corresponding to Neisseria gonorrhoeae is 19 bp, and the molecular weight of the extended product is 5752.6 Da; The length of the extended product corresponding to Chlamydia trachomatis is 23 bp, and the molecular weight of the extended product is 7054.5 Da; The length of the extended product corresponding to Gardnerella vaginalis is 21 bp, and the molecular weight of the extended product is 6414.1 Da; The length of the extended product corresponding to Treponema pallidum is 18 bp, and the molecular weight of the extended product is 5334.5 Da; The length of the extended product corresponding to Candida albicans is 20 bp, and the molecular weight of the extended product is 5982.9 Da. The length of the extended product corresponding to Candida cruzie is 22 bp, and the molecular weight of the extended product is 6686.4 Da. The length of the extended product of Candida Portugal is 24 bp, and the molecular weight of the extended product is 7274.8 Da. The length of the extended product corresponding to Candida glabrata is 22 bp, and the molecular weight of the extended product is 6788.3 Da; The length of the extended product corresponding to Candida glabrata is 21 bp, and the molecular weight of the extended product is 6521.1 Da. The length of the extended product corresponding to Candida tropicalis is 24 bp, and the molecular weight of the extended product is 7352.9 Da; The length of the extended product corresponding to Candida doblin is 26 bp, and the molecular weight of the extended product is 7965.2 Da.

3. The use of the primer composition according to any one of claims 1 to 2 in the preparation of a product for simultaneous detection of 17 pathogens.

4. A detection product for simultaneously detecting 17 pathogens, characterized in that, Includes the primer composition according to any one of claims 1 to 2.

5. The testing product according to claim 4, characterized in that, The detection product also includes reaction solution I for PCR amplification, which includes an amplification primer mixture, PCR reaction buffer, MgCl2, a dNTP / dUTP mixture, uracil-DNA glycosylase, and DNA polymerase.

6. The testing product according to claim 4, characterized in that, The detection product also includes reaction solution II for purifying PCR amplification products, wherein reaction solution II includes SAP buffer and shrimp alkaline phosphatase.

7. The testing product according to claim 4, characterized in that, The detection product also includes reaction solution III for single-base extension reaction, which includes extension probe, iPLEX reaction buffer, iPLEX termination mixture, and iPLEX extension enzyme.

8. The use of the primer composition according to any one of claims 1 to 2 in the simultaneous detection of 17 pathogens for non-disease diagnosis purposes.

9. A method for simultaneously detecting 17 pathogens in environmental sanitation, food safety testing, and import / export inspection and quarantine fields for non-disease diagnosis purposes, characterized in that... Includes the following steps: S1. Using the 17 pairs of amplification primers in the primer composition of claim 1, the target DNA regions of 17 pathogens are simultaneously amplified in a reaction system to obtain PCR amplification products containing DNA regions containing 17 specific sites. S2. Purify the PCR amplification product obtained in step S1; S3. Using the 17 extension probes in the primer composition of claim 1, perform multiple single-base extension on the purified PCR amplification product obtained in step S2 in a reaction system. The 17 extension probes extend one nucleotide at a specific site of the pathogen, and the nucleotide is complementary to the genotype at the specific site, serving as a molecular weight marker. S4. Purify the extended product obtained in step S3 to obtain a purified extended product. S5. The extended product obtained in step S4 is subjected to molecular weight detection using mass spectrometry, and the type of reproductive tract pathogen to be tested is determined based on the molecular weight difference.

10. The method according to claim 9, characterized in that, The PCR amplification system in step S1 includes: 1 μL of amplification primer mixture, 0.5 μL of PCR reaction buffer, 0.4 μL of MgCl2, 0.1 μL of dNTP / dUTP mixture, 0.05 μL of uracil-DNA glycosylase, 0.2 μL of PCR polymerase, 2.0 μL of sample DNA / RNA, and 0.75 μL of HPLC-grade water; The PCR amplification product purification system in step S2 includes: 0.17 μL SAP Buffer, 0.30 μL shrimp alkaline phosphatase, and 1.53 μL HPLC grade water; The multiple single-base extension system in step S3 includes: 0.94 μL of extension probe, 0.20 μL of iPLEX reaction buffer, 0.20 μL of iPLEX termination mixture, 0.04 μL of iPLEX extension enzyme, and 0.62 μL of HPLC-grade water.

Citation Information

Patent Citations

  • Primer group, probe group and kit for synchronously detecting multiple pathogens related to genital tract infection

    CN112301169A

  • Primer composition for detecting genital tract pathogens through MALDI-TOF MS and application

    CN113215322A

  • Kit for multiple nucleic acid detection of sexual transmission infection

    CN114250319A

  • Primer probe composition for synchronously detecting 16 female genital tract pathogens

    CN115873849A

  • Primer probe combination for detecting genital tract pathogenic microorganisms, kit and application

    CN119464524A