Engineering clostridium sporogenes with high yield of indole-3-propionic acid as well as preparation method and application of engineering clostridium sporogenes
By constructing an engineered Clostridium sporogenes that produces high levels of IPA, and using a Clostridium-Escherichia coli shuttle vector to highly express IPA, the problem of existing drugs being unable to achieve dual regulation in the treatment of PMOP was solved. This resulted in safe and effective regulation of the skeletal microenvironment, providing a safe and effective intervention pathway for PMOP.
Patent Information
- Application Number
- CN202510993104.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-11-14
AI Technical Summary
Existing drugs for treating postmenopausal osteoporosis (PMOP) cannot achieve a dual regulation that both inhibits osteoclast formation and promotes osteogenic formation, and they also have side effects. There is a lack of safe and effective long-term intervention methods.
By constructing an engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid (IPA), and using the Clostridium-Escherichia coli shuttle vector pMTL82151-fldAIBC to highly express IPA, stable and efficient IPA production was achieved. This IPA is then used to colonize the intestines and continuously release it to regulate the skeletal microenvironment.
It achieves precise bidirectional regulation of the skeletal microenvironment, inhibits osteoclast activity, promotes osteoblast differentiation, restores homeostasis of bone formation and bone resorption, reduces side effects, and provides a safe and effective PMOP intervention pathway.
Smart Images

Figure CN120944792A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to an engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid, its preparation method, and its application. Background Technology
[0002] Bone homeostasis depends on the dynamic coupling between osteoblasts (OB) and osteoclasts (OC) in bone formation and resorption. The sharp drop in estrogen after menopause disrupts this balance, leading to increased osteoclast activity and relatively insufficient osteogenic activity, resulting in postmenopausal osteoporosis (PMOP). Current medications are broadly divided into two categories: anti-resorption agents such as bisphosphonates and denosumab can rapidly inhibit osteoclast formation but simultaneously suppress coupled osteogenic processes, and are prone to "rebound bone loss" after discontinuation; osteogenic agents such as teriparatide can activate osteogenic processes but stimulate osteoclast resorption and carry potential tumorigenic risks. In recent years, romozolomide, with its "dual-target" properties, has been touted as an ideal therapy, but its effectiveness is limited by cardiovascular events. Therefore, the availability of drugs for treating osteoporosis remains limited by coupling factors or severe side effects, resulting in a lack of interventions that can both inhibit osteoclast formation and promote osteogenic processes while maintaining long-term safety.
[0003] Research on the gut-skeletal axis offers a novel perspective for breaking through current limitations. The gut microbiota structure is significantly imbalanced in PMOP populations—a decrease in Clostridium difficile and an increase in Bacteroides, accompanied by overall alterations in the profiles of gut microbiota metabolites such as short-chain fatty acids (SCFAs), bile acids, and tryptophan derivatives. The applicant has demonstrated a positive correlation between indole-3-propionic acid (IPA), a tryptophan metabolite produced by Clostridium difficile, and bone mass protection. Simultaneously, animal model validation showed that IPA intervention significantly improved bone mineral density and bone microstructure in ovariectomized mice, suggesting its potential as a bone metabolism coupling factor. However, bringing IPA or similar gut microbiota metabolites to clinical application still faces multiple bottlenecks: firstly, endogenous IPA levels are highly dependent on gut microbiota composition, and individual differences and external variables such as age, diet, and medication make precise dose control difficult; secondly, free IPA has low oral absorption and rapid first-pass metabolism, resulting in a narrow systemic exposure window; and thirdly, there is a lack of carrier systems that can accurately deliver IPA to the gut or bone tissue, and long-term safety thresholds and production quality standards need to be established. How to overcome the above bottlenecks and transform IPA or similar gut microbiota metabolites—these "bone-gut metabolic couplers"—into a novel, non-invasive, long-term PMOP intervention program that can truly achieve precise bidirectional regulation of bone remodeling with low side effects has broad application prospects in the future. Summary of the Invention
[0004] Technical Problem Solved: To address the aforementioned technical problems, this invention provides an engineered Clostridium sporogenes strain that produces high levels of indole-3-propionic acid (IPA), its preparation method, and its applications. By stably and highly expressing IPA, its content in the skeletal microenvironment is increased, thereby exerting a dual regulatory function of bone metabolism that promotes bone formation and inhibits bone resorption, restoring the homeostasis of bone formation and bone resorption, and improving postmenopausal osteoporosis. This invention has the dual function of regulating bone metabolism and increasing bone mass, and also possesses the common advantages of probiotic therapy. It also has good biocompatibility, can be scaled up for production in the future, is easy to prepare, and has broad application prospects.
[0005] Technical solution: In a first aspect, the present invention provides an engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid, wherein the engineered Clostridium sporogenes is an engineered Clostridium sporogenes carrying the recombinant plasmid pMTL82151-fldAIBC.
[0006] In a second aspect, the present invention provides a method for preparing the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid as described in the first aspect, comprising the following steps: S1. Vector construction: Using the Clostridium coli shuttle vector pMTL82151 as the backbone, the thl gene was amplified using thl-Xbal-F and thl-XhoI-R primers. The thl gene amplification product was then ligated with pMTL82151 by enzyme digestion to obtain plasmid pMTL82151-thl. S2. Preparation of recombinant plasmid: The fldAIBC structural gene fragment is inserted into the multiple cloning site of plasmid pMTL82151-thl to obtain the recombinant plasmid pMTL82151-fldAIBC, which can transcribe fldAIBC in Clostridium sporogenes. It contains both the pMB1 origin of replication and the repH origin of replication, and carries the chloramphenicol acetyltransferase resistance gene for dual-host selection. S3. Introduce the recombinant plasmid into the host Clostridium sporogenes and screen and identify it: The recombinant plasmid pMTL82151-fldAIBC is introduced into the target Clostridium sporogenes strain using heat shock transformation and / or conjugate transfer methods; transformants are screened in anaerobic medium containing the corresponding antibiotics, and the presence of the fldAIBC gene is confirmed by detection and the expression level is at least 2 times that of the original. Engineered Clostridium sporogenes with IPA production of 2 times or more and stable production are screened, namely engineered strain IPA CS.
[0007] Preferably, in step S1, thl is a strong promoter (using a strong promoter is one of the important conditions for high expression in recombinant bacteria). After evaluating the multiple cloning site of the vector pMTL82151, XbaI and XhoI are determined to be suitable restriction endonuclease sites. When designing the codon-optimized fldAIBC open reading frame, XbaI and XhoI recognition sequences are added to its 5' and 3' ends, respectively, to facilitate the targeted cloning of the target fragment into the Clostridium coli shuttle vector pMTL82151, thus obtaining the recombinant plasmid pMTL82151-fldAIBC. The nucleotide sequence of the recombinant plasmid pMTL82151-fldAIBC is shown in SEQ ID NO.1: SEQ ID NO.1:
[0008] Furthermore, the nucleotide sequence of the thl gene is shown in SEQ ID NO.2, the nucleotide sequences of the thl-Xbal-F and thl-XhoI-R primers are shown in SEQ ID NO.3-SEQ ID NO.4, and the nucleotide sequence of the codon-optimized fldAIBC open reading frame is shown in SEQ ID NO.5. Specifically: SEQ ID NO.2: TTTTTAACAAAATATATTGATAAAAATAATAATAGTGGGTATAATTAAGTTGTTAGAGAAAACGTATAAATTAGGGATAAACTATGGAACTTATGAAATAGATTGAAATGGTTTATCTGTTACCCCGTATCAAAATTTAGGAGGTTAGTTAGA; SEQ ID NO.3: GCTCTAGATTTTTAACAAAATATATTGA; SEQ ID NO.4: CCGGAGCTCTCTAACTAACCTCCTAAATT; SEQ ID NO.5:
[0009] Preferably, in step S2, the fldAIBC structural gene fragment is inserted into the multiple cloning site of plasmid pMTL82151-thl using the Gibson isothermal assembly method.
[0010] Preferably, the heat shock transformation conditions in step S3 are: heat shock at 42℃ for 90 seconds, followed by an ice bath for 5 minutes, and then recovery at 37℃ under anaerobic conditions for 1 hour; the conjugate transfer process is as follows: E. coli donors carrying pMTL82151-thl are mixed with Clostridium sporogenes recipients at a volume ratio of 1:1, co-incubated with a filter membrane for 6-8 hours, and then transferred to an anaerobic plate containing chloramphenicol to complete the transfer; the screening and identification method uses modified RCM anaerobic medium containing 15µg / mL chloramphenicol for screening. After confirming the fldAIBC gene positivity by colony PCR, the IPA production of the engineered strain within 24 hours is detected by HPLC, and the morphology, particle size distribution, zeta potential, and OD of the engineered strain are recorded. 600 Growth curve characterization and control comparison.
[0011] Preferably, the host Clostridium sporogenes is Clostridium sporogenes Or derived strains obtained through mutagenesis / gene knockout / insertion.
[0012] Thirdly, the present invention provides the use of engineered Clostridium sporogenes, which produces high levels of indole-3-propionic acid as described in the first aspect, in the preparation of products that inhibit bone resorption.
[0013] Fourthly, the present invention provides the use of engineered Clostridium sporogenes, which produces high levels of indole-3-propionic acid as described in the first aspect, in the preparation of products that promote bone formation.
[0014] Fifthly, the present invention provides the use of engineered Clostridium sporogenes, which produces high levels of indole-3-propionic acid as described in the first aspect, in the preparation of products for treating osteoporosis.
[0015] Beneficial Effects: This invention utilizes metabolic engineering to construct an engineered Clostridium sporogenes strain capable of stably and efficiently synthesizing IPA. This engineered bacterium can colonize the intestines long-term and continuously release IPA, achieving precise bidirectional regulation of bone homeostasis via the gut-skeletal axis: on the one hand, it inhibits osteoclast activity and reduces bone resorption; on the other hand, it promotes osteoblast differentiation and enhances bone formation, ultimately reshaping the bone microenvironment balance of PMOP. Compared with existing anti-osteoporosis drugs, this invention, as a "living drug," possesses the advantages of both osteoclast inhibition and osteoproliferative effects, low toxicity, and long-term oral administration, providing a safe, effective, and sustainable novel probiotic intervention pathway for PMOP. Specifically: (1) The high-IPA engineered Clostridium sporogenes provided by the present invention can continuously produce physiological concentrations of IPA in vivo. By inhibiting osteoclast differentiation and upregulating osteoblast differentiation, it can simultaneously inhibit bone resorption and promote bone formation. The bacterial cells are of natural origin and have good biosafety. (2) The high-IPA engineered Clostridium sporogenes provided by the present invention has good intestinal colonization and metabolic stability, and can achieve continuous supply of IPA from the source, overcoming the defects of low oral absorption rate of free IPA, fast first-pass metabolism, and narrow system exposure window, and significantly reducing potential toxic side effects on non-target organs such as liver and kidney. (3) The high-IPA engineered Clostridium sporogenes provided by the present invention utilizes the Clostridium-Escherichia coli dual-host shuttle plasmid pMTL82151-thl to efficiently overexpress the fldAIBC gene. The strain is genetically stable and its IPA yield is about 4 times higher than that of the wild type. Its preparation process is mature and can achieve large-scale and standardized production. It is expected to provide a sustainable, economical and quality-controllable source of preparations for long-term intervention in osteoporosis. Attached Figure Description
[0016] Figure 1 These are micro-CT three-dimensional reconstruction images of the distal femur of mice in different groups after treatment in Example 1 of this invention; Figure 2 This is a quantitative statistical analysis of femoral bone mineral density (BMD) and trabecular bone parameters (BV / TV, BS / TV, Tb.Th, Tb.N) in different groups of mice after treatment in Example 1 of the present invention; Figure 3 The images show the HE staining results of the distal femur of mice in different groups after treatment in Example 1 of this invention, as well as the number of osteoblasts (N.Ob / B.Pm) in each group. Figure 4 The images show the results of Sp7 / Osterix immunofluorescence in the femurs of mice from different groups after treatment, as well as data on bone formation activity, in Example 1 of this invention. Figure 5 The images show the TRAP staining results and osteoclast area (Oc.S / BS) of the femur of mice in different groups after treatment in Example 2 of this invention. Figure 6 The images show the CTSK immunofluorescence results and osteoclast activity data of different groups of mice after treatment in Example 2 of this invention. Figure 7 This is a schematic diagram of the construction of the Clostridium coli shuttle vector pMTL82151-thl expressing the fldAIBC gene cluster in Example 3 of the present invention; Figure 8 This is an electrophoresis image of the recombinant plasmid pMTL82151-fldAIBC double enzyme digestion in Example 3 of this invention; Figure 9 Transmission electron microscopy (TEM) images of existing Clostridium sporogenes and the engineered Clostridium sporogenes of this invention that produces high levels of indole-3-propionic acid. Figure 10 This is a graph showing the particle size distribution and zeta potential analysis of the engineered Clostridium sporogene of the present invention, which produces high levels of indole-3-propionic acid, and the wild-type Clostridium sporogene. Figure 11 This is a growth curve of the engineered Clostridium sporogenes, which produces high levels of indole-3-propionic acid according to this invention, and the wild-type Clostridium sporogenes, at 600 nm. Figure 12 The graph shows the IPA yield in the supernatant of the engineered Clostridium sporogenes, which produces high levels of indole-3-propionic acid according to this invention, using HPLC for quantitative analysis. Figure 13 This is a micro-CT three-dimensional reconstruction image of the distal femur of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid according to the present invention. Figure 14 This is a quantitative statistical graph showing the femoral bone mineral density and bone structure parameters after gavage administration of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid according to the present invention. Figure 15 The image shows the HE staining results and quantitative diagram of the femur after gavage administration of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid according to this invention. Figure 16 The image shows the TRAP staining results and quantitative diagram of the femur after gavage administration of the engineered Clostridium sporogenus that produces high levels of indole-3-propionic acid according to this invention. Figure 17 This is a graph showing the quantitative ELISA analysis of serum and bone marrow IPA levels in mice after gavage administration of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid according to this invention. Figure 18 This is a diagram showing the HE staining results of mouse colon after gavage administration of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid according to this invention. Figure 19 This is an ELISA quantitative analysis of IL-1β, TNF-α and IL-6 levels in mouse colon tissue after gavage administration of the engineered Clostridium sporogenus that produces high levels of indole-3-propionic acid according to this invention. Figure 20 This is an immunofluorescence analysis of the tight junction proteins ZO-1 and Occludin in the mouse colon after gavage administration of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid, as described in this invention. Figure 21 The image shows the HE staining results of the heart, liver, spleen, lungs, and kidneys of mice after gavage administration of the engineered Clostridium sporogenes that produces high levels of indole-3-propionic acid according to this invention. Detailed Implementation
[0017] The present invention will be described in detail below with reference to specific embodiments: The mice used in the embodiments are 6-8 week old female C57BL / 6 mice, which are from the Experimental Animal Center of Soochow University; all mouse experiments are carried out in accordance with the animal experiment protocol approved by the Experimental Animal Center of Soochow University.
[0018] Example 1: IPA promotes osteogenic differentiation A mouse model of postmenopausal osteoporosis was established by ovariectomy (OVX) to observe the effects of indole-3-propionic acid (IPA) on osteogenic differentiation and bone mass.
[0019] (1) Establishment of a mouse model of postmenopausal osteoporosis induced by ovariectomy Female mice aged 6-8 weeks were selected and randomly divided into four groups (n=6 per group): sham-operated control group (Sham group), sham-operated + IPA group (Sham+IPA group), ovariectomy group (OVX group), and ovariectomy + IPA group (OVX+IPA group). The surgical procedures are as follows: Anesthesia: Mice were anesthetized by intraperitoneal injection of sodium pentobarbital at a concentration of 20 mg / mL, at a dose of 6 mg / 100 g body weight, and the depth of anesthesia required for the operation was maintained.
[0020] Surgical steps: a) Locating the surgical area: Mark the location 0.5 cm above the intersection of the line connecting the upper edge of the hip joint of the mouse's hind limb and the posterior midline of the back, with a marker pen, as the location point for the surgical incision; b) Skin incision: Under complete anesthesia, make a longitudinal incision along the midline of the back, with an incision length of approximately 0.5-1.0 cm; c) Skin separation: Carefully separate the skin from the underlying tissue until the subcutaneous tissue layer is exposed; d) Locate the adipose tissue: Locate the prominent white fat pad below the kidney as an anatomical landmark for further manipulation; e) Ovarian removal: Using forceps, lift the fat pad, carefully cut along the outer edge of the psoas major muscle, locate the left ovary, ligate and remove it. Then remove the right ovary in the same way; f) Wound suturing: Use sterile surgical sutures to suture the muscle layer and skin layer in sequence to ensure good wound closure and prevent infection.
[0021] After bilateral ovariectomy, mice in the OVX+IPA group and the OVX group were injected intraperitoneally with IPA solution (20 mg / kg) or an equal volume of PBS three times a week for eight consecutive weeks. Femoral samples were then collected from the Sham group, Sham+IPA group, OVX group and OVX+IPA group for Micro-CT imaging analysis.
[0022] (2) Micro CT micro-computed tomography analysis This invention utilizes the NEMO Micro CT system (model NMC-100) for sample scanning, precisely placing the femoral sample to be tested on the sample stage between the X-ray emission source and the CMOS detector. During the scanning process, the sample stage rotates continuously 360° along a direction perpendicular to the long axis of the femur, ensuring that the sample remains within the effective scanning area. After the X-rays penetrate the sample, the high-sensitivity CMOS detector receives the signal and converts it into a digital image, which is transmitted in real time to the workstation for image reconstruction and analysis. The scanning parameters are set as follows: tube voltage 90 kV, tube current 0.04 mA, and single scan time 20 min. The image processing software is Avatar. The FDK algorithm is used for reconstruction, with a pixel size of 0.012 mm. Multiple morphometric parameters are used to quantitatively assess the bone microstructure, specifically including: bone mineral density (BMD), bone surface tissue volume ratio (BS / TV), trabecular bone number (Tb.N), bone volume fraction (BV / TV), trabecular bone thickness (Tb.Th), and trabecular bone separation (Tb.Sp), etc.
[0023] Micro-CT scan results as follows Figure 1 As shown, the trabecular bone structure of the distal femur in the Sham group mice was intact and dense, while the OVX group showed significant bone loss, with the trabeculae becoming sparse and fragmented. There was no significant difference in bone structure between the Sham+IPA group and the Sham group, suggesting that exogenous IPA has little effect on bone mass under normal physiological conditions. Importantly, the OVX+IPA group mice showed significantly higher bone mineral density (BMD), bone volume fraction (BV / TV), bone surface area ratio (BS / TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) than the OVX group, indicating that IPA intervention effectively reduced estrogen deficiency-induced bone loss. Figure 2 ).
[0024] Further histological evaluation was performed, and the H&E staining results of the distal femur bone tissue were as follows: Figure 3 As shown, the trabecular bone structure in the OVX group mice was highly sparse, while the trabecular bone structure in the OVX+IPA group was significantly increased and thickened (quantitatively, the number of osteoblasts per bone circumference, N.Ob / B.Pm, increased). Furthermore, immunofluorescence staining of bone tissue for Sp7, a key transcription factor in osteogenic differentiation, yielded the following results: Figure 4 As shown, the number of Sp7-positive osteoblasts in the femoral metaphysis of the OVX group was significantly lower than that in the Sham group, indicating that ovariectomy inhibited osteogenic differentiation. However, after IPA treatment, the number of Sp7-positive cells in the OVX+IPA group significantly increased, approaching normal levels. Therefore, IPA administration can promote osteogenic differentiation and enhance bone formation in OVX model mice.
[0025] Example 2: IPA inhibits osteoclast formation Following the same animal experimental grouping as in Example 1, the effects of IPA on osteoclast formation and bone resorption were further evaluated. TRAP (tartrate-resistant acid phosphatase) staining was used to detect the number and activity of osteoclasts in femoral tissue.
[0026] Preparation of paraffin sections: After collecting the specimens, they were thoroughly rinsed with water and then fixed in 4% paraformaldehyde solution for 3 days. The fixed femoral tissue was decalcified with EDTA for 14 days (colon tissue did not require decalcification), followed by rinsing with tap water for 2 hours. The cleaned tissues were then subjected to dehydration treatment in ethanol of different concentrations: 75% ethanol for 1 hour, followed by 85% and 95% ethanol for 1 hour each, and finally 100% ethanol for 3 hours, followed by further dehydration overnight in fresh 100% ethanol. After dehydration, the tissues were cleared in xylene, repeated 3 times for 10 minutes each time.
[0027] The paraffin wax needs to be preheated to 65°C until completely melted. The femur and colon tissues are then immersed in the molten paraffin wax for at least 6 hours, or overnight. The paraffin wax is changed three times during this process, with each change spaced 40 minutes apart. After immersion, the embedded tissue is cut into 5μm thick sections using a paraffin microtome, and the sections are fixed onto glass slides for later use.
[0028] Paraffin sections were baked in a 65°C oven for 1 hour to remove excess paraffin. Then, the sections were immersed in xylene twice, 20 minutes each time, to ensure thorough dewaxing. After dewaxing, the sections were hydrated in ethanol solutions of decreasing concentrations: 100%, 90%, 80%, and 70% (v / v) ethanol, 5 minutes each, followed by rinsing with distilled water for 1 minute to complete hydration. The target region was then delineated in the center of the section using a histochemical pen. The section was placed in a humidified chamber and incubated with pure water at 37°C for 2 hours. After incubation, the pure water was discarded, and pre-prepared TRAP staining working solution was added. The section was incubated at 37°C in the dark for 30 minutes. After staining, the sections were counterstained with hematoxylin for approximately 3 minutes. They were then rinsed with tap water, briefly differentiated (for a few seconds), rinsed again, and then blued and thoroughly rinsed with running water. The dehydration steps were as follows: soaking in 75% ethanol for 5 minutes, 85% ethanol for 5 minutes, and anhydrous ethanol for 5 minutes, then replacing with fresh anhydrous ethanol and soaking for another 5 minutes to complete the dehydration process. After dehydration, the sections were treated in xylene for 5 minutes to achieve transparency. The sections were then removed and allowed to dry slightly, carefully mounted with neutral resin, and then placed under a microscope for careful observation and image acquisition.
[0029] The results are as follows Figure 5As shown: Numerous deep red-stained osteoclasts were observed in femoral sections from mice in the OVX group, with a significantly increased number of osteoclasts and a significantly higher percentage of bone surface area (Oc.S / BS) compared to the Sham group. In contrast, the OVX+IPA group showed a significantly reduced number of positively stained osteoclasts, decreased osteoclast coverage on the bone surface, and a reduced degree of bone resorption. Consistent with this, the immunofluorescence results of the osteoclast functional indicator cathepsin K (CTSK) were as follows... Figure 6 As shown, CTSK expression levels were elevated in bone tissue of the OVX group, while CTSK positive signals were significantly reduced after IPA treatment, approaching the levels of the normal control. These results indicate that IPA intervention can inhibit excessive osteoclast formation and bone resorption activity induced by ovariectomy in mice, thereby promoting bone formation while reducing bone loss.
[0030] Example 3: Constructing an Expression fldAIBC Clostridium coli shuttle vector with gene cluster (1) Can transcribe fldAIBC Construction method of recombinant plasmid pMTL82151-thl First, the thl gene was amplified using primers thl-Xbal-F and thl-XhoI-R. Then, the PCR amplification product of the thl gene was double-digested with the pMTL82151 vector (GenScript Biotech Inc.) using XbaI and XhoI restriction endonucleases. The digestion products were recovered, and the thl gene was ligated to plasmid pMT82151 to obtain plasmid pMTL82151-thl. Next, the structural gene sequence of the IPA biosynthetic enzyme (phenyllactic acid dehydratase gene cluster fldAIBC) from Clostridium sporogenes (Genewiz Biotech Ltd.) was used to promote the expression of multiple synthases in the IPA biosynthetic pathway, thereby producing IPA. Then, the pMTL82151-thl plasmid was digested with XbaI and XhoI, and the digestion products were recovered and ligated to fldAIBC. The structural gene fragment of the IPA biosynthetic enzyme was then inserted into the pMTL82151-thl plasmid, generating the recombinant plasmid pMTL82151-fldAIBC (e.g. Figure 7 (As shown).
[0031] (2) Plasmid double enzyme digestion electrophoresis a) Double enzyme digestion reaction: First, take 1-2 µg of recombinant plasmid pMTL82151-fldAIBC. Based on the characteristics of the plasmid, select XbaI and XhoI restriction endonucleases for double digestion. Add the restriction endonucleases and reaction buffer to the plasmid sample, making up to 50 μL. Incubate the reaction at 37 °C for 1-2 hours to ensure complete digestion.
[0032] b) Termination of enzyme digestion: After the enzyme digestion reaction was completed, 1 μL of 0.5 M EDTA was added to terminate the reaction, and the reaction was incubated at 65 °C for 10 minutes to inactivate the enzyme.
[0033] c) Agarose gel electrophoresis: The products after the enzyme digestion reaction was terminated were subjected to electrophoresis on a 0.8% agarose gel (90–120 V, 30–60 min) and observed under UV transilluminator. The results are as follows: Figure 8 As shown, two clear bands appeared at approximately 4kb and 5kb, corresponding to the fldAIBC target fragment (≈4395bp) and the pMTL82151-thl vector backbone (≈5392bp), respectively. Compared with the undigested control, the appearance of the new bands indicates that the recombinant shuttle plasmid carrying the fldAIBC gene cluster has been successfully constructed, laying the foundation for the subsequent construction of engineered strains.
[0034] d) Staining and Imaging: After electrophoresis, the gel was stained with a dye containing ethidium bromide (EB) or SYBR Green. Following staining, the gel was observed and photographed under ultraviolet light to detect the DNA bands after enzyme digestion. The position, size, and number of bands were compared with the DNA marker to determine whether the plasmid was digested correctly as expected, further confirming the successful construction of the recombinant plasmid.
[0035] Example 4: Introduction of recombinant plasmid pMTL82151-fldAIBC into engineered bacteria The recombinant plasmid pMTL82151-fldAIBC constructed in Example 3 was introduced into Clostridium sporogenes ( Clostridium sporogenesIn a study conducted by Baosai Biotechnology Co., Ltd., an engineered strain capable of overexpressing IPA synthase was obtained. Specifically, the recombinant plasmid pMTL82151-fldAIBC was first introduced into the Escherichia coli donor strain CA434 (Baosai Biotechnology Co., Ltd.) via heat shock transformation. Positive clones carrying the target plasmid were then screened on LB agar plates containing chloramphenicol. These positive clones were then mixed with Clostridium sporogenes recipient bacteria as donor and recipient cultures, plated on reinforced Clostridium tumefaciens (RCM) plates, and co-cultured anaerobicly at 37°C to allow the recombinant plasmid pMTL82151-fldAIBC to be transferred into Clostridium sporogenes via inter-bacterial cross-linking. After 8 hours of co-culture, the culture was plated on RCM selection plates containing chloramphenicol. After 48 hours of anaerobic culture, single colonies exhibiting resistant growth were picked and further amplified to obtain engineered Clostridium sporogenes carrying the recombinant plasmid pMTL82151-fldAIBC. The resulting engineered strain was named *Clostridium sporogenes*, a high-yield strain of indole-3-propionic acid (referred to as engineered strain IPA CS).
[0036] Example 5: Verification of the activity of engineered bacteria IPA CS and the level of IPA upregulation Transmission electron microscopy was used to observe the bacterial morphology of IPA CS, and nanoparticle size distribution and zeta potential were characterized using nanoparticle size and zeta potential analyzers. Results are as follows: Figures 9-10 As shown: Electron microscopy results showed that the morphology of IPA CS was basically the same as that of CS, both being rod-shaped and similar in size; dynamic light scattering analysis showed that the particle size distribution and Zeta potential of IPA CS and CS bacterial suspensions were similar, with no significant difference. IPA CS was statically cultured in RCM containing chloramphenicol (15 µg / mL) and CS in RCM without chloramphenicol at 37℃. The absorbance of the bacterial cultures was measured at 600 nm using a UV spectrophotometer to evaluate the effect of engineering treatment on bacterial growth. The results are as follows. Figure 11 As shown, the growth curves of IPA CS and CS almost overlapped, with no significant changes in parameters such as growth rate and stasis period duration. These results indicate that the engineered treatment introducing the fldAIBC gene cluster did not affect the growth capacity and strain morphology of Clostridium sporogenes, and IPA CS achieved a significant increase in IPA yield while maintaining normal biological characteristics.
[0037] To determine IPA production, bacterial samples stored at -80 °C were first transferred to RCM containing chloramphenicol (15 µg / mL) and incubated anaerobically at 37 °C for 24 hours. After incubation, the culture medium was centrifuged at 12,000 rpm for 10 minutes, and the bacterial supernatant was collected and filtered through a 0.2 μm filter membrane to obtain the filtrate. Then, high-performance liquid chromatography (HPLC) was used to quantitatively analyze the IPA in the filtrate. The HPLC detection conditions were: separation using a mixed solution of 20% acetonitrile and 80% 0.1% trifluoroacetic acid, a linear program, an analysis time of 25 minutes, and a flow rate of 1.0 mL / min. The IPA content (μg / mL) was quantitatively analyzed by comparing the peak height (λmax 280 nm) or peak area of the sample with the control value of the standard. The results are shown below. Figure 12 As shown: there was no significant difference in IPA content in the supernatant of the two strains at the beginning of culture; after 24 hours of culture, the IPA concentration in the supernatant of the IPA CS strain was significantly higher than that of the wild-type CS strain, indicating that the engineered strain has a stronger IPA synthesis and secretion capacity.
[0038] Example 6: The in vivo regulatory effect of engineered Clostridium sporogenes on bone homeostasis and its biosafety Ovulation-free (OVX) model was established in female mice through bilateral ovariectomy (method as in Example 1). One week later, different treatments were administered. The OVX model mice were divided into three groups (n=6 per group): the OVX control group was administered an equal volume of PBS buffer by gavage; the OVX+CS group was administered wild-type Clostridium sporogenes (CS) by gavage; and the OVX+IPA CS group was administered engineered Clostridium sporogenes (IPA CS) by gavage. The dose of bacterial solution administered by gavage was 1×10⁻⁶. 9 CFU / 200μL, once daily, for 8 consecutive weeks. After treatment, Micro-CT scans and histological analyses were performed on the distal femur of mice in each group, and relevant indicators in serum, bone marrow, and colon tissue were detected. Multiple organs, including heart, liver, spleen, lung, and kidney, were collected for HE staining to test the biosafety of IPA CS.
[0039] Mouse distal femur Micro-CT 3D reconstruction image as follows Figure 13 As shown: OVX group mice exhibited extensive trabecular bone fracture and loss, resulting in a significant decrease in bone mass. After CS treatment (OVX+CS group), trabecular bone structure improved somewhat, while OVX mice treated with IPA CS (OVX+IPA CS group) showed more significant trabecular bone structure recovery, with superior trabecular bone density and continuity compared to the OVX+CS group. Further quantitative analysis of bone structure parameters is as follows... Figure 14As shown, compared with the OVX control group, the OVX+CS group showed improvements in femoral bone mineral density (BMD), bone volume fraction (BV / TV), and trabecular bone thickness (Tb.Th), with the OVX+IPA CS group exhibiting even more significant improvements in these bone parameters (the differences were statistically significant). This indicates that engineered Clostridium sporogenes IPA CS significantly alleviated bone loss induced by oophorectomy in vivo.
[0040] Histological examination further confirmed the results of the Micro-CT scan, and the H&E staining results were as follows: Figure 15 As shown: Under H&E staining, the trabecular bone structure in the distal femur of mice in the OVX group was sparse, while the trabecular bone area in the OVX+IPA CS group was significantly increased and the structure was more compact; compared with the OVX+CS group, the IPA CS treatment group had more osteoblasts in the trabecular bone and more active new bone formation. TRAP staining results are shown below. Figure 16 As shown, the OVX group exhibited a large number of red-stained osteoclasts in its bone tissue, with a high proportion of bone surface area adsorbed by osteoclasts. After IPA CS intervention, the number of osteoclasts decreased significantly, and signs of bone resorption were greatly reduced. The Oc.S / BS ratio was not only lower than that of the OVX group but also significantly lower than that of the group treated with CS alone. This demonstrates that the engineered bacteria IPA CS can promote bone formation and inhibit bone resorption in OVX mice, providing histomorphological evidence of its dual regulatory effect on bone homeostasis.
[0041] Furthermore, this embodiment also investigated the effects of engineered bacterial treatment on IPA levels and intestinal health in OVX mice. Compared with the PBS control group, oral administration of either CS or IPA CS increased IPA levels in the serum and bone marrow of OVX mice, with the IPA CS group showing the greatest increase: ELISA results showed that the serum IPA concentration was approximately four times that of the control group, and the bone marrow IPA level also increased significantly. Figure 17 The results showed that the colonized engineered strains could continuously release IPA in vivo, thereby effectively improving IPA deficiency caused by ovarian dysfunction. The specific procedure of the enzyme-linked immunosorbent assay (ELISA) was as follows: a) Mouse serum collection: After anesthetizing mice, blood samples were obtained via ocular sampling. The collected blood was allowed to stand at room temperature for 1 hour to allow for natural coagulation. Subsequently, the samples were centrifuged at 4 ℃ and 3000 rpm for 10 minutes. After centrifugation, the supernatant serum was carefully transferred to a new centrifuge tube. The serum can be diluted and added as needed for the experiment, or stored directly at -80 ℃ for later use. b) Mouse bone marrow collection: After euthanasia, the femur or tibia was removed, and the attached soft tissue was cleaned. Under aseptic conditions, an appropriate amount of PBS buffer was injected into the bone marrow cavity using a syringe or pipette, and the cavity was gently flushed to collect the bone marrow cell suspension. The collected bone marrow fluid was mixed by repeated pipetting or gentle vortexing to ensure complete cell release. The collected bone marrow cell suspension was centrifuged at 4 ℃ and 3000 rpm for 10 minutes to remove cell debris and impurities. The supernatant was collected and transferred to a new centrifuge tube for immediate ELISA detection or storage at -80 ℃ for later use. c) Mouse colon tissue collection: After euthanasia of mice, colon tissue was quickly removed and washed with ice-cold PBS to remove any residue in the intestinal lumen. Excess liquid was blotted dry with filter paper, and an appropriate amount of tissue (usually 50-100 mg) was weighed and placed in a pre-chilled EP tube. An appropriate amount of lysis buffer (such as PBS or RIPA with added protease inhibitors) was added to the colon tissue at a ratio of 1:9 (tissue weight: buffer volume). The tissue was homogenized thoroughly on ice using a tissue homogenizer or ultrasonic cell disruptor to ensure complete tissue disruption and release of proteins. The homogenate was centrifuged at 4 ℃ and 3000 rpm for 10-15 minutes. After centrifugation, the supernatant was carefully collected, avoiding disturbance of the precipitate. The supernatant was transferred to a new sterile centrifuge tube for later use or storage at -80 ℃. d) ELISA Procedure: Follow the instructions for the Indolepropionic Acid (IPA) ELISA kit (Abogen Biosciences, #CB11098-Mu). First, add 50 μL of standard or test sample to each well of the ELISA plate, followed by 50 μL of substrate A diluted according to the instructions. Cover the well with the sealing film after mixing thoroughly, and incubate at 37 ℃ for 60 minutes. After incubation, discard the reaction solution, add 350 μL of washing buffer to each well, let stand for 30 seconds, then discard. Repeat washing 3 times to ensure no residual liquid remains in the wells. Next, add 100 μL of pre-diluted detection antibody (solution B) to each well and incubate at 37 ℃ for another 30 minutes. After incubation, repeat the washing process 5 times. Add 90 μL of TMB substrate solution to each well and incubate at 37 ℃ in the dark for 10 minutes. After color development, add 50 μL of stop solution to each well to terminate the reaction. Immediately use an ELISA reader to measure the absorbance (OD value) of each well at a wavelength of 450 nm.
[0042] Considering that estrogen deficiency is often accompanied by intestinal inflammation and barrier dysfunction, this embodiment simultaneously evaluated the biosafety of the engineered bacteria and its impact on the host gut. The results of colonic tissue pathological analysis are as follows: Figure 18As shown: In the OVX group, the colonic mucosal epithelial integrity of mice was disrupted, with partial loss of crypt structures and extensive inflammatory cell infiltration; while after treatment with CS or IPA CS, the inflammatory damage in the colonic tissue of mice was reduced, with the IPA CS group showing the best recovery of mucosal structure and the least inflammatory cell infiltration. Further measurement of the levels of inflammatory factors in the colonic tissue yielded the following results: Figure 19 As shown: the levels of IL-1β, TNF-α, and IL-6 in the colon homogenate of OVX group mice were significantly increased; in contrast, CS treatment could reduce the levels of the above-mentioned inflammatory cytokines, with the IPA CS group showing a more significant reduction, almost approaching the level of the sham-operated control. This indicates that engineered bacteria treatment effectively alleviated the intestinal inflammatory response in OVX mice while improving bone quality. Meanwhile, the results of intestinal barrier function index detection are as follows... Figure 20 As shown, the expression of tight junction proteins ZO-1 and Occludin in the colon tissue of mice in the OVX group was significantly decreased, indicating increased intestinal barrier permeability. After intervention with CS or IPA CS, the expression of both tight junction proteins in the intestinal epithelium was significantly increased, with the IPA CS group showing the most significant recovery. This indicates that engineered Clostridium sporogenes treatment can enhance the damaged intestinal barrier function without causing adverse effects on the host intestine, demonstrating good biosafety.
[0043] To further evaluate the systemic safety of engineered Clostridium perfringens IPA CS, routine histological examinations of major organs in mice were performed at week 8 after drug withdrawal. Specifically, mice were sacrificed after drug withdrawal, and the heart, liver, spleen, lungs, and kidneys were isolated, fixed in 4% paraformaldehyde for 24 hours, routinely dehydrated, embedded in paraffin, and sectioned (5 μm thick). Subsequently, the sections were dewaxed in xylene, rehydrated with graded ethanol, and stained with hematoxylin and eosin (H&E). The sections were observed and photographed under a light microscope (×200). Results are as follows: Figure 21 As shown: In the IPA CS treatment group, the parenchymal structure of each organ was intact: the myocardial fibers were regularly arranged, the hepatic cord structure was clear, and there were no fatty degeneration or necrotic foci; the spleen corpuscles were normal in morphology, and the white and red pulp regions were clear; the alveolar walls were thin and no inflammatory cell infiltration was observed; the glomeruli and renal tubules were normal in morphology, and no luminal dilatation or protein casts were observed. Compared with the control group, no obvious pathological changes such as inflammatory cell infiltration, hemorrhage, necrosis or fibrosis were observed in any tissue, suggesting that the engineered Clostridium sporogenes has good biosafety with long-term oral gavage.
[0044] In summary, the experimental results from the above embodiments demonstrate that increasing in vivo IPA levels can promote osteogenic differentiation and inhibit osteoclast formation, thereby correcting the bone mass imbalance in the postmenopausal osteoporosis model. Utilizing engineered Clostridium sporogenes IPA CS to colonize the intestine and continuously synthesize IPA can significantly improve bone loss and impaired intestinal barrier function in OVX mice, demonstrating both therapeutic effects and good safety profile.
[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. An engineered Clostridium sporogenes species that produces high levels of indole-3-propionic acid, characterized in that: The engineered Clostridium sporogenes is an engineered Clostridium sporogenes carrying the recombinant plasmid pMTL82151-fldAIBC.
2. A method for preparing the engineered Clostridium sporogenes with high indole-3-propionic acid production as described in claim 1, characterized in that, Includes the following steps: S1. Vector construction: Using the Clostridium coli shuttle vector pMTL82151 as the backbone, the thl gene was amplified using thl-Xbal-F and thl-XhoI-R primers. The thl gene amplification product was then ligated with pMTL82151 by enzyme digestion to obtain plasmid pMTL82151-thl. S2. Preparation of recombinant plasmid: The fldAIBC structural gene fragment is inserted into the multiple cloning site of plasmid pMTL82151-thl to obtain the recombinant plasmid pMTL82151-fldAIBC, which can transcribe fldAIBC in Clostridium sporogenes. It contains both the pMB1 origin of replication and the repH origin of replication, and carries the chloramphenicol acetyltransferase resistance gene for dual-host selection. S3. Introduce the recombinant plasmid into the host Clostridium sporogenes and screen and identify it: The recombinant plasmid pMTL82151-fldAIBC is introduced into the target Clostridium sporogenes strain using heat shock transformation and / or conjugate transfer methods; transformants are screened in anaerobic medium containing the corresponding antibiotics, and the presence of the fldAIBC gene is confirmed by detection and the expression level is at least 2 times that of the original. Engineered Clostridium sporogenes with IPA production of 2 times or more and stable production are screened, namely engineered strain IPA CS.
3. The method for preparing engineered Clostridium sporogenes with high indole-3-propionic acid production according to claim 2, characterized in that, The restriction endonucleases used in step S1 for enzyme digestion and ligation are XbaI and XhoI.
4. The method for preparing the engineered Clostridium sporogenes with high indole-3-propionic acid production according to claim 2, characterized in that, The nucleotide sequence of the recombinant plasmid pMTL82151-fldAIBC is shown in SEQ ID NO.1, the nucleotide sequence of the thl gene is shown in SEQ ID NO.2, the nucleotide sequences of the thl-XbaI-F and thl-XhoI-R primers are shown in SEQ ID NO.3-SEQ ID NO.4, and the fldAIBC structural gene fragment is a codon-optimized fldAIBC open reading frame, the nucleotide sequence of which is shown in SEQ ID NO.
5.
5. The method for preparing engineered Clostridium sporogenes with high indole-3-propionic acid production according to claim 2, characterized in that, In step S2, the fldAIBC structural gene fragment is inserted into the multiple cloning site of plasmid pMTL82151-thl using the Gibson isothermal assembly method.
6. The method for preparing the engineered Clostridium sporogenes with high indole-3-propionic acid production according to claim 2, characterized in that, In step S3, the heat shock transformation conditions were 42℃ for 90 seconds, followed by an ice bath for 5 minutes, and then recovery at 37℃ under anaerobic conditions for 1 hour. The conjugate transfer process involved mixing the *E. coli* donor carrying pMTL82151-thl with *Clostridium sporogenes* recipient bacteria at a volume ratio of 1:1, incubating with a filter membrane for 6-8 hours, and then transferring to an anaerobic plate containing chloramphenicol to complete the transfer. Screening and identification were performed using a modified RCM anaerobic medium containing 15 µg / mL chloramphenicol. After confirming the fldAIBC gene positivity by colony PCR, HPLC was used to detect the IPA production of the engineered strain within 24 hours. The morphology, particle size distribution, zeta potential, and OD of the engineered strain were also analyzed. 600 Growth curve characterization and control comparison.
7. The method for preparing the engineered Clostridium sporogenes with high indole-3-propionic acid production according to claim 2, characterized in that, The host Clostridium is Clostridium sporogenes Or derived strains obtained through mutagenesis / gene knockout / insertion.
8. The use of the engineered Clostridium sporogenes of claim 1, which produces high levels of indole-3-propionic acid, in the preparation of products that inhibit bone resorption.
9. The use of the engineered Clostridium sporogenes of claim 1, which produces high levels of indole-3-propionic acid, in the preparation of products that promote bone formation.
10. The use of the engineered Clostridium sporogenes of claim 1, which produces high levels of indole-3-propionic acid, in the preparation of products for treating osteoporosis.