Primer group and kit for rapidly detecting consanguinity of different segments of chromosome 1 of saccharum arundinaceum in sugarcane and application of primer group and kit

Abstract

The invention provides a primer group and a kit for rapidly detecting consanguinity of different segments of a chromosome 1 of saccharum arundinaceum in sugarcane and application of the primer group and the kit, and belongs to the technical field of molecular biology. The primer group provided by the invention comprises 17 pairs of primers, and the specific sequences of the primers are shown as Seq1 to Seq34. The characteristics of high sensitivity of a PCR detection method, excellent amplification performance of a rapid PCR mixed solution and the like are integrated, at least one pair of primer group is included in each 30Mb of the saccharum arundinaceum chromosome 1, and whether the saccharum arundinaceum and saccharum arundinaceum filial generation contains consanguinity of different segments of the saccharum arundinaceum chromosome 1 can be simply, rapidly and accurately detected or identified.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, and in particular to a primer set, reagent kit, and application for rapid detection of bloodlines in different segments of chromosome 1 of Imperata cylindrica in sugarcane. Background Technology

[0002] Sugarcane (Saccharum spp.) is an important sugar crop in my country, and maintaining sugar security is crucial to the national economy and people's livelihood. However, the narrow genetic background of modern sugarcane cultivars severely limits the efficiency of their genetic improvement. Introducing superior traits from wild germplasm resources is one of the important ways to improve sugarcane varieties. Tripidium arundinaceum, with its characteristics of high tillering, disease resistance, and drought resistance, has become a widely used wild germplasm for sugarcane genetic improvement in recent years, with the hope of integrating its beneficial traits into sugarcane through hybridization. However, the precise chromosomal segments of Tripidium arundinaceum chromosomes that have infiltrated into the sugarcane genetic background remain unclear.

[0003] Molecular markers can visualize the genomic structure of individuals or populations, reflecting genetic diversity and variability at the deoxyribonucleic acid (DNA) level. DNA molecular marker technology is simple to implement, highly efficient, and unaffected by tissue location, developmental stage, season, climate, or environment. It is a highly efficient technique for assessing the genetic diversity of germplasm resources and has been widely applied in research fields such as crop germplasm resource screening, genetic polymorphism analysis, and the localization of resistance genes. Using the Sichuan mulberry genome as a reference, Shuai Qin et al. successfully developed 110 pairs of structural variation markers for mulberry using resequencing data from two mulberry varieties, Lunjiao 109 and Pearl White, and identified 169 polymorphic loci. Guo Xiaojiao et al. used QTL (quantitative trait locus) mapping to discover that different chromosome numbers contribute differently to panicle length in rice. In wheat, Qiu et al. also found the influence of different chromosome translocation lines on the superior quality of wheat. Therefore, different chromosome numbers carry different genes, resulting in significant differences in their phenotypic effects on crops. Based on previous work in bioinformatics, this invention patent designs chromosome segment-specific primers according to the specific sequence of chromosome 1 of *Imperata cylindrica*. By combining the high sensitivity of PCR detection methods with the excellent amplification performance of rapid PCR mixtures, a rapid detection kit and detection method have been developed to identify the bloodline of different segments of chromosome 1 in the offspring of sugarcane-*Imperata cylindrica* hybrids. This invention aims to provide technical support for basic research on bloodline identification of hybrids of wild *Imperata cylindrica* introduced to sugarcane in my country and on chromosome structural variations in *Imperata cylindrica*. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a primer set, a kit, and their applications for rapid detection of bloodlines in different segments of chromosome 1 of *Imperata cylindrica* in sugarcane. The primer set provided by this invention has the advantages of high sensitivity, strong specificity, low cost, and simplicity and speed, and can be used for bloodline identification and high-throughput rapid detection of different segments of chromosome 1 of *Imperata cylindrica* in the offspring of sugarcane and *Imperata cylindrica* hybrids.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] A primer set for rapid detection of chromosome 1 lineage in sugarcane, comprising 17 pairs of primers, the specific sequences of which are shown in Seq_1 to Seq_34.

[0007] In this invention, the names and specific nucleotide sequences of the 17 primer pairs are as follows:

[0008] (1)Chr01A_6309234_6309383:

[0009] Seq_1: 5'-TGATAATGTCATCCGGGTCTTCAA-3';

[0010] Seq_2: 5'-CCATGTCATGTCAGCAGATGGA-3';

[0011] (2)Chr01A_29100625_29100774:

[0012] Seq_3: 5'-GTGTTATGCCAGAGGTTACTTGAG-3';

[0013] Seq_4: 5'-TGGAATTGCTTACTGTGTCGTTTAT-3';

[0014] (3)Chr01A_35620361_35620510:

[0015] Seq_5: 5'-AGATATGGCCTTAGGAAGTGGAGTA-3';

[0016] Seq_6: 5'-TTGATCAGGTTTCTCAAGTTCACC-3';

[0017] (4)Chr01A_38078118_38078267Seq_7: 5'-CGGTTGTAGATGAGTTGATTGATGAA-3'; Seq_8: 5'-CCAAGAACTCGTAAAGACCATCAT-3';

[0018] (5)Chr01A_51207711_51207860:

[0019] Seq_9:5’-ACAAACTAACCTACCTATCTTATCGC-3’;

[0020] Seq_10:5’-TGGAATTAAATCGACCTTGATCTGT-3’;

[0021] (6)Chr01A_51592605_51592754:

[0022] Seq_11:5’-ATTCGCCACAACCCTATCCAATC-3’;

[0023] Seq_12:5’-AATAGTGCATGGATAAATTTCAGGAGG-3’;

[0024] (7)Chr01A_51961977_51962126:

[0025] Seq_13:5’-ACGATCTTCTCTGAGCTCAATGA-3’;

[0026] Seq_14:5’-AGCGAGACTATGAGATCACTTGT-3’;

[0027] (8)Chr01A_69208108_69208257:

[0028] Seq_15:5’-ACCTTATGTACAGACCTCTATTGCA-3’;

[0029] Seq_16:5’-GGAAGACTGGATGCACTGATGTA-3’;

[0030] (9)Chr01A_73704494_73704643:

[0031] Seq_17:5’-ATACAAGTGAAAGTCTGCATCTATGTC-3’;Seq_18:5’-GGCCAATGACTCCGCATACATAA-3’;

[0032] (10)Chr01A_82241097_82241246:

[0033] Seq_19:5’-CAGTCCAGTGGTCCATTGATACG-3’;

[0034] Seq_20:5’-CGAGTAGAAGGCTCCATCAACAT-3’;

[0035] (11)Chr01A_90688190_90688339:

[0036] Seq_21:5’-TCAACCATACTGAAGAACGACCA-3’;

[0037] Seq_22:5’-TTGCATGCATTGGTTGAATTCCT-3’;

[0038] (12)Chr01A_99327500_99327649:

[0039] Seq_23:5’-TGTTAGTTGGCAGTCTTCAATTTGA-3’;

[0040] Seq_24:5’-GCCAATAGTGCTTGTGTCCATAC-3’;

[0041] (13)Chr01A_104821755_104821904:Seq_25:5’-TGGACGAAATCAACTAAGTACATGTG-3’;Seq_26:5’-GCCAAGCTATGACACTGTAAATACC-3’;

[0042] (14)Chr01A_114344909_114345058:

[0043] Seq_27:5’-AGCTTCTCTATTGATTTGTGTGCTT-3’;

[0044] Seq_28:5’-GGATAATTGTACTGCCACACTTGTT-3’;

[0045] (15)Chr01A_114734439_114734588:

[0046] Seq_29:5’-ACGATTGTGTTGATTCATCTTACCT-3’;

[0047] Seq_30:5’-TACTCTCACGACTCAGGAATGG-3’;

[0048] (16)Chr01A_124420248_124420397:

[0049] Seq_31:5’-AGAGATGGAGTGTGGTAGATTAAGT-3’;

[0050] Seq_32:5’-AATCTACCTGAACTCTCCAAGGC-3’;

[0051] (17)Chr01A_130367979_130368128:

[0052] Seq_33:5’-ATTAAGTTTGATGTATAGTCTACGTGGTTG-3’;

[0053] Seq_34:5’-CTCATAACGTTCATTAATCAACAGGCA-3’。

[0054] In this invention, the amplification products of primer pair (1) correspond to the position of chromosome 1 of *Imperata cylindrica* 6309234_6309383; the amplification products of primer pair (2) correspond to the position of chromosome 1 of *Imperata cylindrica* 29100625_29100774; the amplification products of primer pair (3) correspond to the position of chromosome 1 of *Imperata cylindrica* 35620361_35620510; the amplification products of primer pair (4) correspond to the position of chromosome 1 of *Imperata cylindrica* 38078118_38078267; the amplification products of primer pair (5) correspond to the position of chromosome 1 of *Imperata cylindrica* 38078118_38078267; The position of chromosome 1 of *Imperata cylindrica* is 51207711_51207860; the position of the amplification product of primer pair (6) corresponding to chromosome 1 of *Imperata cylindrica* is 51592605_51592754; the position of the amplification product of primer pair (7) corresponding to chromosome 1 of *Imperata cylindrica* is 51961977_51962126; the position of the amplification product of primer pair (8) corresponding to chromosome 1 of *Imperata cylindrica* is 69208108_69208257; the position of the amplification product of primer pair (9) corresponding to chromosome 1 of *Imperata cylindrica* is 7370. 4494_73704643; the amplification product of primer pair (10) corresponds to the position of chromosome 1 of *Imperata cylindrica* 82241097_82241246; the amplification product of primer pair (11) corresponds to the position of chromosome 1 of *Imperata cylindrica* 90688190_90688339; the amplification product of primer pair (12) corresponds to the position of chromosome 1 of *Imperata cylindrica* 99327500_99327649; the amplification product of primer pair (13) corresponds to the position of chromosome 1 of *Imperata cylindrica* 104821755_104821 904; the amplification product of primer pair (14) corresponds to the position of chromosome 1 of *Imperata cylindrica* 114344909_114345058; the amplification product of primer pair (15) corresponds to the position of chromosome 1 of *Imperata cylindrica* 114734439_114734588; the amplification product of primer pair (16) corresponds to the position of chromosome 1 of *Imperata cylindrica* 124420248_124420397; the amplification product of primer pair (17) corresponds to the position of chromosome 1 of *Imperata cylindrica* 130367979_130368128.

[0055] In this invention, the amplification products of the 17 primer pairs are preferably 146bp to 150bp in size.

[0056] This invention also provides a kit for rapid detection of bloodlines in different segments of chromosome 1 in sugarcane, comprising the primer set described above for rapid detection of bloodlines in different segments of chromosome 1 in sugarcane.

[0057] In this invention, the kit preferably also includes reagents for PCR.

[0058] In this invention, the PCR reagents preferably include Rapid Taq Master Mix and ddH2O.

[0059] In this invention, the kit preferably includes negative sample DNA and positive sample DNA; the negative sample DNA is preferably sugarcane leaf DNA without the bloodline of Imperata cylindrica; more preferably, it is sugarcane leaf DNA of Badila, LA-Purple, Np-X, SES208, Zhongzhe No. 1 and Xintai Sugar No. 22; the positive sample DNA is preferably sugarcane leaf DNA containing the bloodline of Imperata cylindrica No. 1 chromosome; more preferably, it is sugarcane leaf DNA of Hainan 92-77, Yunnan 2012-3 and Yacheng 05-164.

[0060] The present invention also provides an application of the primer set or reagent kit described in the above technical solutions, preferably including the following applications:

[0061] (1) Detection or auxiliary detection of bloodline in different segments of chromosome 1 of Imperata cylindrica in sugarcane;

[0062] (2) Prepare products for detecting or assisting in the detection of bloodlines in different segments of chromosome 1 of Imperata cylindrica in sugarcane;

[0063] (3) Assisting in sugarcane breeding;

[0064] (4) Prepare products to assist in sugarcane breeding.

[0065] This invention also provides a method for rapidly detecting bloodlines of different segments of chromosome 1 in sugarcane, comprising the following steps: extracting genomic DNA from the sugarcane material to be tested; performing PCR amplification on the extracted genomic DNA using the primer set or kit described in the above technical solution; and determining whether different segments of chromosome 1 are present in the sugarcane material to be tested based on the electrophoresis results of the PCR amplification products.

[0066] In this invention, the preferred criterion for judgment is: if a specific band appears on the gel, it can be determined that the sugarcane material to be tested contains different segments of chromosome 1 of the 'Pissula ovata' chromosome; otherwise, it does not contain chromosome 1 of the 'Pissula ovata' chromosome. The specific bands of the amplification products of each primer pair appear at the position of 146bp to 150bp.

[0067] In this invention, the PCR reaction system is preferably prepared as one reaction system for each primer pair: each 25 μL reaction system contains 12.5 μL of 2×Rapid Taq Master Mix, 2.5 μL of 50 ng / μL DNA template, 2.5 μL each of 10 μM upstream and downstream primers, and the remainder is ddH2O.

[0068] In this invention, the preferred PCR amplification program is: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 60°C annealing for 20 s, 72°C extension for 15 s, 32 cycles; 72°C final extension for 3 min; and storage at 12°C.

[0069] Beneficial Technical Effects: This invention provides a primer set, kit, and application for rapid detection of bloodlines in different segments of chromosome 1 of *Imperata cylindrica* in sugarcane. The primer set includes 17 pairs of primers, with specific sequences shown in Seq_1 to Seq_34. This invention combines the high sensitivity of PCR detection methods with the excellent amplification performance of rapid PCR mixtures. It contains at least one primer pair per 30Mb segment of chromosome 1 of *Imperata cylindrica*, enabling simple, rapid, and accurate detection or identification of whether different segments of chromosome 1 of *Imperata cylindrica* are present in the offspring of sugarcane-*Imperata cylindrica* hybrids. Attached Figure Description

[0070] Figure 1 Electrophoresis images for bloodline identification of different segments of chromosome 1 of Banmao No. 1. In the images, M is the relative molecular mass of 100bp DNA gradient standard, 1 is nuclease-free sterile water, 2-7 are sugarcane leaf samples of Baldila, LA-Purple, Np-X, SES208, Zhongzhe No. 1 and ROC22 respectively, and 8-10 are sugarcane leaf samples of Hainan 92-77, Yunnan 2012-3 and Yacheng 05-164 respectively.

[0071] Figure 2 Electrophoretic images of different segments of chromosome 1 in Yacheng 01-92 and Yacheng 01-36 materials were obtained by detecting blood relations using 17 primer pairs. Detailed Implementation

[0072] To better understand the present invention, the following embodiments further illustrate the content of the present invention, but the content of the present invention is not limited to the following embodiments. Unless otherwise specified, the materials, reagents, etc., used in the embodiments and experimental examples of the present invention can be obtained commercially; unless otherwise specified, the methods used in the embodiments and experimental examples of the present invention are conventional methods.

[0073] The main reagents used in this invention are as follows: (All chemical reagents are of analytical grade)

[0074] 1. CTAB extraction buffer: 100mM Tris-HCl (pH=8.0), 20mM EDTA-Na2, 1.4M NaCl, 2% CTAB (w / v), add 0.1% β-mercaptoethanol (w / v) before use;

[0075] 2. 1×TAE buffer: 242g Tris, 37.2g EDTA-Na2, 57.1mL glacial acetic acid, add pure water to make up to 1L;

[0076] 3. PCR amplification reagents were purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0077] The main instruments used in this invention are as follows:

[0078] 1. PCR Amplification Instrument: Singapore T100TM Thermal Cycler PCR Amplification Instrument;

[0079] 2. Electrophoresis apparatus: DYY-6C electrophoresis apparatus from Beijing Liuyi Biotechnology Co., Ltd.;

[0080] 3. Centrifuge: Heraeus Pico 17 high-speed centrifuge from Germany;

[0081] 4. Gel Imaging System: Omega Fluor plus gel imaging system (USA);

[0082] 5. Spectrophotometer: Mona (Suzhou) Biotechnology Co., Ltd. Eva 3200 Ultra-micro Nucleic Acid and Protein Detector.

[0083] The sampling information of this invention is shown in Table 1.

[0084] Table 1 Sampling Information

[0085]

[0086] Example 1

[0087] 1. Total DNA extraction from sugarcane leaves

[0088] (1) Prepare tools: Clean and disinfect the mortar and scissors. The scissors are disinfected with 75% alcohol, while the mortar is disinfected by burning with anhydrous ethanol. After that, place them on ice to cool before use.

[0089] (2) Sample processing: Fresh and healthy young leaves of seedlings of Badila, LA-Purple, Np-X, SES208, Zhongzhe No. 1, Xintai Sugar No. 22 (ROC22), Hainan 92-77, Yunnan 2012-3 and Yacheng 05-164 planted in the planting resource nursery of Guangxi University Fusui Base were selected. The leaf surface was disinfected by wiping with 75% alcohol cotton balls. After removing the leaf veins, the leaves were chopped and placed in a pre-cooled mortar. Liquid nitrogen was poured in and the leaves were quickly ground into fine powder. Generally, the best time is when the color changes from dark green to light green and white. The powder was placed in a 2mL centrifuge tube, which occupies about 1 / 3 of the tube volume.

[0090] (3) Cell lysis: The prepared 2×CTAB was preheated in a water bath at 65°C for 30 minutes. 900 μL of the preheated CTAB extract and 100 μL of anhydrous ethanol were added to the powder. The mixture was quickly shaken and mixed. The mixture was then placed in a water bath at 65°C for 0.5 h to 1 h. The mixture was taken out every 10 minutes and inverted to mix, ensuring that the cells were fully lysed.

[0091] (4) Chloroform extraction: After water bath, take out and centrifuge for 10 min. Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) lower phase separation solution to the supernatant, mix thoroughly on a shaker, remove the precipitate by centrifugation for 10 min, add an equal volume of chloroform:isoamyl alcohol (24:1) solution to the supernatant, shake several times to mix, and centrifuge for 10 min. The centrifugation speed is 12000 rpm each time.

[0092] (5) Precipitate DNA: Add 1 / 10 of the volume of the supernatant from the previous step of 3M NaAc (pH=5.2) solution and an equal volume of pre-cooled isopropanol solution, mix them thoroughly, and let them stand at -20℃ for 1 hour.

[0093] (6) Washing DNA: After precipitation, centrifuge for 10 min, add 1 mL of 75% ethanol solution to rinse the precipitate twice. After the first rinse, centrifuge for 5 min and then rinse a second time. It is best to use pre-cooled ethanol solution.

[0094] (7) Purify DNA: After rinsing, centrifuge for 10 min and retain the precipitate. Let it stand at room temperature until the ethanol evaporates. Finally, add 100 μL of TE Buffer and 1 μL of RNase A and purify in a water bath at 37°C for 30 min to remove RNA.

[0095] (8) After testing the DNA quality and concentration with a nucleic acid protein detector, store at 4°C for later use, or store at -20°C for long-term storage.

[0096] 2. Primer design

[0097] First, the genomes of the tropical species *LA-Purple* (obtained by sequencing DNA extracted using the total DNA extraction method described above, hereinafter the same), *Dendrobium nobile* Np-X, and *Imperata cylindrica* Hainan 92-77 were masked for whole-genome repetitive sequences using Repeatmasker software. Chromosome 1 of the three genomes was then cut using the K-mers method, with the cutting performed via a Python script. The cut fragments were aligned using bwa software, and a set of 150bp fragments specific to *Imperata cylindrica* was selected. Primers were designed for the *Imperata cylindrica*-specific sequence set using Primer3. The primer design parameters used the software's default values ​​with some modifications, including: fragment size approximately 17bp–23bp, primer output quantity of 1, and target product size of 146bp–150bp. The filtered sequences were then used to design primers. Specific primer sequences are shown in Table 1.

[0098] Table 1 Primer sequences for molecular markers on different segments of chromosome 1 of *Imperata cylindrica*

[0099]

[0100] 3. PCR amplification

[0101] Each primer pair was used to prepare a reaction system, and the PCR reaction systems are shown in Table 2.

[0102] Table 2 PCR reaction system

[0103]

[0104] Mix well, centrifuge at 8000 rpm for 5 seconds, and then perform the amplification program as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 60℃ for 20 s, extension at 72℃ for 15 s, for 32 cycles; final extension at 72℃ for 3 min; and store at 12℃.

[0105] 4. Electrophoresis detection

[0106] After the amplification reaction was completed, 10 μL of PCR product was subjected to low melting point agarose gel electrophoresis at a mass-to-volume ratio of 2.0%. Electrophoresis was performed at a constant voltage of 120V for 30 min in 1×TAE electrophoresis buffer, and then observed and photographed using a gel imaging system.

[0107] If a PCR product amplification band appears at the 146bp-150bp position in the electrophoresis detection image, it indicates that the sample contains blood ties to different segments of chromosome 1 of the 'Pistacia chinensis'. The specific corresponding intervals are as mentioned above. If no PCR product amplification band appears, it indicates that the sample does not contain blood ties to different segments of chromosome 1 of the 'Pistacia chinensis'.

[0108] Electrophoresis results as follows Figure 1 As shown. Figure 1Each electrophoresis image in the image represents the specific identification of blood relations at different segments of chromosome 1. Samples 8-10 in the image show PCR product amplification bands at around 150bp, indicating that these samples contain blood relations corresponding to different segments of chromosome 1. Figure 1 No PCR product amplification bands were observed in samples 2-7 (negative controls), indicating that these samples do not contain bloodlines from different segments of chromosome 1. Figure 1 The absence of PCR product restriction bands in sample 1 (sterile water without nuclease) indicates that the experiment was not contaminated. Overall, this kit can effectively distinguish the bloodline of chromosome 1 of *Imperata cylindrica* from other bloodline materials that do not contain *Imperata cylindrica* and different segments.

[0109] The amplification product sequence of Chr01A_6309234_6309383 is as follows:

[0110] TGATAATGTCATCCGGGTCTTCAACTCTCAAATTTTGATATTTTGTGTCCCAAACTTGTCAG TGGTGTTGTTTAGGTCCTAACTTGTCTCGCGTGCCAGCATGGGTCCAATAGGCTCAGACTCGCTCCATCTGCTGACATGACATGG(Seq_35);

[0111] The amplification product sequence of Chr01A_29100625_29100774 is as follows:

[0112] GTGTTATGCCAGAGGTTACTTGAGTATTCTTCAGAGCAGGCTAGTATGTGAAAGCATTATGT CAAAATTTCACATCCTATTAATCTTCTGCCTACATTCAATTGATGAAGGGTAATAACATATAAACGACACAGTAAGCAATTCCA(Seq_36);

[0113] The amplification product sequence of Chr01A_35620361_35620510 is as follows:

[0114] AGATATGGCCTTAGGAAGTGGAGTAAAAGTCTTTCTAACCTAAAAGGCCTAATTGCGAACT GCAACACAGTGATACTCTTCCTAGACACCCTCGAGGAGTTAAGGTTCTTGTTCAACCTAGAGGTGAACTTGAGAAACCTGATCAA(Seq_37)

[0115] The amplification product sequence of Chr01A_38078118_38078267 is as follows:

[0116] CGGTTGTAGATGAGTTGATTGATGAACTGGCAGGAGCAAAGTGGTTCTCCAAATTGGACT TCCGTGCAGGCTATCATCAAATTCGTATTGCCCATGATGACACGCACAAGACGGCATTCAAAACTCATGATGGTCTTTACGAGTTCTTGG(Seq_38);

[0117] The amplification product sequence of Chr01A_51207711_51207860 is as follows:

[0118] ACAAACTAACCTACCTATCTTATCGCCCACAAAATCTATCTCAATGCAGCCCCACAATCGCA TTGAGAAGATTTAGAAAGCACCTGAAAACTCGTGAACCATGATTTACTCCATGCAAATTACAGATCAAGGTCGATTTAATTCCA(Seq_39);

[0119] The amplification product sequence of Chr01A_51592605_51592754 is as follows:

[0120] ATTCGCCACAACCCTATCCAATCTCTCTCTTATGTAGCCCTCCAGCATGTGGTTATTATTCCT CCAAGTAAATCTATCACCTTAAAAGCCCAAGCCCTCCACCCCACACCCCTCAAGTACCTCCTGAAATTTATCCATGCACTATT(Seq_40);

[0121] The amplification product sequence of Chr01A_51961977_51962126 is as follows:

[0122] ACGATCTTCTCTGAGCTCAATGAAAACTGCGACAGCAAAACGATGGCTTAAAGTGGTACA GATGTATGGCCTAAATTCCAGATCAATGTGGGTCGCCTGCGCTTCGGAATATTAGTTGTTTATTACACAAGTGATCTCATAGTCTCGCT(Seq_41);

[0123] The amplification product sequence of Chr01A_69208108_69208257 is as follows:

[0124] ACCTTATGTACAGACCTCTATTGCAACTAGAGCTAATCACAAGTTATCATTTCGTTATTTTGG TTCATACCCTGTTGTTGCCAAAGTGGGTTCAGTGGCATGCAAGTTGCTTCTTCCTGACAATACATCAGTGCATCCAGTCTTCC(Seq_42);

[0125] The amplification product sequence of Chr01A_73704494_73704643 is as follows:

[0126] ATACAAGTGAAAGTCTGCATCTATGTCCTTAAGCCGTTGATGCAAGGAGTTACTATCTTTGA TGAAGCGAAGGCGATGGACCGATGATGCCCTCTGTGCTATGAGTTTCTCCCTGGAGTTTTGTTATGTATGCGGAGTCATTGGCC(Seq_43);

[0127] The amplification product sequence of Chr01A_82241097_82241246 is as follows:

[0128] CAGTCCAGTGGGTCCATTGATACGGCTCTAGATCTTTTGGCAGGTGTGCAAACCCAACCGGCA TGCTGAACCATGGCGGGCCAAACCGGCATGGAATCCACCGCAGGAGGGCTGGCTTAAATGTAATGTTGATGGAGCCTTCTACTCG(Seq_44);

[0129] The amplification product sequence of Chr01A_90688190_90688339 is as follows:

[0130] TCACCATACTGAAGAACGACCATGGTAGCGGAATCAAAACATGCATAGCAGAGGTAGAG GCCATGGTTGTTGCTGGAACAACACTATACATTAAACCAATGATCCATCTGGTCGTCCATCATTTAGGAATTCAACCAATGCATGCAA(Seq_45);

[0131] The amplification product sequence of Chr01A_99327500_99327649 is as follows:

[0132] TGTTAGTTGGCAGTCTTCAATTTGAGTGTATCGGTCGGCTCTTCGCTACACTAGCCACCTCA GTACCTAAGCCTTAGACTGAGAGTGTTCCGCTCAATGATACTCTAGAGAGTCTAGTGACTCAAGGTATGGACACAAGCACTATTGGC(Seq_46);

[0133] The amplification product sequence of Chr01A_104821755_104821904 is as follows:

[0134] TGGACGAAATCAACTAAGTACATGTGTGGTGGGATCGTTTTCAACAAAGTAGACTAGGAG TTGTGCATTTCCAGTAAAATGTCTTGTACGATGATATCTCAAAATTCAAGCGATATAGGATTGGTATTTACAGTGTCATAGCTTGGC(Seq_47);

[0135] The amplification product sequence of Chr01A_114344909_114345058 is as follows:

[0136] AGCTTCTCTATTGATTTGTGTGCTTGGGCTTAGGAACACGATTTTCCACACCTGACTTGACC AAACTAGTATAATAGTGCCCAAATGCTAATCCATCTGACTTATCTCCTTTGTAAATGGAACAAGTGTGGCAGTACAATTATCC(Seq_48);

[0137] The amplification product sequence of Chr01A_114734439_114734588 is as follows:

[0138] ACGATTGTGTTGATTCATCTTACCTATTGAGTTAATAGATTTCAGCTTTGTTAGGGTTATTTC AGTTTTGAGAGGATAGACTTGTGGTCCACTGACCTTACCTTCATGAGTCAATTACTCAATGTGCCATTCCTGAGTCGTGAGAGTA(Seq_49);

[0139] The amplification product sequence of Chr01A_124420248_124420397 is as follows:

[0140] AGAGATGGAGTGTGGTAGATTAAGTTTCGAAGATCACTGACTCCGGCGGAGATGGAAGAG TGGAATCGATTGATGAGAGTGCTATTAGAAGTCCAACTTGCGGAAGGGAGGGATGAGATGAGATGGGCCTTGGAGAGTTCAGGTAGATT(Seq_50);

[0141] The amplification product sequence of Chr01A_130367979_130368128 is as follows:

[0142] ATTAAGTTTGATGTATAGTCTACGTGGTTGAGGGATGGAACTGTGAATTTGAATGCAGTAGT CACCTTTGTAAACTCGTTCATAGTAGCTTGCTAGAACTTGACTGTCTTCCGCTGAGCTGCCTGTTGATTAATGAACGTTATGAG(Seq_51).

[0143] Experiment 1 used primer sets to detect bloodline materials that had been identified to contain different segments of chromosome 1 of the variegated iris.

[0144] According to reports (Fan Yu, Zehuai Yu, Jin Chai, et al. Intergeneric chromosome-specific painting reveals differential chromosomal transmission from Tripidium arundinaceumin sugarcane progeny, Journal of Integrative Agriculture, 2024, 23, 11: 3751-3762.), the genomic DNA of materials Yacheng 01-92 and Yacheng 01-36 contains the bloodline of Tripidium arundinaceumin sugarcane progeny.

[0145] Genomic DNA containing chromosome 1 of *Imperata cylindrica* chromosome 1 was extracted from the real *Imperata cylindrica* hybrid BC1 progeny, Yacheng 01-92 and Yacheng 01-36. Its OD... 260 / OD 280 DNA with a ratio between 1.6 and 1.8 meets the experimental requirements. The concentration is determined and diluted to 50 ng / μL for aliquoting as template DNA.

[0146] Detection was performed on chromosomes 1-17 using specific primers for different segments of chromosome 1 (e.g., *Imperata cylindrica*), following the procedure described in Example 1. The results showed that the target band could be amplified in all of the above clones. Figure 2 The results indicate that primer pair 1-17 has good accuracy and can be used to detect different segments of chromosome 1 lineage in high-generation sugarcane-piper hybrid offspring.

[0147] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer set for rapid detection of bloodlines in different segments of chromosome 1 of Imperata cylindrica in sugarcane, characterized in that, The primer set includes 17 pairs of primers, with specific sequences shown in Seq_1 to Seq_34.

2. The primer set according to claim 1, characterized in that, The amplification products of the 17 primer pairs were all 146bp to 150bp in size.

3. A rapid reagent kit for detecting bloodlines in different segments of chromosome 1 in sugarcane, characterized in that, The primer set includes the rapid detection primers for different segments of chromosome 1 in sugarcane as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes reagents for PCR.

5. The reagent kit according to claim 3, characterized in that, The kit also includes negative sample DNA and positive sample DNA; the negative sample DNA is sugarcane leaf DNA without *Imperata cylindrica* lineage; the positive sample DNA is sugarcane leaf DNA containing *Imperata cylindrica* chromosome 1 lineage.

6. The application of the primer set according to any one of claims 1-2 or the reagent kit according to any one of claims 3-5, characterized in that, Including the following applications: (1) Detection or auxiliary detection of bloodline in different segments of chromosome 1 of Imperata cylindrica in sugarcane; (2) Prepare products for detecting or assisting in the detection of bloodlines in different segments of chromosome 1 of Imperata cylindrica in sugarcane; (3) Assisting in sugarcane breeding; (4) Prepare products to assist in sugarcane breeding.

7. A method for rapidly detecting bloodlines in different segments of chromosome 1 in sugarcane, characterized in that, Includes the following steps: Genomic DNA was extracted from the sugarcane material to be tested; The extracted genomic DNA was amplified by PCR using the primer set described in any one of claims 1 to 2 or the kit described in any one of claims 3 to 5. Based on the electrophoresis results of the PCR amplification products, it was determined whether there was blood relation to different segments of chromosome 1 in the sugarcane material to be tested.

8. The method according to claim 7, characterized in that, The criteria for judgment are as follows: if a specific band appears on the gel, it can be determined that the sugarcane material to be tested contains blood relatives of different segments of chromosome 1; otherwise, it does not contain blood relatives of different segments of chromosome 1; the specific bands of the amplification products of each primer pair appear at the position of 146bp to 150bp.

9. The method according to claim 7, characterized in that, The PCR reaction system was prepared as one reaction system for each primer pair: each 25 μL reaction system contained 12.5 μL of 2×Rapid Taq Master Mix, 2.5 μL of 50 ng / μL DNA template, 2.5 μL each of 10 μM forward and reverse primers, and the remainder was ddH2O.

10. The method according to claim 7, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 20 s, 72℃ extension for 15 s, 32 cycles; 72℃ final extension for 3 min; and storage at 12℃.

Images