African swine fever virus gene typing dot blot chip and construction method and application thereof

By designing a genotyping array chip and utilizing a combination of 16 SNP sites and molecular probes, we have achieved accurate detection of ASFV genotypes I, II, and I/II recombinant types. This solves the problem of existing technologies being unable to accurately distinguish ASFV genotypes, and enables efficient and accurate ASFV detection and monitoring.

CN120945126BActive Publication Date: 2026-04-28LANZHOU UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU UNIV
Filing Date
2025-08-14
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing ASFV detection methods cannot accurately distinguish between genotype I, II, and I/II recombinant strains, making ASF control difficult. Furthermore, whole-genome sequencing is costly and time-consuming.

Method used

A genotyping array chip was designed, containing 16 SNP site combinations and corresponding molecular probes, for detecting ASFV genotypes I, II, and I/II recombinant types. High-throughput and high-sensitivity accurate genotyping is achieved by hybridizing fluorescently labeled DNA probes with genomic DNA.

Benefits of technology

It enables accurate genotyping of ASFV genotypes I, II, and I/II recombinant types, monitors the prevalence and variation of ASFV, and features high throughput, high sensitivity, and high accuracy, supporting automated sample testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945126B_ABST
    Figure CN120945126B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology and particularly relates to a gene typing dot array chip for detecting African swine fever virus and a construction method and application thereof. The application firstly provides a single nucleotide polymorphism site combination for precisely detecting African swine fever virus of genotype I, genotype II and I / II recombinant virus. Secondly, the application provides a gene typing dot array chip for detecting African swine fever virus, which can simultaneously realize precise typing, epidemic and variation monitoring and identification of the recombinant gene of I / II recombinant virus of high-throughput detection samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This technology belongs to the field of gene chip technology, specifically involving a gene typing array chip for detecting African swine fever virus, its construction method, and its application. Background Technology

[0002] African swine fever (ASF) is an acute, febrile, hemorrhagic infectious disease caused by the African swine fever virus (ASFV). It is highly contagious through contact, and pigs of all ages and breeds are susceptible. With a mortality rate as high as 100%, it seriously threatens the global pig industry and food security. There are four clinical diagnoses for ASFV infection: peracute (highly virulent virus, up to 100% mortality), acute (highly virulent virus, up to 100% mortality), subacute (moderately virulent virus, 30%–50% mortality), and chronic (moderate or low virulent virus, 0%–50% mortality).

[0003] The ASFV genome is large (170-190 kb) and complex in structure, and its epidemiology is also complex. Currently, there are still no effective treatments or commercially available vaccines. ASF control primarily relies on strict management of pig imports and purchases, personnel, transport vehicles, feed, and incoming materials to ensure ASFV negativity and absence of contamination; enhanced clinical monitoring and sample testing of pig herds; intensified disinfection of the pig farm and surrounding environment; and the harmless disposal of dead and sick pigs. Therefore, given the severe challenges facing ASF control, accurate ASFV detection is crucial. Thus, researching precise ASFV detection technologies and developing methods capable of accurately detecting different ASFV genotypes while simultaneously monitoring the prevalence and variation of these genotypes is of great significance.

[0004] Current methods for detecting ASFV mainly include virus isolation (erythrocyte adsorption assay, HA), fluorescent antibody assay (FAT), indirect fluorescent antibody assay (IFA), direct immunofluorescence assay (DIF), double antibody sandwich ELISA, and ASFV nucleic acid detection (PCR, qPCR). Currently, PCR and fluorescent PCR (qPCR), recommended by the World Association for Human Health (WOAH), are the most widely used methods.

[0005] ASFV is classified into 24 genotypes based on the B646L gene. ASF was introduced to my country in 2018, with the prevalent strain being a highly virulent type II strain resembling Geogia07. In 2020, my country reported its first locally prevalent ASFV type II genotype with moderate virulence. In 2021, China was the first to report a locally prevalent ASFV type I genotype with low virulence, NH / P68-like. That same year, my country also discovered for the first time natural recombination between ASFV genotypes, resulting in a highly virulent ASFV type I / II recombinant NH / P68 and Geogia07-like strain. In 2022, my country promptly discovered and reported a locally prevalent B646L gene point mutant strain. In six years, the ASFV circulating in my country has undergone significant mutations, posing a severe challenge to ASF control. Currently, ASF (Anaerobic Septicemia) in my country exhibits a pattern of normalization, sporadic localization, and regional epidemics. ASFV diversity is increasing, with genotypes including ASFV type I, II, and I / II recombinant strains, and pathogenicity ranging from highly virulent to moderately virulent. Notably, since 2021, the detection rate of highly virulent ASFV genotype I / II recombinant strains has gradually increased and has now become the dominant circulating strain. Highly virulent ASFV genotype I / II recombinant strains are highly lethal and transmissible, posing a significant challenge to ASF control. Therefore, in the absence of effective treatments and commercially available vaccines, establishing precise ASFV typing and detection methods, and monitoring the prevalence and variation of ASFV types I, II, and I / II recombinant strains, is of great significance for precise ASF control.

[0006] Single nucleotide polymorphisms (SNPs) refer to variations in a single nucleotide at the genomic level, including molecular markers formed by deletions, insertions, transitions, and transversions of single bases, and are highly specific. Genotyping arrays immobilize fluorescently labeled DNA probes on a silicon chip, and SNP typing is performed by hybridizing the probe DNA with genomic DNA, offering advantages such as high throughput, high sensitivity, and high accuracy.

[0007] However, there are currently no genotyping arrays for ASFV genotyping. Detection of ASFV genotype I / II recombinant strains mainly relies on whole-genome sequencing, which is costly and time-consuming. Furthermore, existing ASFV detection methods are general or single-point detection methods, unable to distinguish between ASFV genotype I, II, and I / II recombinant strains, thus failing to provide precise clinical guidance. Summary of the Invention

[0008] To address the aforementioned technical problems, the purpose of this invention is to develop a genotyping array chip for accurate ASFV typing, identification of ASFV gene I / II recombinant genes, and simultaneous monitoring of ASFV prevalence and variation. Specifically, it includes the following:

[0009] In a first aspect, the present invention provides a combination of SNP sites for detecting African swine fever virus genotypes I, II, and I / II recombinant types, wherein the combination of SNP sites consists of 16 SNP sites, and the 16 SNP sites are as follows:

[0010] SNP1: Located at the 78th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / G polymorphism;

[0011] SNP2: Located at the 90th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / C polymorphism;

[0012] SNP3: Located at nucleotide 132 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits C / T polymorphism;

[0013] SNP4: Located at nucleotide 174 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits T / G polymorphism;

[0014] SNP5: Located at nucleotide 308 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits G / A polymorphism;

[0015] SNP6: Located at nucleotide 363 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits A / G polymorphism;

[0016] SNP7: Located at nucleotide 387 of the CDS sequence of the African swine fever virus CP204L gene with gene version number NC_044957.1, it exhibits A / G polymorphism;

[0017] SNP8: Located at nucleotide 392 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits an A / T polymorphism;

[0018] SNP9: Located at nucleotide 678 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism;

[0019] SNP10: Located at nucleotide 685 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism.

[0020] SNP11: Located at nucleotide 698 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism;

[0021] SNP12: Located at nucleotide 923 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism;

[0022] SNP13: Located at nucleotide 1224 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits T / C polymorphism;

[0023] SNP14: Located at nucleotide 1278 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism;

[0024] SNP15: Located at nucleotide 1282 of the CDS sequence of the African swine fever virus MGF505-11L gene with gene version number NC_044956.1, it has a G / A polymorphism.

[0025] SNP16: Located at nucleotide 1292 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism.

[0026] Secondly, the present invention provides an application of a molecular probe for detecting the SNP site combination described in the first aspect in the preparation of a chip / kit for detecting African swine fever virus genotype I, II, and I / II recombinant genotypes.

[0027] Thirdly, the present invention provides a molecular probe for detecting African swine fever virus genotypes I, II, and I / II recombinant types, wherein the molecular probe detects the SNP site combinations described in the first aspect in the sample to be tested.

[0028] Preferably, the molecular probe is designed based on the SNP site described in the first aspect above and the 50bp sequences before and after it.

[0029] Preferably, the molecular probe comprises the probe sequence shown in SEQ ID NO.1-16.

[0030] Preferably, the molecular probe further includes the internal reference sequence shown in SEQ ID NO.17.

[0031] Preferably, the molecular probe is as follows:

[0032] SNP1 probe sequence (5'-3'): TAACGATTGCTACCCTTCCGGCTGTTCTAATATAACCGGGTTCTGAACGA (shown in SEQ ID NO.1);

[0033] SNP2 probe sequence (5'-3'): CCCTTCCGGCTGTTCTAATATAACCGGGTTCTGAACGAATTATCGTCCTA (shown as SEQ ID NO.2);

[0034] SNP3 probe sequence (5'-3'): TCGTCCTAAAGATTGTAATTTTTACACTTGTTTTCAATACCCTTTGGGCT (shown as SEQ ID NO.3);

[0035] SNP4 probe sequence (5'-3'): TTTGGGCTGGGGCTTGGGTGAAACTCAGTTTAGCTTCTTTGTGTAAACCA (shown as SEQ ID NO.4);

[0036] SNP5 probe sequence (5'-3'): AGACGTAGACAAACTTCTCCTCTGCCTTAGGAGTCGTAGAAGCCTCT (shown in SEQ ID NO.5);

[0037] SNP6 probe sequence (5'-3'): GTACTTTTTTTACTATTACTTTGGTTACTTACGTGTAGGAGGAAACTTTG (shown in SEQ ID NO. 6);

[0038] SNP7 probe sequence (5'-3'): TTACTTACGTGTAGGAGGAAACTTTGCAACAAACTCGTTCTCGGGAGTAG (shown in SEQ ID NO.7);

[0039] SNP8 probe sequence (5'-3'): TACGTGTAGGAGGAAACTTTGCAACAAACTCGTTCTCGGGAGTAGCCTCC (shown in SEQ ID NO. 8);

[0040] SNP9 probe sequence (5'-3'): TTATTACCAAGCTGGAAGTGCTCGACATGCGTTTCCTCTTCCAAGCATA (shown in SEQ ID NO.9);

[0041] SNP10 probe sequence (5'-3'): ACAAGCGTGGAAGTGCTCGACATGCGTTTCCTCTTCCAAGCATACCTGTAC (shown in SEQ ID NO.10);

[0042] SNP11 probe sequence (5'-3'): GCTCGACATGCGTTTCCTCTTCCAAGCATACCTGTACCTACTTTACGATT (shown in SEQ ID NO.11);

[0043] SNP12 probe sequence (5'-3'): GGTTTTTCTGTTGAGCAAGTAACGGTCGTACAATAGTAATTTAACAATAT (shown in SEQ ID NO.12);

[0044] SNP13 probe sequence (3'-5'): TAAAGATTGAATCATTTAATGTGTCAGCAGGTTCGCCACCGGTAGCTTAT (shown in SEQ ID NO.13);

[0045] SNP14 probe sequence (3'-5'): GCACTTAAAGTGGCTCTTTTCGTCGAAGGGTAGCAAGGGAACAATTACCA (shown in SEQ ID NO.14);

[0046] SNP15 probe sequence (3'-5'): TTAAAGTGGCTCTTTTCGTCGAAGGGTAGCAAGGGAACAATTACCACGAA (shown in SEQ ID NO.15);

[0047] SNP16 probe sequence (3'-5'): TCTTTTTCGTCGAAGGGTAGCAAGGGAACAATTACCACGAACGCCTTGTAT (shown in SEQ ID NO.16);

[0048] Internal reference probe sequence (5'-3'): TGAAAGAAGAAGAAGTCTTGCCAAGTCGACACGACGCAATGTCATGGATT (shown in SEQ ID NO.17).

[0049] Fourthly, the present invention provides a genotyping array chip for detecting African swine fever virus genotype I, II, and I / II recombinant genotypes, wherein the genotyping array chip is loaded with the molecular probes described in the third aspect above.

[0050] Fifthly, the present invention provides a kit for detecting African swine fever virus genotypes I, II, and I / II recombinant genotypes, the kit comprising reagents for detecting the SNP site combinations described in the first aspect, or the molecular probes described in the third aspect, or the genotyping array chip described in the fourth aspect.

[0051] In a sixth aspect, the present invention provides reagents for detecting the SNP site combinations described in the first aspect, or the molecular probes described in the third aspect, or the genotyping array chips described in the fourth aspect, or the kits described in the fifth aspect, for use for non-diagnostic purposes as shown in any of the following:

[0052] (1) Application in the genotyping detection of African swine fever virus type I, type II, and I / II recombinant types;

[0053] (2) Application in monitoring the prevalence and variation of existing African swine fever virus genotypes I, II, and I / II recombinant strains;

[0054] (3) Application in identifying conserved genes in recombinant African swine fever virus gene I / II.

[0055] In a seventh aspect, the present invention provides a method for non-diagnostic genotyping and identification of African swine fever virus (ASFV) genotypes I, II, and I / II recombinant types. The method includes: detecting the SNP site combinations described in the first aspect; when the SNP1-16 sites are sequentially T, T, C, T, G, A, A, A, G, G, G, T, G, G, G, indicating ASFV genotype I; when the SNP1-16 sites are sequentially G, C, T, G, A, G, G, T, A, A, A, A, C, A, A, A, indicating ASFV genotype II; and when the SNP1-16 sites are sequentially T, T, C, T, A, G, G, T, A, A, A, A, C, A, A, A, indicating ASFV genotype I / II recombinant types.

[0056] Preferably, the method includes the following steps:

[0057] (1) Extract DNA from the test sample and use ddH2O as a blank control;

[0058] (2) Amplify the DNA described in step (1), incubate it, fragment the DNA, purify the DNA, and then resuspend it in hybridization solution;

[0059] (3) Hybridize the DNA processed in step (2) with the dot matrix chip described in the third aspect above, clean the genotyping dot matrix chip, and perform single base extension and staining.

[0060] (4) Scan the fluorescence signal of the genotyping array chip to obtain fluorescence images and data;

[0061] (5) Quality control is performed on the four detection processes of hybridization, washing, extension and staining of the genotyping array chip. The samples are analyzed after the quality control is qualified.

[0062] (6) Cluster the detection results and perform genotyping on each sample according to the SNP site combination described in the first aspect above; wherein, when the detection sites of SNP1-16 are T, T, C, T, G, A, A, A, G, G, G, G, T, G, G, G, African swine fever virus genotype I; when the detection sites of SNP1-16 are G, C, T, G, A, G, G, T, A, A, A, A, C, A, A, A, African swine fever virus genotype II; when the detection sites of SNP1-16 are T, T, C, T, A, G, G, T, A, A, A, A, C, A, A, A, African swine fever virus genotype I / II recombinant.

[0063] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0064] (1) The gene typing array chip for accurate detection of African swine fever genotype I, II, and I / II recombinant viruses is designed for typing and specifically screens highly conserved SNP sites of conserved ASFV genes, which can realize accurate typing detection of African swine fever genotype I, II, and I / II recombinant viruses.

[0065] (2) The gene typing array chip for accurate detection of African swine fever genotype I, II and I / II recombinant viruses is designed for monitoring the prevalence and variation of ASFV. It specifically screens conserved genes of ASFV genotype I and II and conserved recombinant genes of I / II recombinant type, and can monitor the prevalence and variation of existing ASFV genotype I, II and I / II recombinant strains.

[0066] (3) Accurately detect the gene typing array chip of African swine fever genotype I, II and I / II recombinant viruses, and specifically screen the conserved genes of ASFV genotype I and II and the conserved recombinant genes of I / II recombinant viruses, and can accurately identify the conserved genes of ASFV genotype I / II recombinant recombinant viruses.

[0067] (4) A gene typing array chip for accurate detection of African swine fever genotype I, II, and I / II recombinant viruses can achieve high-throughput, high-sensitivity, high-accuracy and automated sample detection, and can detect 96 samples at a time;

[0068] (5) The gene typing array chip for accurate detection of African swine fever genotype I, II and I / II recombinant viruses can simultaneously achieve high-throughput accurate typing of samples, epidemic and variation monitoring, and identification of recombinant genes of I / II recombinant viruses. Attached Figure Description

[0069] Figure 1 This is a schematic diagram of the detection principle of the genotyping array chip for the accurate detection of African swine fever genotype I, II, and I / II recombinant viruses as described in this invention.

[0070] Figure 2 This is a quality control chart for the genotyping array chip detection of African swine fever genotype I, II, and I / II recombinant viruses as described in this invention.

[0071] Figure 3 This is one of the results of the genotyping array chip detection of African swine fever genotype I, II, and I / II recombinant viruses as described in this invention;

[0072] Figure 4 This is one of the results of the genotyping array chip detection of African swine fever genotype I, II, and I / II recombinant viruses as described in this invention;

[0073] Figure 5 This is one of the results of the genotyping array chip detection of African swine fever genotype I, II, and I / II recombinant viruses as described in this invention. Detailed Implementation

[0074] The present invention will be further illustrated below with reference to a detailed description of specific embodiments. However, the embodiments described below are merely illustrative of the technical solutions of the present invention and do not limit the technical solutions of the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, the bioinformatics software and products used are all commercially available, and the experimental processes and methods are also conventional methods known in the art. The source, trade name, and components of the materials used, if necessary, are indicated upon their first appearance. Unless otherwise specified, the same reagents used thereafter are the same as those initially indicated.

[0075] Furthermore, it should be noted that the site combinations and applications provided by this invention were achieved through the arduous creative labor and optimization work of the inventors of this application.

[0076] The SNP referred to in this application is Single Nucleotide Polymorphism, which mainly refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. The single nucleotide variation includes variations caused by a single base conversion, transversion, insertion, or deletion.

[0077] It should be noted that the molecular markers referred to in this invention are all heritable and detectable DNA sequences or proteins, including but not limited to molecular markers based on molecular hybridization, molecular markers based on PCR technology, DNA markers based on restriction enzyme digestion and PCR technology, molecular markers based on DNA microarray technology, and analytical marker technologies developed based on EST databases. The molecular markers provided by this invention can be used for genome mapping and gene localization studies, map-based gene cloning, species phylogenetics, and systematic classification.

[0078] It should be noted that the probe referred to in this invention is a nucleic acid sequence (DNA or RNA) that is complementary to the target gene, has a known sequence and carries a detection marker.

[0079] It should be noted that the kit referred to in this application is any kit commonly used in the art that contains reagents for detection or experimentation, allowing operators to avoid the cumbersome process of reagent preparation and optimization. In one embodiment of the present invention, it includes primers for amplifying the site information provided by the present invention, molecular markers or probes or gene chips for detecting the site information provided by the present invention, enzymes and buffers for amplification, or fluorescent labels for detection.

[0080] Example 1: Design and fabrication of a genotyping array for accurate detection of African swine fever virus genotypes I, II, and I / II recombinant types.

[0081] 1. Acquisition of whole genome data for African swine fever virus genotypes I, II, and I / II recombinant types

[0082] A total of 355 African swine fever virus (ASFV) whole-genome sequences were obtained from the NCBI database and from our own sequencing. We screened ASFV whole-genome sequences with complete and accurate gene annotations, removing sequences with incorrect annotations, no annotation information, or partial deletions, resulting in 310 quality-controlled ASFV whole-genome sequences. After sequence alignment of these quality-controlled ASFV sequences, the B646L gene sequence was extracted. ASFV typing was performed using an ASFV typing tool, and the whole-genome sequences of ASFVs classified as genotype I and II were collected, while other genotypes were removed. The whole genome sequence files of African swine fever virus genotypes I and II, classified according to the B646L genotype, were modified into txt format, merged into one file, and compared with the whole genome sequences of African swine fever genotype I / II recombinant viruses reported in the literature. The whole genome sequences of African swine fever genotype I, II, and I / II recombinant viruses were extracted, resulting in a total of 297 African swine fever virus whole genome sequences, including 101 African swine fever genotype I viruses, 186 African swine fever genotype II viruses, and 10 African swine fever genotype I / II recombinant viruses.

[0083] 2. Identification of target genes for African swine fever virus genotypes I, II, and I / II recombinant types.

[0084] The whole genome sequences of 297 African swine fever viruses were aligned, and four target genes were identified: B646L, CP204L, MGF360-9L, and MGF505-11L. Protein-coding sequences of these four target genes were directly extracted from the 297 African swine fever viruses. For target genes from which direct extraction of protein-coding sequences was not possible, complementary sequences were extracted and reversed. The protein-coding sequences of the four target genes were merged into a single file, modified into a .txt file, and then sequence alignment was performed. Sequence alignment revealed that the four target genes have different gene lengths in different ASFV types. Specifically, the B646L gene in type I, type II, and I / II recombinant ASFV is 1941 bp long; the CP204L gene in type I ASFV is 561 bp or 585 bp long; the CP204L gene in type II ASFV is 561 bp long; and the CP204L gene in I / II recombinant ASFV is 585 bp long. The MGF360-9L gene in type I ASFV is 1104 bp, 1053 bp, or 1020 bp long; the MGF360-9L gene in type II ASFV is 1104 bp long; and the MGF360-9L gene in I / II recombinant ASFV is 1053 bp long. The MGF505-11L gene in type I, type II, and I / II recombinant ASFV is 1629 bp long. Among them, the B646L gene of genotype I ASFV and genotype I / II recombinant ASFV has 100% similarity, differing from genotype II ASFV by 30 SNP sites; the CP204L gene of genotype II ASFV without deletions of 1-24 bases has 100% similarity to genotype I / II recombinant ASFV, while the CP204L gene of genotype II ASFV and genotype I / II recombinant ASFV with deletions of 1-24 bases has 25-585 base positions. The similarity between the two genes is 100%, with 12 SNP sites different from the type I ASFV; the similarity between the type II ASFV and the MGF360-9L gene of the recombinant ASFV of the type I / II genes without the deletion of 1-24 bases is 100%, with 15 SNP sites different from the type I ASFV; the similarity between the type II ASFV and the MGF505-11L gene of the recombinant ASFV of the type I / II genes is 100%, with 24 SNP sites different from the type I ASFV.

[0085] 3. Screening and identification of SNP sites in target genes for African swine fever virus genotypes I, II, and I / II recombinant types.

[0086] After comparing the sequences of four target genes, a total of 81 single nucleotide polymorphism (SNP) sites were extracted. Based on the distribution frequency and location of the SNP sites, four SNP sites were further extracted from the conserved regions of each target gene, for a total of 16 SNP sites. These were used to construct a genotyping array chip for the accurate detection of African swine fever genotype I, II, and I / II recombinant viruses. The locations and mutation types of the 16 single nucleotide polymorphism sites in the target genes are shown below; the reference gene versions are NC_044956.1 (African swine fever virus Benin 97 / 1 pathogenic isolate, complete genome) and NC_044957.1 (African swine fever virus OURT 88 / 3 avirulent field isolate, complete genome); among the reference target genes at physical locations, the B646L gene is 1941 bp long; the CP204L gene is 585 bp long; the MGF360-9L gene is 1053 bp long; and the MGF505-11L gene is 1629 bp long.

[0087] SNP1: Located at the 78th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / G polymorphism;

[0088] SNP2: Located at the 90th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / C polymorphism;

[0089] SNP3: Located at nucleotide 132 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits C / T polymorphism;

[0090] SNP4: Located at nucleotide 174 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits T / G polymorphism;

[0091] SNP5: Located at nucleotide 308 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits G / A polymorphism;

[0092] SNP6: Located at nucleotide 363 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits A / G polymorphism;

[0093] SNP7: Located at nucleotide 387 of the CDS sequence of the African swine fever virus CP204L gene with gene version number NC_044957.1, it exhibits A / G polymorphism;

[0094] SNP8: Located at nucleotide 392 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits an A / T polymorphism;

[0095] SNP9: Located at nucleotide 678 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism;

[0096] SNP10: Located at nucleotide 685 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism.

[0097] SNP11: Located at nucleotide 698 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism;

[0098] SNP12: Located at nucleotide 923 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism;

[0099] SNP13: Located at nucleotide 1224 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits T / C polymorphism;

[0100] SNP14: Located at nucleotide 1278 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism;

[0101] SNP15: Located at nucleotide 1282 of the CDS sequence of the African swine fever virus MGF505-11L gene with gene version number NC_044956.1, it has a G / A polymorphism.

[0102] SNP16: Located at nucleotide 1292 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism.

[0103] 4. Preparation and Detection Principle of Genotyping Matrix Chips

[0104] Probes were designed based on the 16 SNP sites identified above and their preceding and following 50 bp sequences. Simultaneously, a probe targeting the conserved region of the ASFV B646L gene was designed as an internal control. The SNP site detection probes and the internal control probes are shown below:

[0105] SNP1 probe sequence (5'-3'): TAACGATTGCTACCCTTCCGGCTGTTCTAATATAACCGGGTTCTGAACGA (shown in SEQ ID NO.1);

[0106] SNP2 probe sequence (5'-3'): CCCTTCCGGCTGTTCTAATATAACCGGGTTCTGAACGAATTATCGTCCTA (shown as SEQ ID NO.2);

[0107] SNP3 probe sequence (5'-3'): TCGTCCTAAAGATTGTAATTTTTACACTTGTTTTCAATACCCTTTGGGCT (shown as SEQ ID NO.3);

[0108] SNP4 probe sequence (5'-3'): TTTGGGCTGGGGCTTGGGTGAAACTCAGTTTAGCTTCTTTGTGTAAACCA (shown as SEQ ID NO.4);

[0109] SNP5 probe sequence (5'-3'): AGACGTAGACAAACTTCTCCTCTGCCTTAGGAGTCGTAGAAGCCTCT (shown in SEQ ID NO.5);

[0110] SNP6 probe sequence (5'-3'): GTACTTTTTTTACTATTACTTTGGTTACTTACGTGTAGGAGGAAACTTTG (shown in SEQ ID NO. 6);

[0111] SNP7 probe sequence (5'-3'): TTACTTACGTGTAGGAGGAAACTTTGCAACAAACTCGTTCTCGGGAGTAG (shown in SEQ ID NO.7);

[0112] SNP8 probe sequence (5'-3'): TACGTGTAGGAGGAAACTTTGCAACAAACTCGTTCTCGGGAGTAGCCTCC (shown in SEQ ID NO. 8);

[0113] SNP9 probe sequence (5'-3'): TTATTACCAAGCTGGAAGTGCTCGACATGCGTTTCCTCTTCCAAGCATA (shown in SEQ ID NO.9);

[0114] SNP10 probe sequence (5'-3'): ACAAGCGTGGAAGTGCTCGACATGCGTTTCCTCTTCCAAGCATACCTGTAC (shown in SEQ ID NO.10);

[0115] SNP11 probe sequence (5'-3'): GCTCGACATGCGTTTCCTCTTCCAAGCATACCTGTACCTACTTTACGATT (shown in SEQ ID NO.11);

[0116] SNP12 probe sequence (5'-3'): GGTTTTTCTGTTGAGCAAGTAACGGTCGTACAATAGTAATTTAACAATAT (shown in SEQ ID NO.12);

[0117] SNP13 probe sequence (3'-5'): TAAAGATTGAATCATTTAATGTGTCAGCAGGTTCGCCACCGGTAGCTTAT (shown in SEQ ID NO.13);

[0118] SNP14 probe sequence (3'-5'): GCACTTAAAGTGGCTCTTTTCGTCGAAGGGTAGCAAGGGAACAATTACCA (shown in SEQ ID NO.14);

[0119] SNP15 probe sequence (3'-5'): TTAAAGTGGCTCTTTTCGTCGAAGGGTAGCAAGGGAACAATTACCACGAA (shown in SEQ ID NO.15);

[0120] SNP16 probe sequence (3'-5'): TCTTTTTCGTCGAAGGGTAGCAAGGGAACAATTACCACGAACGCCTTGTAT (shown in SEQ ID NO.16);

[0121] Internal reference probe sequence (5'-3'): TGAAAGAAGAAGAAGTCTTGCCAAGTCGACACGACGCAATGTCATGGATT (shown in SEQ ID NO.17).

[0122] Probes are coupled to micron-sized silica microspheres, with each microsphere coupled to hundreds of thousands of identical probes to detect the same site. The microspheres are fixed in carefully etched micropores in a single-crystal silicon substrate, with one microsphere corresponding to one micropore. Each detection unit is independent and does not interfere with others, and each site contains 15 to 30 microspheres.

[0123] The sample is added to the genotyping array chip. The probe captures the target gene sequence according to the base complementarity principle. Then, four biotin-labeled dideoxynucleotides are added for single-base extension, and the fluorescence signal is further amplified by chemical methods. The detection principle diagram is shown below. Figure 1 As shown.

[0124] The OminScan gene chip scanner and its accompanying OCS software were used to scan the chip, obtain fluorescence intensity signals, and analyze them to ultimately obtain the genotype of the target mutation site.

[0125] Example 2: Application of Genotyping Array Chip in Precise Genotyping of African Swine Fever Genotype I, II, and I / II Recombinant Viruses

[0126] Based on the highly conserved target genes and highly conserved SNP sites screened above, in the precise genotyping of ASFV type I, II, and I / II recombinant types, when the detected B646L, CP204L, MGF360-9L, and MGF505-11L genes belong to ASFV type II, i.e., the SNP1-16 sites are G, C, T, G, A, G, G, T, A, A, A, A, C, A, A, A, A, the ASFV in the sample is type II; when the detected B646L, CP204L, MGF360-9L, and MGF505-11L genes belong to ASFV type II, i.e., the SNP1-16 sites are G, C, T, G, A, G, G, T, A, A, A, A, C, A, A, A, the ASFV in the sample is type II; when the detected B646L, CP204L, MGF360-9L, and MGF505-11L genes belong to ASFV type II, the ASFV in the sample is type II. All 11L genes belong to ASFV genotype I, meaning the SNP1-16 sites are T, T, C, T, G, A, A, A, G, G, G, G, T, G, G, G in sequence, indicating that the ASFV in the sample is genotype I. When the detected B646L gene belongs to ASFV genotype I, but the CP204L, MGF360-9L, and MGF505-11L genes belong to ASFV genotype II, meaning the SNP1-16 sites are T, T, C, T, A, G, G, T, A, A, A, A, C, A, A, A in sequence, the ASFV in the sample is genotype I / II recombinant.

[0127] The specific steps are as follows:

[0128] (1) Collect field samples and clinical samples, extract DNA (if necessary, first isolate ASFV and then extract DNA), and use ddH2O as a blank control;

[0129] (2) Amplify DNA, incubate overnight, fragment DNA, purify DNA, and resuspend it in hybridization solution;

[0130] (3) After the DNA was hybridized with the genotyping array chip constructed in Example 1 overnight, the genotyping array chip was washed and single base extension and staining were performed.

[0131] (4) The gene chip scanner OminScan and its accessory software OCS scan the fluorescence signal of the gene typing array chip and export the fluorescence image and data;

[0132] (5) Quality control was performed on the four detection processes of hybridization, extension, target removal (washing), and staining of the genotyping array chip. Samples were analyzed after passing quality control. The quality control chart for the genotyping array chip detection is shown below. Figure 2 As shown in the diagram, the vertical axis of the quality control graph represents the fluorescence signal intensity values ​​of four types of quality control microspheres in the four steps of hybridization, extension, target removal, and staining. The horizontal axis represents the number of times the quality control microspheres were tested. Specifically, if the fluorescence signal values ​​of different quality control microspheres during hybridization meet the preset values, and the fluorescence signal values ​​of different single bases during extension meet the preset values, indicating that unbound DNA has been completely removed, and the fluorescence signal value is high after staining, it indicates that the detection process is normal and the quality control is qualified.

[0133] (6) Cluster the detection results and perform genotyping on each sample by comparing it with the identified SNP sites. The results of the genotyping array chip detection of the samples are as follows: Figure 3-5 The figures show the coordinates of 16 SNP sites in the B646L, CP204L, MGF360-9L, and MGF505-11L genes. The vertical and horizontal axes represent the normalized R-value and Theta value of the corresponding sample after the fluorescence signal value was detected by the scanning chip, respectively. Specifically, in the coordinate diagram of the first SNP site of the ASFV B646L gene, the red circle on the left indicates that the first SNP site of the B646L gene in 8 samples was successfully genotyped as base T, and the green circle on the right indicates that the first SNP site of the B646L gene in 6 samples was successfully genotyped as base G. By statistically analyzing the coordinate diagrams of the 16 SNP sites and the internal reference SNP site, the genotyping and identification of each sample can be successfully performed.

[0134] (7) Compare the genotyping results of the sample with the high-throughput sequencing results.

[0135] The detection results are shown in Table 1. The genotyping array chip can successfully detect ASFV in the sample and successfully genotype it with a site detection rate of 100%. The genotyping results are consistent with the results of high-throughput whole genome sequencing, indicating that the genotyping array chip constructed in this invention has high accuracy and high sensitivity and can be used for accurate genotyping detection of African swine fever genotype I, II, and I / II recombinant viruses.

[0136] Table 1. Genotyping results of samples from genotyping array microarrays.

[0137]

[0138] Example 3: Application of Genotyping Array Chips in Identification of Recombinant Genes in African Swine Fever I / II Recombinant Viruses

[0139] The four ASFV detection target genes selected in this invention are highly conserved genes. Currently reported ASFV gene I / II recombinant genomes include 10 fragments from ASFV gene type I and 10 fragments from ASFV gene type II. Bioinformatics alignment of the four conserved genes selected in this invention confirmed that they all underwent recombination in ASFV gene I / II recombinant types. The distribution of recombinant genes was fully considered during microarray construction, therefore, this invention can be used for the identification of recombinant genes in African swine fever I / II recombinant viruses.

[0140] Specific steps:

[0141] (1) After collecting field samples and clinical samples, extract DNA (if necessary, isolate ASFV first and then extract DNA), and use ddH2O as a blank control;

[0142] (2) After amplification and purification of the DNA, it is hybridized with a genotyping array chip;

[0143] (3) The hybridization fluorescence signal of the gene chip scanner OminScan and its accessory software OCS was scanned. The 16 SNP sites detected by cluster analysis were compared with the specific SNP sites of ASFV type I and type II strains in the genes B646L, CP204L, MGF360-9L and MGF505-11L identified by bioinformatics analysis. The results showed that the four genes of the sample belonged to ASFV type I or type II strains.

[0144] (4) Based on the literature reports on the whole genome information and recombinant genes of ASFV I / II recombinant types (Zhao D, Sun E, Huang L, et al. Highly lethal genotype I and II recombinant African swinefever viruses detected in pigs[J]. Nat Commun. 2023,14(1):3096-3106.), and the results of the comparison of ASFV type I, II, and I / II recombinant gene sequences in steps 2 and 3 of Example 1, the gene recombination results of the currently popular ASFV I / II recombinant types are that the B646L gene comes from ASFV type I, and CP204L, MGF360-9L, and MGF505-11L come from ASFV type II. That is, ASFV recombinant type I / II was detected in this sample, specifically, the ASFV type I B646L gene and the type II CP204L, MGF360-9L, and MGF505-11L genes have recombinated.

[0145] The gene chip constructed in this invention may also identify other gene recombination results in ASFV I / II recombinant types, such as the B646L gene from ASFV gene type II, and CP204L, MGF360-9L, and MGF505-11L from ASFV gene type I.

[0146] Example 4: Application of Genotyping Array Chips in Monitoring the Epidemic and Mutation of African Swine Fever Virus

[0147] This invention selects 16 SNP sites from four ASFV detection target genes, which are highly conserved and specific. This allows for the accurate detection of ASFV genotypes I, II, and I / II recombinant types, as well as the precise identification of recombinant genes within ASFV I / II recombinant types. Real-time collection of field and clinical samples from different time points and regions, along with detection of specific SNP sites using a genotyping array, enables timely monitoring of single nucleotide site variations in newly emerging highly conserved ASFV genotypes I, II, and I / II recombinant types. Simultaneously, it monitors changes in ASFV I / II recombinant genes and variations at specific single nucleotide sites within the recombinant genes.

[0148] Specific steps:

[0149] (1) Collect field samples and clinical samples from different time points and regions in real time, extract DNA (if necessary, first separate ASFV and then extract DNA), use ddH2O as a blank control, amplify and purify the DNA, and then hybridize it with the genotyping array chip;

[0150] (2) The hybridization fluorescence signal of the chip was scanned by the OminScan gene chip scanner and the OCS software. The 16 SNP sites detected by cluster analysis were compared with the 16 SNP sites described in this application. If they are consistent, it indicates that the currently popular ASFV genotypes I, II, and I / II recombinant types have not undergone nucleotide site variations, and the recombinant genes of ASFV I / II recombinant types have not changed. If they are inconsistent, they are compared with the 16 SNP sites described in this application according to different types to identify the ASFV genotypes and variant genes that have undergone variations, as well as the number and location of variant nucleotide sites. This further identifies the changes in recombinant genes in ASFV I / II recombinant types and the number and location of variant nucleotide sites in the recombinant genes.

Claims

1. Application of molecular probes for detecting SNP site combinations in the preparation of chips / kits for detecting African swine fever virus genotypes I, II, and I / II recombinant types; the SNP site combination consists of 16 SNP sites, which are as follows: SNP1: Located at the 78th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / G polymorphism; SNP2: Located at the 90th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / C polymorphism; SNP3: Located at nucleotide 132 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits C / T polymorphism; SNP4: Located at nucleotide 174 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits T / G polymorphism; SNP5: Located at nucleotide 308 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits G / A polymorphism; SNP6: Located at nucleotide 363 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits A / G polymorphism; SNP7: Located at nucleotide 387 of the CDS sequence of the African swine fever virus CP204L gene with gene version number NC_044957.1, it exhibits A / G polymorphism; SNP8: Located at nucleotide 392 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits an A / T polymorphism; SNP9: Located at nucleotide 678 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism; SNP10: Located at nucleotide 685 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism. SNP11: Located at nucleotide 698 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism; SNP12: Located at nucleotide 923 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism; SNP13: Located at nucleotide 1224 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits T / C polymorphism; SNP14: Located at nucleotide 1278 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism; SNP15: Located at nucleotide 1282 of the CDS sequence of the African swine fever virus MGF505-11L gene with gene version number NC_044956.1, it has a G / A polymorphism. SNP16: Located at nucleotide 1292 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism.

2. A molecular probe for detecting African swine fever virus genotypes I, II, and I / II recombinant types, characterized in that, The molecular probe includes the probe sequence shown in SEQ ID NO.1-16.

3. The molecular probe as described in claim 2, characterized in that, The molecular probe also includes the internal reference sequence shown in SEQ ID NO.

17.

4. A genotyping array chip for detecting African swine fever virus genotypes I, II, and I / II recombinant types, characterized in that, The genotyping array chip is loaded with any of the molecular probes described in claims 2-3.

5. A kit for detecting African swine fever virus genotypes I, II, and I / II recombinant types, characterized in that, The kit comprises the molecular probes of any one of claims 2-3, or the genotyping array chip of claim 4.

6. Use for non-diagnostic purposes of the molecular probe as described in any of claims 2-3, or the genotyping array chip as described in claim 4, or the kit as described in claim 5, as shown in any of the following: (1) Application in the genotyping detection of African swine fever virus type I, type II, and I / II recombinant types; (2) Application in monitoring the prevalence and variation of existing African swine fever virus genotypes I, II, and I / II recombinant strains; (3) Application in identifying conserved genes in recombinant African swine fever virus gene I / II.

7. A method for typing and identifying African swine fever virus genotypes I, II, and I / II recombinant types for non-diagnostic purposes, characterized in that, The method includes: detecting SNP site combinations; when the SNP1-16 sites are sequentially T, T, C, T, G, A, A, A, G, G, G, G, T, G, G, G, indicating African swine fever virus genotype I; when the SNP1-16 sites are sequentially G, C, T, G, A, G, G, T, A, A, A, A, C, A, A, A, indicating African swine fever virus genotype II; when the SNP1-16 sites are sequentially T, T, C, T, A, G, G, T, A, A, A, A, C, A, A, A, indicating African swine fever virus genotype I / II recombinant type. The SNP locus combination consists of 16 SNP loci, which are as follows: SNP1: Located at the 78th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / G polymorphism; SNP2: Located at the 90th nucleotide of the CDS sequence of the African swine fever virus B646L gene with gene version number NC_044956.1, it exhibits T / C polymorphism; SNP3: Located at nucleotide 132 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits C / T polymorphism; SNP4: Located at nucleotide 174 of the CDS sequence of the African swine fever virus B646L gene in gene version number NC_044956.1, it exhibits T / G polymorphism; SNP5: Located at nucleotide 308 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits G / A polymorphism; SNP6: Located at nucleotide 363 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits A / G polymorphism; SNP7: Located at nucleotide 387 of the CDS sequence of the African swine fever virus CP204L gene with gene version number NC_044957.1, it exhibits A / G polymorphism; SNP8: Located at nucleotide 392 of the CDS sequence of the African swine fever virus CP204L gene in version NC_044957.1, it exhibits an A / T polymorphism; SNP9: Located at nucleotide 678 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism; SNP10: Located at nucleotide 685 of the CDS sequence of the African swine fever virus MGF360-9L gene with gene version number NC_044956.1, it has a G / A polymorphism. SNP11: Located at nucleotide 698 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism; SNP12: Located at nucleotide 923 of the CDS sequence of the African swine fever virus MGF360-9L gene with version number NC_044956.1, it exhibits G / A polymorphism; SNP13: Located at nucleotide 1224 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits T / C polymorphism; SNP14: Located at nucleotide 1278 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism; SNP15: Located at nucleotide 1282 of the CDS sequence of the African swine fever virus MGF505-11L gene with gene version number NC_044956.1, it has a G / A polymorphism. SNP16: Located at nucleotide 1292 of the CDS sequence of the African swine fever virus MGF505-11L gene with version number NC_044956.1, it exhibits G / A polymorphism.

Citation Information

Patent Citations

  • Double-target combination, primer combination, reagent, kit and method for detecting African swine fever virus and application

    CN114774590A

  • Specific probe, gene chip, nucleic acid hybridization assembly and kit

    CN116287428A