Bicistronic constructs for allogeneic gene therapy

Abstract

The present disclosure relates to bicistronic polypeptide constructs for use in allogeneic gene therapy, such as CAR-T cell therapy. The bicistronic constructs comprise a first polynucleotide encoding a therapeutic molecule (e.g., CAR-T or an antibody) and a second polynucleotide encoding an immune surveillance masking molecule (ISMM). The ISMs comprise a human leukocyte antigen-E genetically fused to a non-functional form, such as a fragment, of a protein, such as beta-2 microglobulin or B2M, which is knocked out by insertion of the bicistronic construct. Also provided are vectors, cells (e.g., CAR-T cells) comprising the bicistronic constructs and methods of use. Kits and articles of manufacture are also provided. The present disclosure also provides four new insertion sites that can be used to insert an expression construct into the B2M gene.

Description

[0001] Cross-references and incorporation by reference to related applications

[0002] This PCT application claims priority to U.S. Provisional Application No. 63 / 491,492, filed March 21, 2023, which is incorporated herein by reference in its entirety.

[0003] Reference sequence list submitted electronically

[0004] The contents of the ST.26 sequence list (name 5064_003PC01_SequenceListing_ST26.xml; size: 158,640 bytes; and creation date: March 18, 2023), which was submitted electronically in XML format with this application, are incorporated herein by reference in their entirety. Technical Field

[0005] This disclosure provides bicistronic constructs for allogeneic gene therapy. Background Technology

[0006] Gene therapy, particularly adaptive cellular immunotherapy using immune cells expressing chimeric antigen receptors (CARs), has shown promise, especially for the treatment of malignancies. Adoptive cell therapy involves isolating immune cells, performing ex vivo manipulation, and subsequently delivering them to a patient as a therapeutic intervention. CARs combine the specificity of antibodies with the signaling domains and co-stimulatory molecules of effector cells. When constitutively expressed on the surface of immune cells via non-viral or viral transduction, CARs enable effector cells to recognize targets in an antigen-specific manner. CARs engineered to target specific tumor-associated antigens (TAAs) can then be used in anticancer therapies.

[0007] Most clinically evaluated CAR products are derived from autologous immune cells, i.e., cells collected from the patient to receive the therapy. The autologous (patient-derived) CAR T-cell paradigm has several important advantages, including the infusion of CAR-engineered cell products without immunological mismatch between donor and recipient. However, this strategy has significant clinical and economic limitations, such as the availability of facilities to perform successful leukocyte isolation and obtain cells from patients (e.g., those with relapsed / refractory malignancies), cell transport to and from processing centers, cell quality (which may have been negatively impacted by previous aggressive cancer-targeted therapies), and the time required to manufacture and test cells before clinical use. The time delay can be significant, especially in patients with aggressive relapsed / resistant cancers who are at risk of clinical deterioration, potentially excluding them from continuing CAR cell therapy. Furthermore, the production of cell products cannot be guaranteed, and for those patients who do successfully produce products, a portion of the products have limited short- or long-term efficacy. This may be partly due to the poor viability of autologous immune cells in cancer patients, especially after aggressive cancer-targeted therapies. Finally, autologous cell therapy is administered to individual patients and is associated with high costs, limiting the wider application of this therapy.

[0008] Using allogeneic cells—cells obtained from healthy donors who are not ultimately the recipients of gene therapy—has the potential to overcome many of these limitations. For example, the use of allogeneic cells makes the production of CAR-engineered cell products cost-effective, readily available, and delivers higher quality products. Healthy donor cells provide homogeneous starting material, making the fabrication and performance of the resulting cell products more predictable. Allogeneic therapies have the potential to provide “off-the-shelf” immunotherapy regimens, allowing for dosing of several patients and / or multiple doses to an individual patient from a single manufacturing run. Furthermore, by scaling up production and creating manufacturing CAR immune cell banks from healthy donors, the cost per patient will decrease while product accessibility will increase. However, allogeneic CAR cell products may potentially induce graft-versus-host disease or expose the host to immune-mediated rejection, thus limiting therapeutic efficacy. Summary of the Invention

[0009] This disclosure provides a bicistronic polynucleotide encoding (i) a therapeutic agent and (ii) an immune surveillance masking molecule (ISMM), wherein the ISMM comprises a nonfunctional peptide of β-2-microglobulin (B2M) and human leukocyte antigen (HLA). In some aspects, the therapeutic agent is a chimeric antigen receptor (CAR) comprising an antigen-binding domain that specifically binds to an epitope on a tumor antigen on a target cell. In some aspects, the antigen-binding domain comprises an antibody or an antigen-binding portion thereof. In some aspects, the tumor antigen is disialotetrahexosylganglioside GD2. In some aspects, the antibody is dartuximab or an antigen-binding portion thereof. See www.accessdata.fda.gov / drugsatfda_docs / label / 2015 / 125516s000lbl.pdf, which is incorporated herein by reference in its entirety.

[0010] In some aspects, the antibody is a single-chain variable fragment (scFv) comprising a variable region of the heavy chain (VH) and a variable region of the light chain (VL) of dataximab. In some aspects, the dataximab scFv comprises the protein sequence shown in SEQ ID NO:22. In some aspects, the antigen-binding domain cross-competes with dataximab. In some aspects, the antigen-binding domain binds to the same epitopes as dataximab. In some aspects, the antigen-binding domain comprises VH CDR3 of dataximab. In some aspects, the antigen-binding domain also comprises VH CDR1 and VH CDR2. In some aspects, VH CDR1 comprises VH CDR1 of dataximab and / or VH CDR2 comprises VH CDR2 of dataximab. In some aspects, the antigen-binding domain also comprises VL CDR1, VL CDR2, and / or VL CDR3. In some respects, VL CDR1 comprises VL CDR1 of dartuximab, VLCDR2 comprises VL CDR2 of dartuximab, and / or VL CDR3 comprises VL CDR3 of dartuximab.In some aspects, the antigen-binding domain comprises (i) VH CDR1 of SEQ ID NO:59; VH CDR2 of SEQ ID NO:63; and VH CDR3 of SEQ ID NO:67; and / or VL CDR1 of SEQ ID NO:71; VL CDR2 of SEQ ID NO:75; and VL CDR3 of SEQ ID NO:79; or (ii) VH CDR1 of SEQ ID NO:60; VH CDR2 of SEQ ID NO:64; and VH CDR3 of SEQ ID NO:68; and / or VL CDR1 of SEQ ID NO:72; VL CDR2 of SEQ ID NO:76; and VLCDR3 of SEQ ID NO:80; or (iii) VH CDR1 of SEQ ID NO:61; VH CDR2 of SEQ ID NO:65; and VHCDR3 of SEQ ID NO:69; and / or VL CDR1 of SEQ ID NO:73; SEQ ID NO:64; VH CDR2 of SEQ ID NO:65; and VHCDR3 of SEQ ID NO:69; and / or VL CDR1 of SEQ ID NO:73; SEQ ID NO:65; VH CDR2 of SEQ ID NO:65; and VHCDR3 of SEQ ID NO:69; and / or VL CDR1 of SEQ ID NO:79; SEQ ID NO:65; VH CDR2 of SEQ ID NO:65; VHCDR3 of SEQ ID NO:65; and / or VHCDR3 ...79; VH CDR2 of SEQ ID NO:79; VH CDR2 of SEQ ID VL CDR2 of SEQ ID NO:77; and VLCDR3 of SEQ ID NO:81; or (iv) VH CDR1 of SEQ ID NO:62; VH CDR2 of SEQ ID NO:66; and VHCDR3 of SEQ ID NO:70; and / or VL CDR1 of SEQ ID NO:74; VL CDR2 of SEQ ID NO:78; and VLCDR3 of SEQ ID NO:82; or (v) VH CDR1 of SEQ ID NO:53; VH CDR2 of SEQ ID NO:54; and VHCDR3 of SEQ ID NO:55; and / or VL CDR1 of SEQ ID NO:56; VL CDR2 of SEQ ID NO:57; and VLCDR3 of SEQ ID NO:58.

[0011] In some aspects, the antigen-binding domain comprises VH and VL, wherein VH comprises the protein sequence shown in SEQ ID NO:44 or VL comprises the protein sequence shown in SEQ ID NO:46. In some aspects, the antigen-binding domain comprises VH and VL, where VH comprises the protein sequence shown in SEQ ID NO:44 and VL comprises the protein sequence shown in SEQ ID NO:46. In some aspects, VH and VL are linked via a linker. In some aspects, VH and VL are linked in a VH-linker-VL or VL-linker-VH conformation. In some aspects, the linker is a Gly4-Ser linker. In some aspects, the Gly4-Ser linker comprises the sequence shown in SEQ ID NO:84. In some aspects, the CAR construct is designed as a standard CAR, a split CAR, a switch-off CAR, a switch-on CAR, a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR.

[0012] In some respects, the antigen-binding domain is an IgG NAR, Fab, Fab', F(ab)'2, F(ab)'3, Fv, single-chain variable fragment (scFv), double scFv, (scFv)2, microantibody, biantibody, triantibody, tetraantibody, intracellular antibody, disulfide-stabilized Fv protein (dsFv), monoantibody, nanobody, affinity compound, DARPin, monomeric antibody, adnectin, α-body, or a designed conjugate. In some respects, the CAR construct also includes a transmembrane domain, an intracellular domain, and a spacer region located between the antigen-binding domain and the transmembrane domain. In some respects, the intracellular domain of the CAR construct is a signal transduction domain derived from CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, or CD28. In some respects, the intracellular domain of the CAR construct is derived from CD28. In some respects, the transmembrane domain of the CAR construct is derived from CD28. In some respects, the transmembrane domain is connected to the intracellular domain via a linker. In some respects, the intracellular and transmembrane domains of the CAR construct are derived from the same molecule. In some respects, both the transmembrane and intracellular domains are derived from CD28. In some respects, the spacer region of the CAR construct is the CD8α hinge region. In some respects, the CAR construct also contains a co-stimulatory domain or a combination thereof. In some respects, the co-stimulatory domain is derived from 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, CD3ζ, and combinations thereof. In some aspects, the co-stimulatory domain includes a 4-1BB activation domain. In some aspects, the co-stimulatory domain includes a CD3ζ activation domain. In some aspects, the co-stimulatory domain includes both a 4-1BB activation domain and a CD3ζ activation domain. In some aspects, the CAR construct includes the nucleic acid sequence shown in SEQ ID NO:19. In some aspects, the CAR construct encodes the protein shown in SEQ ID NO:20.

[0013] In some aspects, the therapeutic agent includes an antibody or its antigen-binding moiety, an enzyme, a receptor, a cytokine, a clotting factor, or a hormone. In some aspects, the B2M nonfunctional peptide is a B2M nonfunctional fragment. In some aspects, the B2M nonfunctional peptide is a B2M nonfunctional variant. In some aspects, the HLA is HLA-E or HLA-G. In some aspects, the B2M peptide and HLA are linked by a linker. In some aspects, the linker is a Gly4-Ser linker. In some aspects, the Gly4-Ser linker comprises the sequence shown in SEQ ID NO:84. In some aspects of the bicistronic polynucleotides of this disclosure, (i) the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the ISMM are linked by a 2A (e.g., P2A) element; or, (ii) the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the ISMM are linked by an internal ribosome entry site (IRES).

[0014] In some aspects, the nucleic acid sequence encoding the therapeutic agent comprises the sequence shown in SEQ ID NO:5. In some aspects, the nucleic acid sequence encoding ISMM comprises the sequence shown in SEQ ID NO:6. In some aspects, the nucleic acid sequence encoding the therapeutic agent comprises the sequence shown in SEQ ID NO:5, and the nucleic acid sequence encoding ISMM comprises the sequence shown in SEQ ID NO:6. In some aspects, the bicistronic polynucleotide is selected from the group consisting of: bicistronic construct 1, bicistronic construct 2, bicistronic construct 3, bicistronic construct 4, bicistronic construct 5, bicistronic construct 6, bicistronic construct 7, or bicistronic construct 8. In some aspects, the bicistronic polynucleotide also comprises a 5' sequence complementary to the B2M gene sequence upstream of the insertion site and a 3' sequence complementary to the B2M gene sequence downstream of the insertion site. In some aspects, the 5' sequence and the 3' sequence have the same length. In some respects, the lengths of the 5' and 3' sequences are at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, and at least about 1000 nucleotides. In some respects, the bicistronic polynucleotide is selected from the group consisting of: complete donor 1, complete donor 2, complete donor 3, complete donor 4, complete donor 5, complete donor 6, complete donor 7, or complete donor 8.

[0015] In some respects, bicistronic polynucleotides are inserted into the B2M gene, and the insertion in the B2M gene inactivates the gene. In some respects, the insertion in the B2M gene is mediated by a nuclease. In some respects, the insertion in the B2M gene is mediated by a CRISPR / Cas nuclease. In some respects, the nuclease is CRISPR / Cas9.

[0016] In some respects, the insertion site in the B2M gene is at an intron position. In some respects, the insertion site in the B2M gene is at an intron-exon junction position. In some respects, the insertion site in the B2M gene is at an exon position. In some respects, the exon position is at exon 1. In some respects, the insertion site is site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1). In some respects, the exon position is at exon 2. In some respects, the insertion site is site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2) or site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3). In some respects, the exon position is at exon 3. In some respects, the insertion site is site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4). In some respects, the polynucleotide is a DNA molecule or an RNA molecule. In some respects, the CAR is an inducible CAR.

[0017] This disclosure also provides a vector comprising the bicistronic polynucleotide disclosed herein, the bicistronic polynucleotide being operatively linked to a regulatory element. In some aspects, the vector is a viral vector, a mammalian vector, or a bacterial vector. In some aspects, the vector is a retroviral vector. In some aspects, the viral vector is selected from the group consisting of: adenovirus vectors, lentiviruses, Sendai virus vectors, baculovirus vectors, Epstein-Barr virus vectors, lactopolyvacuolar virus vectors, vaccinia virus vectors, herpes simplex virus vectors, hybrid vectors, and adeno-associated virus (AAV) vectors.

[0018] This disclosure also provides a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein. A kit is also provided comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein.

[0019] Also provided are genetically modified cells for expressing therapeutic agents and ISMM, the cells comprising (i) the bicistronic polynucleotides disclosed herein, (ii) a vector comprising the bicistronic polynucleotides disclosed herein, or (iii) a composition comprising the bicistronic polynucleotides disclosed herein or a vector comprising the bicistronic polynucleotides disclosed herein. In some aspects, the cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, ILC cells, macrophages, or antigen-presenting cells. In some aspects, the cells are allogeneic. In some aspects, the genetically modified cells are part of a kit or product.

[0020] This disclosure also provides a composition comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein, or a cell comprising (i), (ii), or (iii). In some aspects, this composition is used to treat a subject in need of therapy. In some aspects, the therapy is CAR therapy. In some aspects, the composition is part of a kit or article of manufacture.

[0021] This disclosure also provides a pharmaceutical composition for treating cancer in a subject of need, wherein the pharmaceutical composition comprises genetically modified cells expressing a therapeutic agent and ISMM, the cells comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein. In some aspects, the pharmaceutical composition is part of a kit or article of manufacture.

[0022] This disclosure also provides a pharmaceutical composition for treating cancer in a subject of need, wherein the pharmaceutical composition comprises

[0023] (i) The bicistronic polynucleotides disclosed herein;

[0024] (ii) A vector containing the bicistronic polynucleotide disclosed herein;

[0025] (iii) A composition comprising a bicistronic polynucleotide disclosed herein or a carrier comprising a bicistronic polynucleotide disclosed herein; or

[0026] (iv) A cell comprising any one of (i), (ii) or (iii).

[0027] The following uses are also provided as medicine:

[0028] (i) The bicistronic polynucleotides disclosed herein;

[0029] (ii) a vector containing the bicistronic polynucleotide of (i);

[0030] (iii) A composition comprising (i) or (ii);

[0031] (iv) A kit comprising (i), (ii) or (iii);

[0032] (v) A cell that contains any one of (i), (ii) or (iii);

[0033] (vi) A composition comprising (v);

[0034] (vii) A pharmaceutical composition comprising (i), (ii), (iii), (v), or (vi); or

[0035] (viii) Kit, which contains (v), (vi) or (vii).

[0036] The following are also provided as uses of the medicine for treating cancer or inflammatory diseases or conditions in subjects in need:

[0037] (i) The bicistronic polynucleotides disclosed herein;

[0038] (ii) a vector containing the bicistronic polynucleotide of (i);

[0039] (iii) A composition comprising (i) or (ii);

[0040] (iv) A kit comprising (i), (ii) or (iii);

[0041] (v) A cell that contains any one of (i), (ii) or (iii);

[0042] (vi) A composition comprising (v);

[0043] (vii) A pharmaceutical composition comprising (i), (ii), (iii), (v), or (vi); or

[0044] (viii) Kit, which contains (v), (vi) or (vii).

[0045] The following uses are also provided for the manufacture of medicines for the treatment of cancer or inflammatory diseases or conditions in subjects in need:

[0046] (i) The bicistronic polynucleotides disclosed herein;

[0047] (ii) a vector containing the bicistronic polynucleotide of (i);

[0048] (iii) A composition comprising (i) or (ii);

[0049] (iv) A kit comprising (i), (ii) or (iii);

[0050] (v) A cell that contains any one of (i), (ii) or (iii);

[0051] (vi) A composition comprising (v);

[0052] (vii) A pharmaceutical composition comprising (i), (ii), (iii), (v), or (vi); or

[0053] (viii) Kit, which contains (v), (vi) or (vii).

[0054] This disclosure also provides a method for stimulating a subject to a T-cell-mediated immune response against a target cell population or tissue, the method comprising administering to the subject an effective amount of cells containing the bicistronic polynucleotide disclosed herein. A method for providing antitumor immunity to a subject in need is also provided, the method comprising administering to the subject an effective amount of cells containing the bicistronic polynucleotide disclosed herein. This disclosure provides a method for treating cancer in a subject in need, the method comprising administering to the subject an effective amount of cells containing the bicistronic polynucleotide disclosed herein.

[0055] This disclosure provides a method for preparing a cell population for a therapy, the method comprising transducing a cell population isolated from a subject using a bicistronic polynucleotide, vector, or composition disclosed herein. In some aspects, transduction includes culturing the cells under suitable conditions. In some aspects, the therapy is an allogeneic cell therapy.

[0056] This disclosure provides a method for generating a durable population of genetically engineered cells in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject genetically engineered cells expressing the bicistronic polynucleotide disclosed herein. A method for expanding a population of genetically engineered cells in a subject diagnosed with cancer or an inflammatory disease is also provided, the method comprising administering to the subject genetically engineered cells expressing the bicistronic polynucleotide disclosed herein. In some aspects, the cells are T cells. In some aspects, the T cells are allogeneic T cells. In some aspects, the subject is a human subject.

[0057] This disclosure also provides a method for generating allogeneic cells for gene therapy, the method comprising inserting a bicistronic construct comprising a nucleic acid encoding a therapeutic agent and a nucleic acid encoding ISMM into the B2M gene, wherein the insertion of the bicistronic construct inactivates the B2M gene. In some aspects, the nucleic acid encoding ISMM comprises a nucleic acid encoding an HLA selected from HLA-E or HLA-G or functional variants thereof. In some aspects, the gene therapy is CAR-T therapy. In some aspects, the insertion site in the B2M gene is selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); or site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4). In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides upstream or downstream of the 5' or 3' end of site 1, site 2, site 3, or site 4. In some respects, the insertion site is an insertion site that overlaps with site 1, site 2, site 3, or site 4. In some respects, the insertion site is located at a corresponding position on the antiparallel strand.

[0058] This disclosure provides an allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding HLA-E has been replaced by a nucleic acid sequence encoding HLA-G. In some aspects, this disclosure provides an allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding a B2M fragment has been replaced by a nucleic acid sequence encoding a TRAC fragment, and wherein the bicistronic construct is inserted into the TRAC gene. In some aspects, this disclosure provides an allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7 or BC8, wherein the nucleic acid sequence encoding the B2M fragment has been replaced by a nucleic acid sequence encoding the CD52 fragment, and wherein the bicistronic construct is inserted into the CD52 gene.

[0059] This disclosure provides a kit comprising gRNA for CRISPR / Cas9-mediated insertion into B2M, wherein the gRNA is selected from site 1 gRNA (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 gRNA (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 gRNA (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); and site 4 gRNA (GAGACATGTAAGCAGCATCA; SEQ ID NO:4). Attached Figure Description

[0060] Figure 1 The sequence of the four B2M insertion sites disclosed in this paper is shown, along with a schematic representation indicating the location of each insertion site on the B2M gene.

[0061] Figures 2A to 2E Density maps of flow cytometry measurements performed to measure cell surface expression levels of B2M and HLA-A / B / C are shown. Figure 2A The control cells (simulated control) maintained the integrity of the endogenous B2M locus. Figure 2B Disruption of the endogenous B2M locus using a CRISPR reagent targeting site 1 (SEQ ID NO:1). Figure 2C Disruption of the endogenous B2M locus using a CRISPR reagent targeting site 2 (SEQ ID NO:2). Figure 2D Disruption of the endogenous B2M locus using a CRISPR reagent targeting site 3 (SEQ ID NO:3). Figure 2E Disruption of the endogenous B2M locus using a CRISPR reagent targeting site 4 (SEQ ID NO:4).

[0062] Figure 3A and 3B A schematic representation of CAR and HLA-E elements used to design bicistronic constructs is shown. Figure 3A This is a schematic representation of the anti-GD2scFv+CD8aH+CD28TM / IC+4-1BBAD+CD3ζAD chimeric antigen receptor (anti-GD2 CAR, SEQ ID NO:5) component of the bicistronic construct. From the N-terminus to the C-terminus, the CAR component (labeled “CAR”) contains the following operatively linked elements following the signal peptide: (1) anti-GD2 scFv derived from dartuximab; (2) CD8α hinge region; (3) CD28 transmembrane domain (TM) and CD28 intracellular domain co-labeled as CD28; (4) 4-1BB activation domain; and (5) CD3ζ activation domain. Figure 3A This is a schematic representation of the B2M+HLA-E immune surveillance masking molecule (ISMM) (SEQ ID NO:6) component of the bicistronic construct. The ISMM component (labeled "HLA-E") contains, from the N-terminus to the C-terminus, a nonfunctional fragment of the β-2 microglobulin gene (B2M), a 4-repeated Gly4-Ser adapter (i.e., (Gly4Ser)4), and mature human leukocyte antigen-E (HLA-E).

[0063] Figure 3C This is a schematic representation of the overall strategy for inserting a bicistronic construct containing an ISMM and a CAR element separated by a P2A element or IRES into a specific location of the B2M gene in donor cells using CRISPR / Cas and homologous recombination. The result would be donor cells (allogeneic cells) available for CAR T-cell therapy that have an inactivated B2M gene, which would reduce allogeneic response, but would have HLA-E expression, which would protect the cells from allogeneic natural killer (NK) cell-mediated lysis.

[0064] Figure 4A and 4B A schematic representation of the bicistronic construct used for insertion at B2M site 1 is shown. Figure 4A Corresponding to the bicistronic construct 1 (BC1), it has a 2A (P2A) element between the ISMM and CAR component of the construct. Figure 4B Corresponding to the bicistronic construct 2 (BC2), it has an IRES element between the ISMM and CAR components of the construct.

[0065] Figure 5A and 5B A schematic representation of the bicistronic construct for insertion at B2M site 2 or 3 is shown. Figure 5A It corresponds to the bicistronic construct 3 (BC3) when inserted at site 2 or the bicistronic construct 5 (BC5) when inserted at site 3, and has a 2A (P2A) element between the ISMM and CAR component of the construct. Figure 5B It corresponds to the bicistronic construct 4 (BC4) when inserted at site 2 or the bicistronic construct 5 (BC6) when inserted at site 3, and has an IRES element between the ISMM and the CAR component of the construct.

[0066] Figure 6A and 6B A schematic representation of the bicistronic construct used for insertion at B2M site 4 is shown. Figure 6A Corresponding to the bicistronic construct 7 (BC7), it has a 2A (P2A) element between the ISMM and CAR components of the construct. Figure 6B Corresponding to the bicistronic construct 8 (BC8), it has an IRES element between the ISMM and CAR components of the construct.

[0067] Figure 7A and 7B The diagram shows a schematic representation of complete donors generated from BC1 and BC2, named complete donor 1 (FD1) and complete donor 2 (FD2), respectively. They were generated by adding 1,000 bp of B2M gene flanking CRISPR site 1 (500 bp on each side) to generate homologous arms, thereby driving site-specific recombination within the frame.

[0068] Figure 8A and Figure 8B The diagram shows a schematic representation of complete donors generated from BC3, BC4, BC5, and BC6, named Complete Donor 3 (FD3), Complete Donor 4 (FD4), Complete Donor 5 (FD5), and Complete Donor 6 (FD6), respectively. These complete donors are generated by adding 1,000 bp B2M genes (500 bp on each side) flanking CRISPR site 2 or site 3 to generate homologous arms, thereby driving site-specific recombination within the frame.

[0069] Figure 9A and Figure 9B The diagram shows a schematic representation of complete donors generated from BC7 and BC8, named complete donor 7 (FD7) and complete donor 8 (FD8), respectively. They were generated by adding 1,000 bp of B2M gene flanking CRISPR site 4 (500 bp on each side) to generate homologous arms, thereby driving site-specific recombination within the frame.

[0070] Figures 10A to 10D Density maps of flow cytometry measurements performed to measure cell surface expression levels of HLA-A / B / C and HLA-E are shown. Figure 10A Untreated control cells (simulated control). Figure 10B FD2 is inserted at site 1 of the B2M gene. Figure 10C FD6 is inserted at site 3 of the B2M gene. Figure 10D FD8 was inserted at site 4 of the B2M gene.

[0071] Figures 11A to 11D Density maps of flow cytometry measurements performed to measure cell surface expression levels of HLA-A / B / C and HLA-E are shown. Figure 11A Untreated control cells (simulated control). Figure 11B FD1 is inserted at site 1 of the B2M gene. Figure 11C FD5 is inserted at site 3 of the B2M gene. Figure 11D FD6 is inserted at site 3 of the B2M gene.

[0072] Figure 12 The graph shows the percentage change (%) of CHP-134 neuroblastoma cells presented 24 hours after co-culture with transformed T cells at different ratios (1:1, 2:1, 4:1, or 10:1). All transformed T cells used in the experiment contained a bicistronic construct targeting B2M insertion site 1 (i.e., bicistronic construct 1), which has the CAR portion and ISMM portion of the construct linked by 2A elements (P2A) (see [link to experimental data]). Figure 4A ).

[0073] Figure 13 The graph shows the percentage change (%) of CHP-134 neuroblastoma cells presented 24 hours after co-culture with transformed T cells at different ratios (1:1, 2:1, 4:1, or 10:1). All transformed T cells used in the experiment contained a bicistronic construct (bicistronic construct 5) targeting the B2M insertion site 3, which has the CAR portion and ISMM portion of the construct linked by a 2A element (P2A) (see [link to experimental data]). Figure 5A ).

[0074] Figure 14 The graph shows the percentage change (%) of CHP-134 neuroblastomas presented during 24 hours after co-culture with transformed T cells at different ratios (1:1, 2:1, 4:1, or 10:1). All transformed T cells used in the experiment contained a bicistronic construct (bicistronic construct 6) targeting the B2M insertion site 3, which has the CAR portion and ISMM portion of the construct linked via IRES (see [link to IRES]). Figure 5B ). Detailed Implementation

[0075] This disclosure provides a bicistronic polynucleotide encoding (i) a therapeutic agent and (ii) an immune surveillance masking molecule (ISMM), wherein the ISMM comprises a nonfunctional β-2-microglobulin (B2M) polypeptide and human leukocyte antigen (HLA). As used herein, the terms “immune surveillance masking molecule” and “ISMM” refer to a polynucleotide construct and its polypeptide product, such as a construct encoding a nonfunctional B2M polypeptide (e.g., a nonfunctional fragment or a nonfunctional variant thereof) and an HLA polypeptide or a functional fragment or a functional variant thereof, wherein expression of the construct reduces immunogenicity.

[0076] β-2-microglobulin (abbreviated "B2M") is a serum protein associated with the major histocompatibility complex (MHC) class I heavy chain on the surface of almost all nucleated cells. Inactivation of the B2M gene can prevent infused T cells from presenting allogeneic antigens. Due to the lack of functional B2M, the recognition of allogeneic CAR T cells by recipient T cells via HLA / MHC interactions is impaired. However, the loss of functional B2M expression in engineered T cells can trigger an immune response because they can still be recognized as foreign cells. For this reason, the bicistronic construct of this disclosure, in addition to inactivating B2M via its insertion into the B2M gene, includes a polynucleotide sequence encoding HLA-E (or alternatively, HLA-G).

[0077] HLA class I histocompatibility antigen α chain E, also known as MHC class I antigen E (abbreviated as "HLA-E"), is a protein encoded by the HLA-E gene in humans. Human HLA-E is a non-classical MHC class I molecule common to all humans, characterized by limited polymorphism and lower cell surface expression than its classical paralogs.

[0078] Expression of a construct encoding a partially but inactive B2M fused within the HLA-E molecular frame allows the immune system to perceive that genetically engineered cells, although not expressing B2M, are still human and not dangerous. Because CAR-T cells expressing the HLA-E molecule are not considered foreign despite the lack of functional B2M expression, they do not trigger an immune response, particularly the self-destructive killing of lysed NK cells induced by the "missing cell" mechanism.

[0079] Inserting the bicistronic polynucleotide of this disclosure into a specific insertion site in the B2M gene accomplishes two important tasks. First, the insertion of the bicistronic polynucleotide inactivates the B2M gene, thus generating cells that can be used for allogeneic therapies (e.g., for CAR-T gene therapy or gene replacement therapy). For example, inserting a CAR targeting a certain type of cancer into the B2M gene, or inserting a functional copy of the gene to compensate for the presence of a defective gene (e.g., clotting factors, enzymes, or hormones). Second, it simplifies the generation of allogeneic cells for gene therapy because the inactivation of B2M and the insertion of the therapeutic gene occur in the same operation. Furthermore, the insertion of the bicistronic polynucleotide into the existing B2M gene results in an expression process controlled by the endogenous B2M promoter, avoiding the need to provide an exogenous promoter. As a result of using the B2M promoter, the regulatory signals controlling B2M expression and homeostasis can also regulate the expression of the engineered bicistronic construct of this disclosure, which is not expressed at excessively high or low levels, as would be the case if the expression of the bicistronic construct were under the control of an exogenous promoter.

[0080] It is noteworthy that the use of 2A elements (e.g., P2A) to separate the therapeutic agents (e.g., the CAR portion of the construct) and the ISMM portion of the bicistronic polynucleotides disclosed herein has been observed to have a significantly positive effect on expression compared to the use of IRES.

[0081] The cell engineering methods presented herein for generating allogeneic cells can be extended beyond B2M. These methods can be used, for example, to insert similar bicistronic peptides into alternative or additional genes that can be knocked out to generate allogeneic cells. For example, the bicistronic constructs disclosed herein can be inserted into the T-cell receptor α constant gene (TRAC), the programmed cell death protein 1 gene (PDCD1, also known as PD-1 or CD279), the CD52 gene, the SAG gene (S-arrestin), or any combination thereof. Therefore, in some aspects, the methods disclosed herein can be used to insert one or more bicistronic polynucleotides at one or more locations in the B2M, TRAC, PDCD1, SAG, or CD52 genes, or combinations thereof. These methods can also be used, for example, to insert similar bicistronic peptides into additional genes (e.g., CD5) that are typically knocked out to increase the potency of allogeneic cells. Therefore, in some aspects, the methods disclosed herein can be used to insert one or more bicistronic polynucleotides at one or more locations in the CD5 gene.

[0082] Similarly, the disclosed cell engineering methods for generating allogeneic cells expressing CAR can be extended to other therapeutic proteins, such as antibodies, enzymes, and coagulation factors. Likewise, the cell engineering methods disclosed herein can be used to generate allogeneic cells containing polycistronic polynucleotides comprising one or more ISMMs (e.g., an ISMM containing HLA-E and a second ISMM containing HLA-G) and one or more therapeutic proteins (e.g., the heavy and light chains of an antibody, or multiple subunits of a therapeutic protein).

[0083] Before describing this disclosure in detail, it should be understood that this disclosure is not limited to the specific compositions or process steps described, and that such compositions or process steps may vary. As will be apparent to those skilled in the art upon reading this disclosure, each of the aspects described and illustrated herein has discrete components and features that can be readily separated from or combined with features of any of the other aspects without departing from the scope or spirit of this disclosure. Any described method may be performed in the order of the described events or in any other logically possible order.

[0084] The headings provided herein are not intended to limit the various aspects of this disclosure, which can be defined by referring to the entire specification. It should also be understood that the terminology used herein is for describing particular aspects only and is not intended to be restrictive, as the scope of this disclosure will be limited only by the appended claims.

[0085] Therefore, the terms defined below are defined more fully by referring to the full text of this specification.

[0086] I. Definition

[0087] To facilitate understanding of this specification, certain terms are defined first. Additional definitions are set forth throughout the detailed implementation.

[0088] It should be noted that the term "a / an" refers to one or more of the entities; for example, "a nucleotide sequence" should be understood to represent one or more nucleotide sequences. Therefore, the terms "a / an," "one or more," and "at least one" are used interchangeably herein. It should also be noted that claims can be drafted to exclude any optional elements. Therefore, this statement is intended to serve as a precondition for the use of exclusive terms such as "only" or "just" or negative limitations related to the recitation of the claim elements.

[0089] Furthermore, the term “and / or” as used herein should be considered as a specific disclosure of each of two specified features or components having or not having the other feature or component. Therefore, the term “and / or” as used in phrases such as “A and / or B” herein is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Similarly, the term “and / or” as used in phrases such as “A, B and / or C” is intended to cover each of the following: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0090] It should be understood that, regardless of which aspect is described in this document using the language "including", other similar aspects described according to "consisting of" and / or "substantially consisting of" are also provided.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art relating to this disclosure. For example, *Concise Dictionary of Biomedicine and Molecular Biology*, Juo, Pei-Show, 2nd ed., 2002, CRC Press; *The Dictionary of Cell and Molecular Biology*, 3rd ed., 1999, Academic Press; and *Oxford Dictionary of Biochemistry and Molecular Biology*, Revised, 2000, Oxford University Press provide a general dictionary for those skilled in the art of the use of many of the terms used in this disclosure.

[0092] Units, prefixes, and symbols are represented in a form recognized by the International System of Units (SI). Numerical ranges include the numbers defining the range. In enumerating numerical ranges, it should be understood that each intermediate integer value between the upper and lower limits of the range, each fraction thereof, and each subrange between these values ​​is also specifically disclosed. The upper and lower limits of any range may be independently included in or excluded from the range, and every range that includes either of the two limits, excludes neither limit, or includes both limits is also covered in this disclosure. Therefore, the ranges enumerated herein are understood to be abbreviations of all values ​​within the range, including the enumerated endpoints. For example, the range 1 to 10 should be understood to include any number, combination of numbers, or subrange of numbers derived from groups consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0093] Where values ​​are explicitly listed, it should be understood that values ​​of approximately the same quantity or amount as the listed values ​​are also within the scope of this disclosure. Where combinations are disclosed, each sub-combination of the elements of that combination is also specifically disclosed, and that sub-combination is within the scope of this disclosure. Conversely, where different elements or groups of elements are disclosed individually, their combinations are also disclosed. Where any disclosed element is disclosed as having multiple alternatives, examples of this disclosure in which each alternative is excluded individually or in any combination with other alternatives are also disclosed; more than one element of this disclosure may have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.

[0094] Nucleotides are designated by their recognized single-letter codes. Unless otherwise specified, nucleotide sequences are written from left to right in a 5' to 3' orientation. Nucleotides are designated herein by the well-known single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Thus, "a" represents adenine, "c" represents cytosine, "g" represents guanine, "t" represents thymine, and "u" represents uracil.

[0095] Approximately: The term “approximately” is used herein to mean approximately, roughly, about, or within a range. When the term “approximately” is used in conjunction with a numerical range, it modifies the range by extending the boundaries above and below the stated value. Typically, the term “approximately” can modify the values ​​above and below the stated value by, for example, an upward or downward (increase or decrease) variance of 10%.

[0096] Administration: The terms “administration,” “application,” and their grammatical variations refer to the introduction of a composition comprising a bicistronic polynucleotide (e.g., a polynucleotide, a carrier, or cells) disclosed herein into a subject via a pharmaceutically acceptable route. The composition may be introduced into a subject via any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intrathecal, intratumoral, periorbital, or topical administration. Administration includes self-administration and administration by another person. A suitable route of administration allows the composition or agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein in the subject. In some respects, cells are administered. In some respects, cells may be implanted.

[0097] Antibody: As used herein, the term "antibody" (Ab) refers to, but is not limited to, a glycoprotein immunoglobulin or its antigen-binding moiety that specifically binds to an antigen and comprises at least two heavy (H) chains and two light (L) chains linked by disulfide bonds. Each H chain contains a heavy chain variable region (abbreviated as V in this document). H The heavy-chain constant region contains three constant structural domains, namely C H1 C H2 and C H3 Each light chain contains a light chain variable region (abbreviated as V in this article). L () and the light chain constant region. The light chain constant region contains a constant structural domain C L V H and V L The region can be further subdivided into highly variable regions (called complementary determinant regions (CDRs)), which are interspersed with more conservative regions (called frame regions (FRs)). Each V H and V LContaining three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant regions of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. Thus, for example, the term "anti-GD2 antibody" includes, for instance, a complete antibody having two heavy chains and two light chains that specifically bind to GD2, and an antigen-binding portion of the complete antibody. Non-limiting examples of antigen-binding portions are shown elsewhere herein. In some aspects of this disclosure, the anti-GD2 antibody is dartuximab. Or its antigen-binding portion.

[0098] Recently, various recombinant antibody forms have been developed, such as trivalent or quadrivalent bispecific antibodies. Examples include IgG antibody forms and single-chain domain fusions (see examples for different forms: Coloma, MJ, et al., Nature Biotech 15 (1997), 159-163; WO 2001 / 077342; Morrison, SL., Nature Biotech 25 (2007), 1233-1234; Holliger, P. et al., Nature Biotech. 23 (2005), 1126-1136; Fischer, N., and Leger, O., Pathobiology 74 (2007), 3-14; Shen, J., et al., J. Immunol. Methods 318 (2007), 65-74; Wu, C. et al., Nature Biotech. 25 (2007), 1290-1297). Bispecific antibodies include trivalent or tetravalent bispecific antibodies produced according to the methods disclosed below; WO2009 / 080251; WO2009 / 080252; WO 2009 / 080253; WO2009 / 080254; WO2010 / 112193; WO2010 / 115589; WO2010 / 136172; WO2010 / 145792; WO2010 / 145793 and WO2011 / 117330, all of which are incorporated herein by reference in their entirety. Those skilled in the art will understand that higher valence states may also be used.

[0099] Antigen: The term "antigen" refers to a molecule that elicits an immune response. This immune response may involve antibody production or activation of specific immune-active cells, or both. Those skilled in the art will understand that any macromolecule (including almost all proteins or peptides) can be used as an antigen. Furthermore, antigens can be derived from recombinant DNA or genomic DNA.

[0100] Antigen-binding moiety: The “antigen-binding moiety” (also known as the “antigen-binding fragment”) of an antibody refers to one or more fragments of the antibody that retain the ability to specifically bind to an antigen bound by the whole antibody. It has been shown that the antigen-binding function of an antibody can be performed by fragments of the full-length antibody. Examples of binding fragments encompassed within the “antigen-binding moiety” of the term antibody (e.g., anti-GD2 antibody) include (i) Fab fragments (fragments derived from papain cleavage) or similar monovalent fragments, which are composed of V… L V H (ii) F(ab')2 fragments (from pepsin-cleaved fragments) or similar bivalent fragments containing two Fab fragments connected by disulfide bridges in the hinge region; (iii) Fd fragments, which consist of V H (iv) The Fv fragment, which consists of the V arm of the antibody, and the CH1 domain; L and V H The domain is composed of (v)dAb fragments (Ward et al., (1989) Nature 341:544-546), which are composed of V H The structural domains consist of: (vi) separate complementarity-determining regions (CDRs) and (vii) combinations of two or more separate CDRs, which may optionally be connected by a synthesis joint. Furthermore, although the two structural domains V of the Fv segment... L and V H Encoded by individual genes, but which can be linked together using recombination methods via synthetic adapters that allow them to be made into single protein chains, where V L and V H Regions pair to form monovalent molecules (called single-chain Fvs (scFvs); see, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding moiety" of antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and their utility is screened in the same manner as for intact antibodies. The antigen-binding moiety can be generated by recombinant DNA technology or by enzymatic or chemical cleavage of intact immunoglobulins.

[0101] Approximation: As used herein, when applied to one or more values ​​of interest, the term "approximation" means a value that is similar to the reference value. In some respects, the term "approximation" refers to a range of values ​​that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater or less than the reference value), unless otherwise stated or obvious from the context (unless such a number would exceed 100% of the possible values).

[0102] CAR: The term "chimeric antigen receptor" or alternatively "CAR" refers to a group of polypeptides, typically two polypeptides in their simplest form, that, in immune effector cells, provide specificity for target cells (usually cancer cells) and facilitate intracellular signaling. In some aspects, a CAR comprises at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also called an "intracellular signaling domain") containing functional signaling domains derived from stimulatory and / or co-stimulatory molecules as defined below. In some aspects, the group of polypeptides is in the same polypeptide chain, e.g., comprising a chimeric fusion protein. In some aspects, the group of polypeptides is discontinuous, e.g., in different polypeptide chains. In some aspects, the group of polypeptides includes a dimerization switch that can couple the polypeptides together in the presence of a dimerizing molecule, e.g., coupling the antigen-binding domain to the intracellular signaling domain. In some aspects, the stimulatory molecule of the CAR is a ζ-chain associated with the T-cell receptor complex (CD3ζ). In some aspects, the cytoplasmic signaling domain includes a primary signaling domain (e.g., the primary signaling domain of CD3ζ). In some aspects, the cytoplasmic signaling domain also includes one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In some aspects, the costimulatory molecule is selected from the costimulatory molecules described herein, such as 4-1BB, CD27, and / or CD28.

[0103] In some aspects, a CAR comprises a chimeric fusion protein comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from a stimulating molecule, wherein the antigen-binding domain and the transmembrane domain are connected via a CAR spacer region. In some aspects, a CAR comprises a chimeric fusion protein comprising an antigen-binding domain and an intracellular signaling domain connected via a CAR spacer region and a transmembrane domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from a co-stimulatory molecule and a functional signaling domain derived from a stimulating molecule. In some aspects, a CAR comprises a chimeric fusion protein comprising an antigen-binding domain and an intracellular signaling domain connected via a CAR spacer region and a transmembrane domain, wherein the intracellular signaling domain comprises two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulating molecule. In some aspects, the CAR comprises a chimeric fusion protein including an antigen-binding domain and an intracellular signaling domain connected via a CAR spacer region to a transmembrane domain. The intracellular signaling domain includes at least two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulatory molecule. In some aspects, the CAR includes an optional leader sequence at the N-terminus (N-terminus) of the CAR. In some aspects, the CAR also includes a leader sequence at the N-terminus of the antigen-binding domain, wherein the leader sequence is optionally cleaved from the antigen-binding domain (e.g., scFv) during cellular processing and localization of the CAR to the cell membrane.

[0104] CDR: As used herein, the term “complementarity-determining region” or “CDR” refers to the amino acid sequence within the variable region of an antibody that confers antigen specificity and binding affinity. For example, typically three CDRs are present in each heavy chain variable region (e.g., HCDR1, HCDR2, and HCDR3), and three CDRs are present in each light chain variable region (LCDR1, LCDR2, and LCDR3). The precise amino acid sequence boundaries of a given CDR can be determined using any of many well-known schemes, including those described below: Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (“Kabat” numbering scheme), Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme), or combinations thereof. According to the Kabat numbering scheme, in some embodiments, the CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the light chain variable domain (VL) are numbered 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3). According to the Chothia numbering scheme, in some embodiments, the CDR amino acids in the VH are numbered 26-32 (HCDR1), 52-56 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the VL are numbered 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3). In combined Kabat and Chothia numbering schemes, in some embodiments, CDR corresponds to amino acid residues that are part of a Kabat CDR, a Chothia CDR, or both. For example, in some embodiments, CDR corresponds to amino acid residues 26-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3) in VH (e.g., mammalian VH, e.g., human VH); and amino acid residues 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) in VL (e.g., mammalian VL, e.g., human VL).

[0105] Complementary sequence: As used herein, the term “complementary sequence” refers to a sequence complementary to a reference sequence. Complementarity is a well-known fundamental principle of DNA replication and transcription because it is a property shared between two DNA or RNA sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequence will be complementary, much like looking in a mirror and seeing the opposite side of something. Therefore, for example, the complementary sequence of 5'“ATGC”3' can be written as 3'“TACG”5' or 5'“GCAT”3'. As used herein, the terms “reverse complementary sequence,” “reverse complementary,” and “reverse complementarity” are interchangeable with the terms “complementary sequence,” “complementary,” and “complementarity.” In some respects, the term “complementary” refers to a 100% match or complementarity with a consecutive nucleic acid sequence (i.e., complete complementarity). In some respects, the term “complementary” refers to a match or complementarity with a continuous nucleic acid sequence of at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0106] Complementary: The terms "complementary" and "complementarity" refer to two or more polynucleotides (i.e., each containing a nucleobase sequence) that are related to each other by the Watson-Crick base pairing rule. For example, the nucleobase sequence "TGA(5'→3')" is complementary to the nucleobase sequence "ACT(3'→5')". Complementarity can be "partial," where fewer than all the nucleobases of a given polynucleotide sequence match another polynucleotide sequence according to the base pairing rule. For example, in some respects, the complementarity between a given polynucleotide sequence and another polynucleotide sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. On the other hand, "complete" or "perfect" (100%) complementarity can exist between a given polynucleotide sequence and another polynucleotide sequence to continue the instance. The degree of complementarity between polynucleotide sequences has a significant impact on the efficiency and strength of hybridization between sequences.

[0107] Conservative: As used herein, the term "conservative" refers to nucleotides in a polynucleotide sequence that appear unchanged at the same position in two or more sequences being compared. Relatively conserved nucleotides are those that are more conserved in a more relevant sequence than nucleotides that appear elsewhere in the sequence.

[0108] Corresponding to: When referring to two separate nucleic acid or nucleotide sequences, the term "corresponding to" or "corresponds to" can be used to clarify regions of sequences that correspond or are similar to each other based on homology and / or functionality, although the nucleotides of a particular sequence may be numbered differently. Furthermore, it should be recognized that different numbering systems may be used when characterizing nucleic acid or nucleotide sequences. Additionally, it should be recognized that the nucleic acid or nucleotide sequences of different variants of a nucleic acid may differ. However, as used herein, regions of variants that share nucleic acid or nucleotide sequence homology and / or functionality are considered to "correspond" to each other.

[0109] Derived from: As used herein, the terms “derived from” or “derived from” refer to a component isolated from or made using a particular molecule or information derived from a particular molecule (e.g., a nucleic acid sequence). For example, a polynucleotide sequence derived from another polynucleotide sequence may include a polynucleotide sequence that is identical or substantially similar to the polynucleotide sequence from which it is derived. In the case of polynucleotides, derivative species can be obtained, for example, through naturally occurring mutations, artificially directed mutations, or artificially random mutations. Mutations used to derive polynucleotides can be intentionally directed or intentionally random, or a mixture of each. Mutating a polynucleotide to produce a different polynucleotide derived from a first polynucleotide can be a random event (e.g., caused by insufficient polymerase fidelity), and the identification of the derived polynucleotide can be performed using appropriate screening methods known in the art. In some aspects, the polynucleotide sequences derived from the first polynucleotide sequence have a percentage, respectively, of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, and at least Sequence identity of approximately 75%, at least approximately 76%, at least approximately 77%, at least approximately 78%, at least approximately 79%, at least approximately 80%, at least approximately 81%, at least approximately 82%, at least approximately 83%, at least approximately 84%, at least approximately 85%, at least approximately 86%, at least approximately 87%, at least approximately 88%, at least approximately 89%, at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or approximately 100%, wherein the derived polynucleotide sequence retains the biological activity of the original polynucleotide.

[0110] Downstream / Upstream: The term "downstream" refers to the nucleotide sequence located at the 3' end of the reference nucleotide sequence. In some respects, the downstream nucleotide sequence involves sequences following the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site. The term "upstream" refers to the nucleotide sequence located at the 5' end of the reference nucleotide sequence.

[0111] Encoding: The term "encoding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA, or mRNA) as a template for the synthesis of other polymers and macromolecules having a defined nucleotide sequence (e.g., rRNA, tRNA, and mRNA) or a defined amino acid sequence in biological processes, and the resulting biological characteristics. Therefore, if the transcription and translation of mRNA corresponding to a gene produces a protein in a cell or other biological system, then that gene, cDNA, or RNA encodes a protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence listing) and the non-coding strand (which serves as a template for the transcription of the gene or cDNA) can be referred to as encoding the protein or other product of that gene or cDNA.

[0112] Unless otherwise stated, a nucleotide sequence that “encodes” an amino acid sequence (e.g., a polynucleotide that “encodes” the CAR of this disclosure) includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence.

[0113] Epitope: As used herein, the term "epitaxy" refers to a portion of an antigen that specifically interacts with an antibody molecule. Such portions (referred to herein as epitope determinants) typically contain elements (such as amino acid or sugar side chains) or are part of such elements. Epitope determinants can be defined, for example, by methods known in the art (e.g., by crystallography or by hydrogen-deuterium exchange). At least one or more portions of an antibody molecule that specifically interact with an epitope determinant are typically located in a CDR. Typically, epitopes have specific three-dimensional structural features. Typically, epitopes have specific charge features. Some epitopes are linear epitopes, while others are conformational epitopes.

[0114] Expression: As used herein, the term “expression” refers to the process by which polynucleotides produce gene products (e.g., RNA or polypeptides). This includes, but is not limited to, the transcription of polynucleotides into messenger RNA (mRNA) and the translation of mRNA into polypeptides. Expression produces “gene products.” As used herein, gene products can be nucleic acids (e.g., messenger RNA produced through gene transcription) or polypeptides translated from transcripts. In some respects, the term “expression” is used to refer to transcription and translation occurring within a cell. The expression level of the product gene in the host cell can be determined based on the amount of corresponding mRNA present in the cell or the amount of protein encoded by the product gene produced by the cell, or both.

[0115] Fragment: As used herein, the term "fragment" (e.g., B2M fragment) refers to a polynucleotide or polypeptide sequence that is shorter than a naturally occurring gene or protein. For example, in a polynucleotide fragment, a portion of the polynucleotide sequence is missing compared to a naturally occurring polynucleotide. Similarly, in a polypeptide fragment, a portion of the polypeptide sequence is missing compared to a naturally occurring polypeptide.

[0116] Functional / Non-functional Fragments: As used herein, the term "functional fragment" refers to a polynucleotide fragment or a polypeptide encoded by such a polynucleotide fragment, such as a fragment of a B2M gene or a fragment of a B2M protein that at least partially retains the function of the complete gene or protein. Thus, in some respects, the functional fragments of the B2M protein disclosed herein retain the ability to associate with the major histocompatibility complex (MHC) class I heavy chain. Conversely, "non-functional fragments" lack one or more functional features of the parent molecule.

[0117] Whether the fragments of the B2M promoter disclosed herein are functional or non-functional can be assessed by any method known in the art without excessive experimentation. In some aspects, functional fragments retain, for example, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the intact B2M protein's ability to associate with the major histocompatibility complex (MHC) class I heavy chain. In some aspects, non-functional fragments retain, for example, less than about 20%, less than about 10%, less than about 5%, or completely lack the ability of the intact B2M protein to associate with the major histocompatibility complex (MHC) class I heavy chain.

[0118] Functional Variant / Non-functional Variant: As used herein, the term "functional variant" refers to a polynucleotide variant or polypeptide (i.e., a mutant molecule with one or more substitutions, deletions, or insertions) encoded by such a polynucleotide variant, such as a variant of the B2M gene or a variant of the B2M protein, which at least partially retains the function of the complete gene or protein. Thus, in some aspects, the functional variants of the B2M protein disclosed herein retain the ability to associate with the major histocompatibility complex (MHC) class I heavy chain. Conversely, a "non-functional variant" lacks one or more functional features of the parent molecule. Whether a variant of the B2M promoter disclosed herein is a functional or non-functional variant can be assessed by any method known in the art without excessive experimentation. In some aspects, the functional variant retains, for example, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the complete B2M protein to associate with the major histocompatibility complex (MHC) class I heavy chain. In some respects, nonfunctional variants retain, for example, less than about 20%, less than about 10%, less than about 5%, or completely lack the ability of intact B2M protein to associate with major histocompatibility complex (MHC) class I heavy chains.

[0119] Gene: The terms “gene,” “coding sequence,” “coding nucleic acid,” and their grammatical variations are used interchangeably in this disclosure and refer to a nucleic acid (RNA or DNA molecule) containing a nucleotide sequence encoding a gene of interest (typically a protein, such as a therapeutic protein, like an antibody or CAR). The coding sequence may also include start and stop signals operatively linked to regulatory elements, including promoters and polyadenylation signals, capable of directing expression in the cells of an individual or mammal administering the nucleic acid. The coding sequence may be codon-optimized.

[0120] Similar to each other: In some respects, if two or more sequences are 100% identical to each other, they are said to be "completely conserved" or "identical". In some respects, if two or more sequences are at least 70%, at least 80%, at least 90%, or at least 95% identical to each other, they are said to be "highly conserved". In some respects, if two or more sequences are approximately 70%, approximately 80%, approximately 90%, approximately 95%, approximately 98%, or approximately 99% identical to each other, they are said to be "highly conserved". In some respects, if two or more sequences are at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% identical to each other, they are said to be "conservative". In some respects, two or more sequences are said to be "conserved" if they are approximately 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to each other. Sequence conservation can apply to the full length of a polynucleotide or polypeptide or to its parts, regions, or features.

[0121] Identity: As used herein, the term “identity” refers to the overall monomer conservation between polymer molecules (e.g., between polypeptide molecules or polynucleotide molecules (e.g., DNA molecules and / or RNA molecules)). The term “identical” without any additional qualifiers (e.g., protein A is identical to protein B) means that the sequences are 100% identical (100% sequence identity). Describing two sequences as, for example, “70% identical” is equivalent to describing them as having, for example, “70% sequence identity”.

[0122] For example, the percentage of identity between two polypeptide or polynucleotide sequences can be calculated by aligning the two sequences for optimal comparison purposes (e.g., vacancies can be introduced in one or both of the first and second polypeptide or polynucleotide sequences to achieve optimal alignment, and dissimilar sequences can be ignored for comparison purposes). In some respects, the length of the sequence aligned for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence. The amino acids at corresponding amino acid positions, or the bases in the case of polynucleotides, are then compared.

[0123] The molecules are identical at that position when a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence. The percentage of identity between two sequences is a function of the number of common positions shared by the sequences, taking into account the number of vacancies and the length of each vacancy needed to achieve optimal alignment of the two sequences. Sequence comparison and determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms.

[0124] Suitable software programs are available from various sources and are used for protein and nucleotide sequence alignment. A suitable program for determining the percentage of sequence identity is bl2seq, which is part of the BLAST program suite available from the National Center for Biotechnology Information (NCBI) website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm to compare two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are available from the European Institute for Bioinformatics (EBI) at ebi.ac.uk / Tools / psa. In a specific sense, sequence identity corresponds to the percentage of sequence identity in a global double sequence alignment determined using a program implementing the Needleman-Wunsch algorithm (e.g., Needle, available at ebi.ac.uk / Tools / psa / emboss_needle / ).

[0125] Sequence alignment can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, ClustalX, or Clustal Omega), MUSCLE, etc.

[0126] Different regions within a single polynucleotide or polypeptide target sequence aligned to a polynucleotide or polypeptide reference sequence can each have their own percentage of sequence identity. It should be noted that the percentage of sequence identity values ​​are rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It should also be noted that length values ​​will always be integers.

[0127] In some respects, the percentage of identity (%ID) between the first amino acid sequence (or nucleic acid sequence) and the second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 x (Y / Z), where Y is the number of amino acid residues (or nucleobases) that score as identical matches in the alignment of the first and second sequences (e.g., by visual inspection or a specific sequence alignment procedure), and Z is the total number of residues in the second sequence. If the first sequence is longer than the second sequence, the percentage of identity between the first and second sequences will be higher than the percentage of identity between the second and first sequences.

[0128] Those skilled in the art will understand that the generation of sequence alignments used to calculate the percentage of sequence identity is not limited to binary sequence-sequence comparisons driven solely by primary sequence data. It should also be understood that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources, such as structural data (e.g., crystal protein structures), functional data (e.g., mutation locations), or phylogenetic data. A suitable procedure for integrating heterogeneous data to generate multiple sequence alignments is T-Coffee, which is available at tcoffee.org, and alternatively from sources such as EBI. It should also be understood that the final alignment used to calculate the percentage of sequence identity can be corrected automatically or manually.

[0129] Intracellular signaling domain: As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. Intracellular signaling domains can generate signals that promote immune effector functions in CAR-containing cells (e.g., CAR T cells). Examples of immune effector functions (e.g., in CAR T cells) include cytolytic activity and cofactor activities, including cytokine secretion. In some respects, an intracellular signaling domain is a portion of a protein that transduces effector signals and directs the cell to perform specific functions. While the entire intracellular signaling domain can be used, in many cases it is not necessary to use the whole strand. In the sense of using a truncated portion of an intracellular signaling domain, such a truncated portion can be used in place of the complete strand, provided it transduces effector signals. Therefore, the term intracellular signaling domain means any truncated portion of an intracellular signaling domain that is sufficient to transduce effector signals.

[0130] In one embodiment, the intracellular signaling domain may include a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules responsible for primary stimulation or antigen-dependent mimicry. In one embodiment, the intracellular signaling domain may include a co-stimulatory intracellular domain. Exemplary co-stimulatory intracellular signaling domains include those derived from molecules responsible for co-stimulatory signals or antigen-independent stimulation. For example, in the case of CAR T, the primary intracellular signaling domain may include a cytoplasmic sequence of a T cell receptor, and the co-stimulatory intracellular signaling domain may include a cytoplasmic sequence from a co-receptor or co-stimulatory molecule.

[0131] Primary intracellular signaling domains may contain signaling motifs known as immune receptor tyrosine activation motifs or ITAMs. Examples of primary cytoplasmic signaling sequences containing ITAMs include, but are not limited to, those derived from: CD3ζ, FcRγ, common FcRγ (FCER1G), FcγRIIa, FcRβ (FcεRib), CD3γ, CD3δ, CD3ε, CD22, CD79a, CD79b, CD278 (ICOS), FcεRI, CD66d, CD32, DAP10, and DAP12.

[0132] Mismatch: The term "mismatch" refers to one or more nucleobases (whether consecutive or separated) in the nucleobase sequence of an oligomer that do not match the pre-target mRNA according to the base pairing rules. While perfect complementarity is generally expected, some aspects may include one or more, but preferably 6, 5, 4, 3, 2, or 1, mismatches relative to the pre-target mRNA. Variations at any position within the oligomer are included. In some aspects, the antisense oligomers of this disclosure include variations in the nucleobase sequence near the ends, internal variations, and, if present, typically within about 6, 5, 4, 3, 2, or 1 subunits at the 5' and / or 3' ends. In some aspects, one, two, or three nucleobases may be removed and still provide targeted binding.

[0133] Nucleic acid: The terms “nucleic acid,” “nucleic acid molecule,” “nucleotide sequence,” “polynucleotide,” and their grammatical variants are used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine, or cytidine; “RNA molecule”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecule”), or any phosphate ester analogues thereof (such as thiophosphates and thioesters), in single-stranded or double-stranded helical form. A single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The term nucleic acid molecule, and especially DNA or RNA molecule, refers only to the primary and secondary structures of the molecule and is not limited to any particular tertiary form. Therefore, the term includes double-stranded DNA, particularly found in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and chromosomes. When discussing the structure of a particular double-stranded DNA molecule, the sequence may be described herein according to the normal convention of giving only the sequence along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to mRNA) in the 5' to 3' direction. A “recombinant DNA molecule” is a DNA molecule manipulated through molecular biology. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. The “nucleic acid compositions” disclosed herein comprise one or more nucleic acids as described herein.

[0134] Nucleic acid sequence: The terms "nucleic acid sequence" and "nucleotide sequence" are used interchangeably and refer to a continuous sequence of nucleic acids. This sequence can be single-stranded or double-stranded DNA or RNA, such as gRNA.

[0135] Operablely linked: "Operably linked" refers to a parallel relationship in which the components described in this way are in a relationship that allows them to function in their intended manner. For example, if a promoter affects its transcription or expression, then the promoter is operablely linked to a coding sequence. For example, the different components in a CAR are operablely linked. Similarly, the different components in the bicistronic polynucleotide or complete donor constructs disclosed herein are operablely linked.

[0136] Pharmaceutically acceptable: The terms "pharmaceutically acceptable carrier," "pharmaceutically acceptable excipient," and their grammatical variations cover any agent, as well as any carrier or diluent, approved by a U.S. federal regulatory agency or listed in the United States Pharmacopeia for use in animals (including humans), that does not cause undesirable physiological effects to the extent that would preclude administration of the composition to a subject, and does not eliminate the biological activity and properties of the administered compound. This term includes excipients and carriers that can be used to prepare pharmaceutical compositions and are generally safe, non-toxic, and desirable.

[0137] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to one or more compounds mixed or doped with a therapeutic composition (e.g., cells) or suspended in one or more other chemical components (such as pharmaceutically acceptable carriers and excipients). One purpose of a pharmaceutical composition is to facilitate administration of a pharmaceutical formulation to a subject.

[0138] Polynucleotide: As used herein, the term "polynucleotide" refers to a polymer of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, their analogues, or mixtures thereof. The term refers to the primary structure of a molecule. Therefore, the term includes triple-stranded, double-stranded, and single-stranded deoxyribonucleic acid ("DNA"), and triple-stranded, double-stranded, and single-stranded ribonucleic acid ("RNA").

[0139] More specifically, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose); polyribonucleotides (containing D-ribose) including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced ​​or unspliced; any other type of polynucleotide that is an N-glycoside or C-glycoside of a purine or pyrimidine base; and other polymers containing a conventional nucleotide backbone, such as polyamides (e.g., peptide nucleic acid "PNA") and polymorpholino polymers, as well as other synthetic sequence-specific nucleic acid polymers, provided that the polymer contains nucleobases that allow for base pairing and base stacking conformations, such as those found in DNA and RNA. In some aspects of this disclosure, a polynucleotide can be, for example, RNA (e.g., mRNA) or DNA.

[0140] Polypeptide: The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. Polymers may contain modified amino acids. These terms also cover amino acid polymers that are naturally modified or modified through intervention (e.g., disulfide bond formation, glycosylation, esterification, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeled component). This definition also includes, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine) and other modifications known in the art. As used herein, the term “polypeptide” refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. Polypeptides may be single polypeptides or may be multi-molecular complexes, such as dimers, trimers, or tetramers. They may also include single-chain or multi-chain polypeptides. Most commonly, disulfide bonds are present in multi-chain polypeptides. The term peptide can also be applied to amino acid polymers, where one or more amino acid residues are artificial chemical analogs of naturally occurring amino acids. In some respects, a "peptide" can be less than or equal to 50 amino acids in length, for example, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids in length.

[0141] Prevention: As used herein, the term "prevent / preventing" and its variations refer to the partial or complete delay of the onset of a disease, condition, and / or illness; the partial or complete delay of the onset of one or more symptoms, features, or clinical manifestations of a particular disease, condition, and / or illness; the partial or complete delay of the onset of one or more symptoms, features, or manifestations of a particular disease, condition, and / or illness; the partial or complete delay of the progression of a particular disease, condition, and / or illness; and / or the reduction of the risk of developing a pathology associated with a disease, condition, and / or illness. In some respects, preventive outcomes are achieved through preventive treatment. As used herein, "preventive" means a therapy or process of action used to prevent the onset of a disease or illness, or to prevent or delay symptoms associated with a disease or illness. As used herein, "prevention" means measures taken to maintain health and to prevent or delay the onset of a disease or illness, or to prevent or delay symptoms associated with a disease or illness.

[0142] scFv: The term "scFv" refers to a fusion protein comprising at least one antibody moiety containing a light chain variable region and at least one antibody moiety containing a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are sequentially linked, for example, via a synthetic linker (e.g., a short flexible peptide linker), and are capable of being expressed as a single-chain polypeptide, wherein the scFv retains the specificity of the intact antibody from which it originated. Unless otherwise specified, as used herein, the scFv may have VL and VH variable regions in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide), and the scFv may comprise a VL-linker-VH or may comprise a VH-linker-VL.

[0143] Similarity: As used herein, the term "similarity" refers to the overall correlation between polymer molecules, such as the overall correlation between polynucleotide molecules (e.g., DNA and / or RNA molecules) and / or polypeptide molecules. The calculation of the percentage of similarity between polymer molecules can be performed in the same manner as the calculation of the percentage of identity, except that the calculation of the percentage of similarity takes into account conservative substitutions as understood in the art. It should be understood that the percentage of similarity depends on the comparative scale used, i.e., whether amino acids are being compared, for example, based on their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.

[0144] Subject: The terms “subject,” “patient,” “individual,” and “host,” and their variations, are used interchangeably herein and refer to any mammalian subject in need of diagnosis, treatment, or therapy, including, but not limited to, humans, domestic animals (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.), particularly humans. The methods described herein are applicable to both human therapies and veterinary applications. As used herein, the phrase “subject in need” includes subjects who would benefit from administration of a therapeutic agent (e.g., CAR-T cells containing bicistronic polynucleotides of this disclosure), such as mammalian subjects.

[0145] Subsequence: As used herein, the term “subsequence” refers to a subset of consecutive nucleotides or amino acids in a sequence (physical sequence or its symbolic representation).

[0146] Therapeutic effective amount: As used herein, the term "therapeutic effective amount" is the amount of cells (e.g., allogeneic T cells) or pharmaceutical compositions containing such cells sufficient to produce the desired therapeutic, pharmacological, and / or physiological effects in a subject in need. Therapeutic effective amount can also be "prophylactic effective amount," as prophylaxis can be considered a therapy.

[0147] Treatment: As used herein, the term "treatment" means, for example, reducing the severity of a disease or condition; shortening the duration of the disease; improving or eliminating one or more symptoms associated with the disease or condition; providing a beneficial effect to a subject suffering from a disease or condition, without necessarily curing the disease or condition. The term also includes prevention or avoidance of the disease or condition or its symptoms. In one aspect, the term "treatment" means inducing an immune response against an antigen in a subject.

[0148] Modulation: As used herein, the terms “modulation,” “alteration,” and their grammatical variations, when applied to a particular concentration, level, expression, function, or behavior, generally refer to the ability to alter that particular concentration, level, expression, function, or behavior by increasing or decreasing (e.g., directly or indirectly promoting / stimulating / upregulating or interfering with / inhibiting / downregulating), for example, as an antagonist or agonist. In some cases, modulators can increase and / or decrease a concentration, level, activity, or function relative to a control, or relative to the generally expected mean activity level or relative to the control activity level.

[0149] Site: The terms “target site” and “insertion site” refer to regions of cellular chromosomal DNA containing recognition sequences for nucleases (e.g., CRISPR). As used herein, the term “recognition sequence” refers to the DNA sequence that is bound and cleaved by a nuclease. In the case of CRISPR, the recognition sequence is the sequence that guides RNA binding to direct Cas9 to perform cleavage, and is typically 16–24 base pairs.

[0150] Vector: The terms “vector,” “expression vector,” “plasmid,” and their grammatical variations are used interchangeably in this disclosure and refer to a foreign polynucleotide in the host cell genome that is inserted at a specific location in the host cell (e.g., T cell) genome. Typically, a plasmid contains a variety of elements, such as recombination sites (e.g., homologous recombination sites and / or site-specific recombination sites), markers (e.g., detection markers and / or selection markers), one or more expression cassettes, or any combination thereof. In some aspects, a plasmid may be a linear plasmid. In other aspects, a plasmid may be a circular plasmid, such as a fully circular plasmid.

[0151] II. Bicistronic polynucleotides

[0152] This disclosure provides a bicistronic polynucleotide encoding (i) a therapeutic agent (e.g., a CAR); and (ii) an immune surveillance masking molecule (ISMM), wherein the ISMM comprises a nonfunctional β-2-microglobulin (B2M) (e.g., a nonfunctional fragment or nonfunctional variant of B2M) and human leukocyte antigen (HLA) (e.g., HLA-E, HLA-G, or a functional fragment or variant thereof). In some aspects, the ISMM comprises a polynucleotide encoding a nonfunctional fragment of a B2M polypeptide and a functional fragment or variant of an HLA-E polypeptide.

[0153] As used herein, the terms “β-2 microglobulin gene,” “B2M gene,” and “B2M” are used interchangeably and refer to the naturally occurring variants of the human β-2 microglobulin gene, which is NCBI gene ID NO. 567 (accession number NG_012920.1) and encodes the functional B2M polypeptide, as well as its functional fragments and variants.

[0154] As used herein, a “bicistronic” polynucleotide refers to a polynucleotide that, upon transcription, produces a single messenger RNA (mRNA) containing two coding sequences (i.e., cistronic) and encoding more than one product (e.g., two proteins). As used herein, a “polycistronic” polynucleotide refers to a polynucleotide that, upon transcription, produces a single messenger RNA (mRNA) containing more than two coding sequences (i.e., cistronic) and encoding more than two products (e.g., proteins). Bicistronic or polycistronic mRNAs may contain any element known in the art that allows the translation of two or more genes from the same mRNA molecule, including but not limited to IRES elements, T2A elements, P2A elements, E2A elements, and F2A elements.

[0155] In some respects, therapeutic agents may comprise antibodies or their antigen-binding portions, enzymes, receptors, receptor ligands, protein antibiotics, fusion proteins, structural proteins, regulatory proteins, vaccines, growth factors, hormones, or cytokines. In other respects, therapeutic agents may comprise one or more heterologous portions, such as portions that prolong the plasma half-life of a biologic (e.g., unstructured peptides, such as XTEN), portions that promote transmembrane or blood-brain barrier transport, portions that increase or decrease clearance, or portions that direct the therapeutic agent to a specific cell or tissue type (i.e., a targeting portion).

[0156] In some respects, therapeutic agents are antibodies or their antigen-binding portions. In other respects, antibodies or their antigen-binding fragments specifically bind to epitopes on tumor antigens. In some respects, tumor antigens include ROR1, HER2, AFP, TRAC, TCRβ, BCMA, CLL-1, CS1, CD38, CD19, TSHR, CD123, CD22, CD30, CD70, CD171, CD33, EGFRvIII, GD2, GD3, TnAg, PSMA, ROR2, GPC1, GPC2, FLT3, FAP, TAG72, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, mesothelin, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, CD20, folate receptor α, ERBB2 (Her2 / neu), MUC1, MUC16, EGFR, NCAM, prostaglandin, PAP, ELF2M, and Ephrin. B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, Fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor β, TEM1 / CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WTI, NY-ESO-1, LAGE-la, MAGE-Al, pod protein, HPV E6, E7, MAGE AI, ETV6-AML, spermin 17, XAGE1, Tie 2. MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, prostate-specific protein (prostein), survivin and telomerase, PCTA-1 / galactoglobin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoint, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin B1, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxylesterase, mutThe extracellular portions of hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, CD2, CD3ε, CD4, CD5, CD7, APRIL proteins, and any combination thereof.

[0157] In some respects, the therapeutic agent is a CAR containing an antigen-binding domain that specifically binds to an epitope on a tumor antigen (e.g., the antigen disclosed above) on a target cell. In some respects, the antigen-binding domain contains an antibody or its antigen-binding portion. In some respects, the tumor antigen is disialotetrahexosylganglioside GD2.

[0158] GD2 is a disialotetrahexosylganglioside overexpressed in many tumors. Antibody therapies targeting disialotetrahexosylganglioside GD2 (dataximab) are available. Dattaximab has been approved for pediatric neuroblastoma. However, the antibody must be administered along with several other expensive components. Dattaximab is administered in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-2 (IL-2), and 13-cis-retinoic acid (RA). Morphine is administered before, during, and for two hours after dattaximab infusion to control the severe pain induced by this drug. Antihistamines and anti-inflammatory drugs are also administered before, during, and after infusion to address infusion reactions. These problems can be avoided by utilizing the dattaximab antibody GD2-binding domain to generate anti-GD2 CAR T cells in a manner that allows any donor T cells to become available for any patient, as disclosed herein, i.e., anti-GD2 therapy may be possible using off-the-shelf allogeneic CAR T cells.

[0159] Therefore, in some aspects, the polycistronic polypeptide of this disclosure comprises a polynucleotide sequence encoding a CAR derived from dartuximab. In some aspects, the antibody is a single-chain variable fragment (scFv) containing an antibody (e.g., dartuximab). The heavy chain variable region (VH) and light chain variable region (VL) of ).

[0160] In some aspects, the therapeutic agent is a CAR comprising datuximab scFv, which contains the protein sequence shown in SEQ ID NO:22. In some aspects, the antigen-binding domain cross-competes with datuximab. In some aspects, the antigen-binding domain binds to the same epitopes as datuximab. In some aspects, the antigen-binding domain comprises VH CDR3 of datuximab. In some aspects, the antigen-binding domain also comprises VH CDR1 and VH CDR2. In some aspects, VHCDR1 comprises VH CDR1 of datuximab and / or VH CDR2 comprises VH CDR2 of datuximab. In some aspects, the antigen-binding domain also comprises VL CDR1, VL CDR2 and / or VL CDR3. In some respects, VL CDR1 comprises VL CDR1 of dartuximab, VL CDR2 comprises VL CDR2 of dartuximab, and / or VL CDR3 comprises VL CDR3 of dartuximab.

[0161] In some respects, the antigen-binding domain contains

[0162] (i) VH CDR1 of SEQ ID NO:59; VH CDR2 of SEQ ID NO:63; and VHCDR3 of SEQ ID NO:67; and / or VL CDR1 of SEQ ID NO:71; VL CDR2 of SEQ ID NO:75; and VLCDR3 of SEQ ID NO:79; or

[0163] (ii) VH CDR1 of SEQ ID NO:60; VH CDR2 of SEQ ID NO:64; and VHCDR3 of SEQ ID NO:68; and / or VL CDR1 of SEQ ID NO:72; VL CDR2 of SEQ ID NO:76; and VLCDR3 of SEQ ID NO:80; or

[0164] (iii) VH CDR1 of SEQ ID NO:61; VH CDR2 of SEQ ID NO:65; and VHCDR3 of SEQ ID NO:69; and / or VL CDR1 of SEQ ID NO:73; VL CDR2 of SEQ ID NO:77; and VLCDR3 of SEQ ID NO:81; or

[0165] (iv) VH CDR1 of SEQ ID NO:62; VH CDR2 of SEQ ID NO:66; and VHCDR3 of SEQ ID NO:70; and / or VL CDR1 of SEQ ID NO:74; VL CDR2 of SEQ ID NO:78; and VLCDR3 of SEQ ID NO:82; or

[0166] (v) VH CDR1 of SEQ ID NO:53; VH CDR2 of SEQ ID NO:54; and VHCDR3 of SEQ ID NO:55; and / or VL CDR1 of SEQ ID NO:56; VL CDR2 of SEQ ID NO:57; and VLCDR3 of SEQ ID NO:58.

[0167] In some aspects, the antigen-binding domain comprises VH and VL, wherein VH comprises the protein sequence shown in SEQ ID NO:44 and VL comprises the protein sequence shown in SEQ ID NO:46. In some aspects, the antigen-binding domain comprises VH and VL, wherein VH comprises the protein sequence shown in SEQ ID NO:44 and VL comprises the protein sequence shown in SEQ ID NO:46. In some aspects, VH and VL are linked via a linker. In some aspects, VH and VL are linked in a VH-linker-VL or VL-linker-VH conformation. In some aspects, the linker is a Gly4-Ser linker. In some aspects, the Gly4-Ser linker comprises the sequence shown in SEQ ID NO:84.

[0168] In some respects, CAR constructs are designed as standard CARs, split CARs, off-switch CARs, on-switch CARs, first-generation CARs, second-generation CARs, third-generation CARs, or fourth-generation CARs.

[0169] In some respects, antigen-binding domains are lg NAR, Fab, Fab', F(ab)'2, F(ab)'3, Fv, single-chain variable fragment (scFv), double scFv, (scFv)2, microantibody, biantibody, triantibody, tetraantibody, intracellular antibody, disulfide-stabilized Fv protein (dsFv), monoantibody, nanobody, affinity, DARPin, monomeric antibody, adnectin, α-body, or designed binding agent.

[0170] In some respects, the CAR construct also includes a transmembrane domain, an intracellular domain, and a spacer region located between the antigen-binding domain and the transmembrane domain.

[0171] In some respects, the intracellular domains of the CAR construct are signal transduction domains derived from CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, or CD28. In some respects, the intracellular domains of the CAR construct are derived from CD28. In some respects, the transmembrane domains of the CAR construct are derived from CD28. In some respects, the transmembrane domains are connected to the intracellular domains via linkers. In some respects, the intracellular and transmembrane domains of the CAR construct are derived from the same molecule, such as CD28; therefore, in some respects, both the transmembrane and intracellular domains are derived from CD28.

[0172] In some respects, the transmembrane domain of CAR is the transmembrane domain of proteins selected from the group consisting of: the α, β or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154. In some respects, transmembrane domains may include at least the following transmembrane regions: for example, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA -1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD2 29), CD160(BY55), PSGL1, CD100(SEMA4D), SLAMF6(NTB-A, Ly108), SLAM(SLAMF1, CD150, IPO-3), BLAME(SLAMF8), SELPLG(CD162), LTBR, ​​PAG / Cbp, NKG2D, NKG2C or CD19.

[0173] In some respects, the spacer region of the CAR construct is the CD8α hinge region. In some respects, the spacer region is derived from the hinge region of human immunoglobulins. In some respects, the hinge region of human immunoglobulins is derived from IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, or IgM.

[0174] In some respects, the CAR construct also includes co-stimulatory domains or combinations thereof. In some respects, the co-stimulatory domains are derived from 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, CD3ζ, and combinations thereof. In some respects, the co-stimulatory domains include a 4-1BB activation domain. In some respects, the co-stimulatory domains include a CD3ζ activation domain. In some respects, the co-stimulatory domains include both a 4-1BB activation domain and a CD3ζ activation domain. In some respects, the co-stimulatory domain contains functional signal transduction domains of proteins selected from the group consisting of: OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), and 4-1BB (CD137).In some respects, the co-stimulatory domain contains functional signal transduction domains of proteins selected from the group consisting of: MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signal lymphocyte activating molecules (SLAM proteins), NK cell activating receptors, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD27) 8), GITR, BAFFR, LIGHT, HVEM(LIGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, C D8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d , ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7 , NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1 CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and ligands that specifically bind to CD83.

[0175] In some aspects, the CAR disclosed herein also includes a leader sequence. In some aspects, the CAR disclosed herein is a bispecific CAR. Thus, in some aspects, the polynucleotide encoding the CAR disclosed herein encodes at least a polypeptide of a bispecific CAR (e.g., a CAR targeting a first antigen and a second antigen).

[0176] In some respects, the CAR construct contains the nucleic acid sequence shown in SEQ ID NO:19. In some respects, the CAR construct encodes the protein shown in SEQ ID NO:20.

[0177] In some respects, B2M nonfunctional peptides are B2M fragments, such as nonfunctional fragments. In some respects, B2M nonfunctional peptides are B2M variants, such as nonfunctional variants. In some respects, human leukocyte antigens (HLA) are HLA-E or HLA-G.

[0178] As used herein, “HLA-E” refers to the polynucleotide encoding the α-heavy chain of HLA class I histocompatibility antigen αE (also known as MHC class I antigen E). HLA-E is a heterodimer composed of an α-heavy chain and a light chain (β-2 microglobulin). The α-heavy chain is approximately 45 kDa and is anchored in the membrane. The HLA-E gene contains eight exons. Exon 1 encodes a signal peptide, exons 2 and 3 encode α1 and α2 domains (both of which are peptide-binding domains), exon 4 encodes an α3 domain, exon 5 encodes a transmembrane domain, and exons 6 and 7 encode a cytoplasmic tail region. See Uniprot entry p13747, Entrez entry 3133, and RefSeq (mRNA) and (protein) entries NM_005516 and NP_005507, which are incorporated herein by reference in their entirety.

[0179] As used herein, “HLA-G” refers to the polynucleotide encoding the α-heavy chain of HLA-G histocompatibility antigen class I G (also known as human leukocyte antigen G). HLA-G is a heterodimer composed of an α-heavy chain and a light chain (β-2 microglobulin). The α-heavy chain is anchored in the membrane. HLA-G is encoded by 88 alleles. The heavy chain is approximately 45 kDa, and its gene contains 8 exons. Exon 1 encodes a leader peptide, exons 2 and 3 encode the α1 and α2 domains (both of which bind to peptides), exon 4 encodes the α3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail region. Exons 7 and 8 are not translated due to the presence of a stop codon in exon 6. HLA-G can be expressed in at least seven isoforms via alternative splicing, these isoforms being designated HLA-G1, HLA-G2, HLA-G3, HLA-G4, HLA-G5, HLA-G6, and HLA-G7. The proteins can be membrane-bound and soluble. HLA-G1 through G4 are membrane-bound; therefore, in some respects, the bicistronic polynucleotides of this disclosure comprise nucleic acids encoding HLA-G1, HLA-G2, HLA-G3, HLA-G4, HLA-G5, HLA-G6, their functional variants, or functional fragments thereof. See the Uniprot entry p17693, the Entrez entry 3135, and the RefSeq (mRNA) and (protein) entries NM_002127, NM_001363567, NM_001384280, NM_001384290, NP_002118, and NP_001350496, which are incorporated herein by reference in their entirety.

[0180] In some respects, HLA-E or HLA-G in bicistronic polynucleotides can encode functional variants or functional fragments of their corresponding wild-type forms. In some respects, HLA-E in bicistronic polynucleotides can encode functional variants or functional fragments of the HLA-E portion of SEQ ID NO:6.

[0181] In some aspects, the β-2-microglobulin (B2M) peptide and human leukocyte antigen (HLA) are linked via a linker (e.g., a flexible linker). In some aspects, the linker is a Gly4-Ser linker (GSSS; SEQ ID NO:83). In some aspects, the Gly4-Ser linker comprises the sequence shown in SEQ ID NO:84 (GSSSGSSSGSSSGSSS).

[0182] In some aspects of the bicistronic polynucleotides disclosed herein, (i) the nucleic acid sequence encoding a therapeutic agent and the nucleic acid sequence encoding an immune surveillance masking molecule (ISMM) are linked by a 2A element (e.g., a P2A element) sequence; or, (ii) the nucleic acid sequence encoding a therapeutic agent and the nucleic acid sequence encoding an immune surveillance masking molecule (ISMM) are linked by an internal ribosome entry site (IRES element). Thus, in some aspects, the cistron is linked via an IRES element. The IRES element recruits the RNA region of the 40S ribosomal subunit through a cap-independent mechanism. The IRES element typically employs a complex RNA structure that acts as an anchoring site for the ribosome guided by RNA-RNA and / or RNA-protein interactions.

[0183] In other respects, cistrons are linked via 2A elements. 2A self-cleaving peptides, or 2A peptides, are a class of peptides 18-22 amino acids long that can induce ribosome jumping during protein translation in cells. 2A elements are good candidates to replace IRES due to their small size and high cleavage efficiency between genes upstream and downstream of the 2A peptide. In some respects, the 2A element is the P2A element (swine cyclovir-12A). In other respects, the 2A element is the F2A element (foot-and-mouth disease virus), the E2A element (equine rhinitis A virus), or the T2A element (Melilothorax muscularis virus 2A). In some respects, the 2A element portion of a bicistronic polynucleotide comprises two or more tandem 2A elements, wherein the 2A elements are selected from P2A, E2A, F2A, E2A, and T2A. In some respects, the 2A element is P2A-T2A. In some respects, the 2A element is 2A-T2A-E2A.

[0184] In some aspects, the nucleic acid sequence encoding the therapeutic agent comprises the sequence shown in SEQ ID NO:5. In some aspects, the nucleic acid sequence encoding ISMM comprises the sequence shown in SEQ ID NO:6. In some aspects, the nucleic acid sequence encoding the therapeutic agent comprises the sequence shown in SEQ ID NO:5, and the nucleic acid sequence encoding ISMM comprises the sequence shown in SEQ ID NO:6. In some aspects, the bicistronic polynucleotide is selected from the group consisting of: bicistronic construct 1 (BC1; SEQ ID NO:7), bicistronic construct 2 (BC2; SEQ ID NO:8), bicistronic construct 3 (BC3; SEQ ID NO:9), bicistronic construct 4 (BC4; SEQ ID NO:10), bicistronic construct 5 (BC5; SEQ ID NO:9), bicistronic construct 6 (BC6; SEQ ID NO:10), bicistronic construct 7 (BC7; SEQ ID NO:11), or bicistronic construct 8 (BC8; SEQ ID NO:12).

[0185] In some respects, the bicistronic polynucleotide also comprises a 5' sequence complementary to the B2M gene sequence upstream of the insertion site and a 3' sequence complementary to the B2M gene sequence downstream of the insertion site. In some respects, the 5' and 3' sequences have the same length. In some respects, the lengths of the 5' and 3' sequences are at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides.

[0186] In some respects, the bicistronic polynucleotide is selected from the group consisting of: complete donor 1 (FD1; SEQ ID NO: 13), complete donor 2 (FD2; SEQ ID NO: 14), complete donor 3 (FD3; SEQ ID NO: 15), complete donor 4 (FD4; SEQ ID NO: 16), complete donor 5 (FD5; SEQ ID NO: 15), complete donor 6 (FD6; SEQ ID NO: 16), complete donor 7 (FD7; SEQ ID NO: 17), or complete donor 8 (FD8; SEQ ID NO: 18).

[0187] In some aspects, bicistronic polynucleotides are inserted into sites within the B2M gene, where the insertion in the B2M gene causes (partial or complete) inactivation of the B2M gene. In some aspects, the insertion of bicistronic polynucleotides into the B2M gene is mediated by a nuclease. In some aspects, the insertion of bicistronic polynucleotides into the B2M gene is mediated by a CRISPR / Cas nuclease. In some aspects, the nuclease is CRISPR / Cas9. CRISPR and other genome editing alternatives that can be used in the methods of this disclosure (e.g., zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and mass nucleases (MNs)) are discussed in more detail below.

[0188] In some respects, the insertion site in the B2M gene is at an intron position. In some respects, the insertion site in the B2M gene is at an intron-exon junction position. In some respects, the insertion site in the B2M gene is at an exon position. In some respects, the exon position is at exon 1. In some respects, the insertion site is site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1). In some respects, the exon position is at exon 2. In some respects, the insertion site is site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2) or site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3). In some respects, the exon position is at exon 3. In some respects, the insertion site is site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

[0189] III. Carrier

[0190] This disclosure also provides a vector comprising the bicistronic polynucleotide disclosed herein operatively linked to a regulatory element (e.g., a promoter). In some aspects, the promoter is a natural promoter, such as the natural B2M gene promoter.

[0191] In some respects, a vector is a transfer vector. The term "transfer vector" refers to a composition of substances containing isolated nucleic acids (e.g., bicistronic polynucleotides of this disclosure) and capable of delivering the isolated nucleic acids into cells. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "transfer vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0192] In some respects, a vector is an expression vector. The term "expression vector" refers to a vector containing a recombinant polynucleotide (e.g., a bicistronic polypeptide of this disclosure) that contains an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be provided by a host cell or in an in vitro expression system. Expression vectors include all those known in the art, including viscera, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating the recombinant polynucleotide.

[0193] In some respects, the vector is a viral vector, a mammalian vector, or a bacterial vector. In some respects, the vector is a retroviral vector. In some respects, the viral vector is selected from the group consisting of: adenovirus vectors, lentiviruses, Sendai virus vectors, baculovirus vectors, Epstein-Barr virus vectors, papillomavirus vectors, vaccinia virus vectors, herpes simplex virus vectors, hybrid vectors, and adeno-associated virus (AAV) vectors.

[0194] In some respects, adenovirus vectors are third-generation adenovirus vectors. TM This is currently the most commonly used method for generating adenovirus vector constructs. The system consists of two types of plasmids: a shuttle (or transfer) vector and an adenovirus vector. The transgene of interest is cloned into the shuttle vector, validated, and linearized using the restriction endonuclease PmeI. This construct is then transformed into ADEASIER-1 cells, which contain PADEASY. TM BJ5183 Escherichia coli cells. PADEASY TM It is an approximately 33 kb adenovirus plasmid containing the adenovirus genes required for viral production. The shuttle vector and the adenovirus plasmid have matching left and right homologous arms, which facilitate homologous recombination of transgenes into the adenovirus plasmid. Supercoiled PADEASY can also be used. TM Standard BJ5183 was co-transformed with a shuttle vector, but this method resulted in significant background interference from non-recombinant adenovirus plasmids. The size and appropriate restriction enzyme digestion pattern of the recombinant adenovirus plasmid were then validated to confirm that the transgene had been inserted into the adenovirus plasmid and that no other recombination patterns had occurred. Once validated, the recombinant plasmid was linearized with PacI to produce a linear dsDNA construct with ITRs flanking it. The linearized construct was transfected into 293 or 911 cells, and the virus could be harvested after approximately 7–10 days. In addition to this method, other methods known in the art at the time of filing of this application for the production of adenovirus vector constructs may be used to practice the methods disclosed herein.

[0195] In other respects, viral vectors are retroviral vectors, such as lentiviral vectors (e.g., third- or fourth-generation lentiviral vectors). The term "lentivirus" refers to a genus within the family Retroviridae. Lentivirals are unique among retroviruses in their ability to infect non-dividing cells; they can deliver large amounts of genetic information into the host cell's DNA, making them one of the most efficient methods among gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses.

[0196] The term "lentiviral vector" refers to a vector derived from at least a portion of a lentiviral genome, particularly including self-inactivated lentiviral vectors as described in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that can be used clinically include, but are not limited to, those from Oxford BioMedica. Gene delivery technology, Lentigen's LENTIMAX TM Vector systems, etc. Non-clinical lentiviral vectors are also available and are known to those skilled in the art.

[0197] Lentiviral vectors are typically generated in transient transfection systems, where cell lines are transfected using three separate plasmid expression systems. These include a transfer vector plasmid (part of the HIV provirus), a packaging plasmid or construct, and a plasmid with a heterologous envelope gene (env) of the different viruses. The three plasmid components of the vector are placed into packaging cells, which are then inserted into the HIV capsid. The viral portion of the vector contains the inserted sequence, preventing viral replication within the cell system. Current third-generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid the generation of recombination-mediated replicative viruses. In fourth-generation lentiviral vectors, the retroviral genome has been further reduced (see, for example, ...). LENTI-X TM Fourth-generation packaging system).

[0198] In some aspects, non-viral methods can be used to deliver nucleic acids containing the bicistronic polynucleotides of this disclosure into the cells or tissues of a subject. In some aspects, non-viral methods involve the use of transposons. In some aspects, the use of non-viral delivery methods allows for the reprogramming of cells (e.g., T or NK cells) and the direct infusion of cells into a subject. In some aspects, nucleic acid sequences containing the bicistronic polynucleotides of this disclosure can be inserted into the genome of target cells (e.g., T cells) or host cells (e.g., cells for recombinant expression of CAR peptides) using the CRISPR / Cas system and genome editing alternatives such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and mass nucleases (MNs).

[0199] This disclosure also provides a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein. A kit is also provided comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein.

[0200] IV. Cells

[0201] This disclosure also provides genetically modified cells to express therapeutic agents (e.g., CAR) and ISMM, the cells comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein. In some aspects, the cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, ILC cells, macrophages, or antigen-presenting cells. In some aspects, the cells are allogeneic. In some aspects, the genetically modified cells are part of a kit or product.

[0202] In some respects, the genetically modified cells disclosed herein have been transfected with: (i) the bicistronic polynucleotide disclosed herein, (ii) a vector containing the bicistronic polynucleotide disclosed herein, or (iii) a composition containing the bicistronic polynucleotide disclosed herein or a vector containing the bicistronic polynucleotide disclosed herein.

[0203] The term "transfected" (or equivalent terms "transformed" and "transduced") refers to the process of transferring or introducing a foreign nucleic acid (e.g., a bicistronic polynucleotide or vector of this disclosure) into the genome of a host cell (e.g., a T cell). A "transfected" cell is a cell that has been transfected, transformed, or transduced with a foreign nucleic acid (e.g., a bicistronic polynucleotide or vector of this disclosure). The term cell or transfected cell includes primary subject cells and their progeny.

[0204] In some respects, cells (e.g., T cells) are transfected with vectors of this disclosure (e.g., AAV vectors or lentiviral vectors containing bicistronic constructs of this disclosure). In some such respects, the cells can stably express therapeutic agents (e.g., CARs) encoded by polycistronic polynucleotides of this disclosure. In some respects, the cells are immune effector cells.

[0205] As used herein, the term "immune effector cell" refers to a cell that participates in an immune response (e.g., participates in promoting an immune effector response). "Immune effector function" or "immune effector response" refers to, for example, the function or response of immune effector cells to enhance or promote the immune attack of target cells. For example, an immune effector function or response refers to the property of T or NK cells to promote the killing or growth or proliferation inhibition of target cells. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector functions or responses.

[0206] The term "effective function" refers to a specialized function of a cell. For example, the effector function of T cells can be cytolytic activity or helper activity, including the secretion of cytokines. The intracellular signaling domains of CARs can generate signals that promote the immune effector function of CAR-containing cells (e.g., CAR T cells). Examples of immune effector functions (e.g., in CAR T cells) include cytolytic activity and helper activity, including the secretion of cytokines.

[0207] In some specific aspects, this disclosure provides allogeneic CAR-T cells comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding HLA-E has been replaced by a nucleic acid sequence encoding HLA-G.

[0208] In some aspects, this disclosure provides an allogeneic CAR-T cell comprising a specific bicistronic construct selected from the group consisting of BC1, BC2, BC3, BC4, BC5, BC6, BC7 and BC8, wherein a nucleic acid sequence encoding a nonfunctional B2M fragment or variant has been replaced by a nucleic acid sequence encoding a nonfunctional TRAC fragment or variant, and wherein the bicistronic construct is inserted into the TRAC gene.

[0209] In some aspects, this disclosure provides an allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein a nucleic acid sequence encoding a nonfunctional B2M fragment or variant has been replaced by a nucleic acid sequence encoding a nonfunctional CD52 fragment or variant, and wherein the bicistronic construct is inserted into the CD52 gene.

[0210] T cells can be obtained from various sources, including but not limited to peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from the site of infection, ascites, pleural effusion, spleen tissue, and tumors.

[0211] V. Pharmaceutical Composition

[0212] This disclosure also provides a pharmaceutical composition comprising genetically modified cells expressing a therapeutic agent and ISMM, the cells comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein, the pharmaceutical composition being suitable for administration to a subject.

[0213] This disclosure also provides a pharmaceutical composition for treating cancer in a subject of need, wherein the pharmaceutical composition comprises genetically modified cells expressing a therapeutic agent and ISMM, the cells comprising (i) the bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein or a vector comprising the bicistronic polynucleotide disclosed herein. In some aspects, the pharmaceutical composition is part of a kit or article of manufacture.

[0214] This disclosure also provides a pharmaceutical composition for treating cancer in a subject of need, wherein the pharmaceutical composition comprises

[0215] (i) The bicistronic polynucleotides disclosed herein;

[0216] (ii) A vector containing the bicistronic polynucleotide disclosed herein;

[0217] (iii) A composition comprising a bicistronic polynucleotide disclosed herein or a carrier comprising a bicistronic polynucleotide disclosed herein; or

[0218] (iv) A cell containing (i), (ii) or (iii).

[0219] In some respects, the pharmaceutical composition is part of a kit or article of manufacture. The pharmaceutical composition typically comprises a bicistronic polynucleotide, a carrier or cell, and a pharmaceutically acceptable excipient or loading agent in a form suitable for administration to a subject, encoding a therapeutic agent (e.g., a CAR) of this disclosure. A pharmaceutically acceptable excipient or loading agent is determined in part by the specific composition administered and the specific method of administration of that composition. Various suitable formulations exist that comprise pharmaceutical compositions containing a therapeutic agent (e.g., a CAR) of this disclosure (see, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical composition is typically aseptically formulated and fully compliant with all Good Manufacturing Practices (GMP) regulations of the U.S. Food and Drug Administration. In some respects, the pharmaceutical composition is co-administered with one or more additional therapeutic agents in a pharmaceutically acceptable loading agent.

[0220] Acceptable carriers, excipients, or stabilizers are non-toxic to recipients (e.g., animals or humans) at the doses and concentrations used, and include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride, hexahydrate quaternary ammonium chloride, benzalkonium chloride, benzyl chloride, phenol, butanol, or benzyl alcohol, alkyl esters of p-hydroxybenzoate (such as methylparaben or propylparaben), catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol); low molecular weight (less) (Approximately 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming anti-charge ions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as TWEEN. TM PLURONICS TM Or polyethylene glycol (PEG).

[0221] Examples of carriers or diluents include, but are not limited to, water, physiological saline, Ringer's solution, glucose solution, and 5% human serum albumin. The use of such carriers and compounds in pharmaceutically active substances is well known in the art. Unless any conventional carrier or compound is incompatible with the compositions disclosed herein (e.g., polynucleotides, carriers, or cells), its use in the compositions should be considered.

[0222] VI. Methods

[0223] This disclosure also provides a method for stimulating a subject to a T-cell-mediated immune response against a target cell population or tissue, the method comprising administering to the subject an effective amount of cells containing the bicistronic polynucleotide disclosed herein. A method for providing antitumor immunity in a subject in need is also provided, the method comprising administering to the subject an effective amount of cells containing the bicistronic polynucleotide disclosed herein. This disclosure further provides a method for treating cancer in a subject in need, the method comprising administering to the subject an effective amount of cells containing the bicistronic polynucleotide disclosed herein. This disclosure provides a method for preparing a cell population for a therapy, the method comprising transducing a cell population isolated from a subject using the bicistronic polynucleotide, a vector, or a composition disclosed herein. In some aspects, transduction includes culturing the cells under suitable conditions. In some aspects, the therapy is an allogeneic cell therapy.

[0224] In some aspects of these methods, the bicistronic polynucleotide is selected from the group consisting of: bicistronic construct 1, bicistronic construct 2, bicistronic construct 3, bicistronic construct 4, bicistronic construct 5, bicistronic construct 6, bicistronic construct 7, and bicistronic construct 8. In some aspects, the bicistronic polynucleotide is selected from the group consisting of: complete donor 1, complete donor 2, complete donor 3, complete donor 4, complete donor 5, complete donor 6, complete donor 7, or complete donor 8. In some aspects, the bicistronic polynucleotide is bicistronic construct 1. In some aspects, the bicistronic polynucleotide is bicistronic construct 2. In some aspects, the bicistronic polynucleotide is bicistronic construct 3. In some aspects, the bicistronic polynucleotide is bicistronic construct 4. In some aspects, the bicistronic polynucleotide is bicistronic construct 5. In some respects, the bicistronic polynucleotide is a bicistronic construct 6. In some respects, the bicistronic polynucleotide is a bicistronic construct 7. In some respects, the bicistronic polynucleotide is a bicistronic construct 8. In some respects, the bicistronic polynucleotide is a complete donor 1. In some respects, the bicistronic polynucleotide is a complete donor 2. In some respects, the bicistronic polynucleotide is a complete donor 3. In some respects, the bicistronic polynucleotide is a complete donor 4. In some respects, the bicistronic polynucleotide is a complete donor 5. In some respects, the bicistronic polynucleotide is a complete donor 6. In some respects, the bicistronic polynucleotide is a complete donor 7. In some respects, the bicistronic polynucleotide is a complete donor 8.

[0225] This disclosure provides a method for generating a durable population of genetically engineered cells (e.g., T cells) in a subject diagnosed with, for example, cancer or an inflammatory disease, the method comprising administering to the subject cells genetically engineered to express a bicistronic polynucleotide disclosed herein (e.g., a bicistronic construct encoding a CAR or any other therapeutic protein (e.g., an antibody). A method for expanding a population of genetically engineered cells (e.g., T cells) in a subject diagnosed with cancer or an inflammatory disease is also provided, the method comprising administering to the subject cells genetically engineered to express a bicistronic polynucleotide disclosed herein. In some aspects, the cells are T cells. In some aspects, the T cells are allogeneic T cells. In some aspects, the subject is a human subject.

[0226] This disclosure also provides a method for generating allogeneic cells for gene therapy, the method comprising inserting a bicistronic construct comprising a nucleic acid encoding a therapeutic agent and a nucleic acid encoding an immune surveillance masking molecule (ISMM) into a β-2-microglobulin (B2M) gene, wherein the insertion of the bicistronic construct inactivates the B2M gene. In some aspects, the bicistronic construct gene may be inserted into other genes, the inactivation of which leads to a weakened immune response when the genetically modified cells are administered to a subject who is not a cell donor. In some aspects, the nucleic acid encoding the ISMM comprises a nucleic acid encoding a human leukocyte antigen (HLA) selected from HLA-E or HLA-G, or a functional variant thereof. In some aspects, the gene therapy is CAR-T therapy.

[0227] In some respects, the insertion sites in the B2M gene are selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); or site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

[0228] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the corresponding position in the complementary strand of the B2M gene relative to the 5' end of site 1.

[0229] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the corresponding position in the complementary strand of the B2M gene at the 3' end of site 1.

[0230] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the corresponding position in the complementary strand of the B2M gene relative to the 5' end of site 2.

[0231] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the corresponding position in the complementary strand of the B2M gene at the 3' end of site 2.

[0232] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the corresponding position in the complementary strand of the B2M gene relative to the 5' end of site 3.

[0233] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the corresponding position in the complementary strand of the B2M gene at the 3' end of site 3.

[0234] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the corresponding position in the complementary strand of the B2M gene relative to the 5' end of site 4.

[0235] In some respects, the insertion site comprises a sequence of approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the corresponding position in the complementary strand of the B2M gene at the 3' end of site 4.

[0236] In some respects, the insertion site is an insertion site that overlaps with site 1, site 2, site 3, or site 4. In other respects, the insertion site is located at a corresponding position on the complementary strand of the B2M gene.

[0237] Also provided are (i) the bicistronic polynucleotide disclosed herein; (ii) a vector comprising the bicistronic polynucleotide of (i); (iii) a composition comprising (i) or (ii); (iv) a kit comprising (i), (ii) or (iii); (v) a cell comprising any one of (i), (ii) or (iii); (vi) a composition comprising (v); (vii) a pharmaceutical composition comprising (i), (ii), (iii), (v) or (vi); or (viii) a kit comprising (v), (vi) or (vii) for use as a pharmaceutical.

[0238] Also provided are (i) the bicistronic polynucleotide disclosed herein; (ii) a vector comprising the bicistronic polynucleotide of (i); (iii) a composition comprising (i) or (ii); (iv) a kit comprising (i), (ii) or (iii); (v) a cell comprising any one of (i), (ii) or (iii); (vi) a composition comprising (v); (vii) a pharmaceutical composition comprising (i), (ii), (iii), (v) or (vi); or (viii) a kit comprising (v), (vi) or (vii) for use as a medicine for treating a subject with cancer or an inflammatory disease or condition in need.

[0239] Also provided are (i) the bicistronic polynucleotide disclosed herein; (ii) a vector comprising the bicistronic polynucleotide of (i); (iii) a composition comprising (i) or (ii); (iv) a kit comprising (i), (ii) or (iii); (v) a cell comprising any one of (i), (ii) or (iii); (vi) a composition comprising (v); (vii) a pharmaceutical composition comprising (i), (ii), (iii), (v) or (vi); or (viii) a kit comprising (v), (vi) or (vii) for manufacturing a medicament for treating a subject with cancer or an inflammatory disease or condition in need.

[0240] VII. Therapeutic agents

[0241] The bicistronic polynucleotides disclosed herein contain genes of interest encoding therapeutic agents. In some aspects, the genes of interest contain one or more polynucleotide sequences encoding a biologic agent (e.g., a CAR), an antibody, or its antigen-binding moiety. In some aspects, the genes of interest contain polynucleotide sequences encoding proteins containing amino acid sequences that are wholly or substantially similar to those of one of the following proteins: tumor necrosis factor (TNF), flt3 ligand (WO 94 / 28391), erythropoietin, thrombopoietin, calcitonin, IL-2, angiopoietin-2 (Maisonpierre et al. (1997), Science 277(5322):55-60), ligand of NF-κB receptor activator (RANKL, WO 01 / 36637), tumor necrosis factor (TNF)-associated apoptosis-inducing ligand (TRAIL, WO 97 / 01633), thymic stromal lymphopoietin, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor (GM-CSF, Australian Patent No. 588819), mast cell growth factor, stem cell growth factor (US Patent No. 6,204,363), epidermal growth factor, keratinocyte growth factor, megakaryocyte growth factor, RANTES, human fibrinogen-like protein 2 (FGL2; NCBI accession number NM_00682; Rüegg and Pytela (1995), Gene 160:257-62), growth hormone, insulin, insulinotropic hormone, insulin-like growth factor, parathyroid hormone, interferon (including α-interferon, γ-interferon and co-interferon) (US Patent Nos. 4,695,623 and 4,897,471), nerve growth factor, brain-derived neurotrophic factor, synaptic binding protein-like protein (SLP) 1-5), neurotrophic factor-3, glucagon, interleukin, colony-stimulating factor, lymphotoxin-β, leukemia inhibitory factor, and oncogene-M.See, for example, Human Cytokines: Handbook for Basic and Clinical Research, all volumes (Aggarwal and Gutterman, eds. Blackwell Sciences, Cambridge, Mass., 1998); Growth Factors: A Practical Approach (McKay and Leigh, eds., Oxford University Press Inc., New York, 1993); and The Cytokine Handbook, Vols. 1 and 2 (Thompson and Lotze, eds., Academic Press, San Diego, Calif., 2003), which are incorporated herein by reference in their entirety.

[0242] In some respects, the gene of interest contains a polynucleotide sequence encoding a protein (e.g., a chimeric or fusion protein) that contains all or part of the amino acid sequence of a receptor for any of the aforementioned proteins, an antagonist of such a receptor or any of the aforementioned proteins, and / or a protein substantially similar to such a receptor or antagonist. These receptors and antagonists include: two forms of tumor necrosis factor receptor (TNFR, referred to as p55 and p75, U.S. Patent Nos. 5,395,760 and 5,610,279), interleukin-1 (IL-1) receptors (types I and II; EP Patent No. 0460846, U.S. Patent Nos. 4,968,607 and 5,767,064), IL-1 receptor antagonists (U.S. Patent No. 6,337,072), IL-1 antagonists, or inhibitors. (US Patent Nos. 5,981,713, 6,096,728 and 5,075,222), IL-2 receptor, IL-4 receptor (EP Patent No. 0,367,566 and US Patent No. 5,856,296), IL-15 receptor, IL-17 receptor, IL-18 receptor, Fc receptor, granulocyte-macrophage colony-stimulating factor receptor, granulocyte colony-stimulating factor receptor, receptors for oncogene-M and leukemia inhibitory factor, NF-κB receptor activator (RANK, WO 01 / 36637 and US Patent No. 6,271,349), osteoprotegerin (US Patent No. 6,015,938), TRAIL receptors (including TRAIL receptors 1, 2, 3 and 4) and receptors containing death domains (such as Fas or apoptosis-inducing receptor (AIR)).

[0243] In some respects, genes of interest contain polynucleotide sequences encoding proteins that contain all or part of the amino acid sequence of a differentiation antigen (called a CD protein) or its ligand, or proteins substantially similar to either of these. Examples of such antigens include CD22, CD27, CD30, CD39, CD40, and their ligands (CD27 ligand, CD30 ligand, etc.). Several of the CD antigens are members of the TNF receptor family, which also includes 41BB and OX40. The ligands are typically members of the TNF family, such as the 41BB ligand and the OX40 ligand.

[0244] In some aspects, genes of interest comprising polynucleotide sequences encoding proteins or ligands thereof that have enzymatic activity can also be generated using the present invention. Therefore, in some aspects, the bicistronic constructs of this disclosure can be used for gene replacement therapy, for example, to replace a defective gene copy encoding an enzyme (e.g., a clotting factor) with a fully functional gene copy. In this respect, the bicistronic construct can be inserted into the B2M gene, or it can be inserted into a locus of a defective gene. Examples of proteins with enzymatic activity include all or part of one of the following proteins or their ligands, or proteins substantially similar to one of these: members of the integrin metalloproteinase domain family (including TNF-α convertase), kinases, glucocerebrosidase, superoxide dismutase, tissue plasminogen activator, factor VIII, factor IX, apolipoprotein E, apolipoprotein AI, globin, IL-2 antagonists, α-1 antitrypsin, ligands of any of the above enzymes, and any other enzymes and their ligands.

[0245] In some respects, genes of interest contain polynucleotide sequences encoding antibodies or their antigen-binding portions.Examples of antibodies include, but are not limited to, those that recognize any or a combination of proteins, including but not limited to the proteins described above and / or the following antigens: CD2, CD3, CD4, CD8, CD11a, CD14, CD18, CD20, CD22, CD23, CD25, CD33, CD40, CD44, CD52, CD80 (B7.1), CD86 (B7.2), CD147, IL-1α, IL-1β, IL-2, IL-3, IL-7, IL-4, IL-5, IL-8, IL-10, IL... -2 receptor, IL-4 receptor, IL-6 receptor, IL-13 receptor, IL-18 receptor subunit, FGL2, PDGF-β and its analogues (see US Patent Nos. 5,272,064 and 5,149,792), VEGF, TGF, TGF-β2, TGF-β1, EGF receptor (see US Patent No. 6,235,883), VEGF receptor, hepatocyte growth factor, osteoprotegerin ligand, interferon-γ, B lymphocyte stimulators (BlyS, also known as BAFF, THANK, TALL-1 and zTNF4; see Do and Chen-Kiang (2002), Cytokine Growth Factor) Rev.13(1):19-25), C5 complement, IgE, tumor antigen CA125, tumor antigen MUC1, PEM antigen, LCG (which is a gene product associated with lung cancer), HER-2, HER-3, RAS (e.g., K-RAS), tumor-associated glycoprotein TAG-72, SK-1 antigen, tumor-associated epitopes present at elevated levels in the serum of patients with colon cancer and / or pancreatic cancer, cancer-associated epitopes or proteins expressed in breast cancer, colon cancer, squamous cell, prostate cancer, pancreatic cancer, lung cancer and / or renal cell carcinoma and / or melanoma, glioma or neuroblastoma cells, necrotic core of tumor, integrin α4β7, integrin VLA-4, B2 integrin, TRAIL receptors 1, 2, 3 and 4, RANK, RANK ligand, TNF-α, adhesion molecule VAP-1, epithelial cell adhesion molecule (EpCAM), intercellular adhesion molecule-3 (ICAM-3), leukocyte integrin, platelet glycoprotein gp IIb / IIIa, cardiac myosin heavy chain, parathyroid hormone, rNAPc2 (an inhibitor of factor VIIa-tissue factor), MHC I, carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), tumor necrosis factor (TNF), CTLA-4 (a cytotoxic T lymphocyte-associated antigen), Fc-γ-1 receptor, HLA-DR10β, HLA-DR antigen, sclerosing protein, L-selectin, respiratory syncytial virus, human immunodeficiency virus (HIV), hepatitis B virus (HBV), Streptococcus mutans, and Staphylococcus aureus.

[0246] Specific examples of known antibodies or their antigen-binding moieties that can be generated using the methods of the present invention include, but are not limited to, adalimumab, atezolizumab, bevacizumab, infliximab, abciximab, alemtuzumab, avelumab, bavizumab, baliximab, belimumab, BMS-986156, budesonide, canamalbrine, cimiprimab, cetuzumab (polyethylene glycol), cetuximab, konnabumab, CX-072, denosumab, durvalumab, iculizumab, gemtuzumab, oxazolidin, golimumab, teimozumab, INCAGN01876, ipilimumab, labezizumab, L Y300054, Mapamoumab, Matozumab, Meporibumab, Movizumab, Morozumab-CD3, Natazumab, Nitozumab, Nivolumab, Ofamumab, Omalazumab, Ogovolumab, Pallizumab, Panitumab, PDR001, Ocelumab, Pembrolizumab, Pentozumab, Pertuzumab, Ranibizumab, Sintilimab, Rituximab, Lovizumab, Tislelizumab, Tocilizumab, Tosimo, Trimelimumab, Trastuzumab, TRX518, Ustenolimab, Vedolzumab, Vopalimumab, XmAb23104, Zalumab and Zalumab.

[0247] In some respects, bicistronic polynucleotides can encode anti-GITR antibodies, such as TRX518, INCAGN01876, and BMS-986156. In some respects, bicistronic polynucleotides can encode anti-OX40 antibodies, such as oxeluzumab. In some respects, bicistronic polynucleotides can encode anti-ICOS (CD278), such as vopalimumab or XmAb23104 (anti-PD-1 / anti-ICOS). In some respects, bicistronic polynucleotides can encode anti-4-1BB (CD137), such as urinumab, utorumab, INBRX-105 (anti-PD-L1 / anti-4-1BB), or MCL A-145 (anti-PD-L1 / anti-4-1BB). In some respects, bicistronic polynucleotides can encode anti-PD-1 antibodies, such as nivolumab, pembrolizumab, cimipril, PDR001, CBT-501, CX-188, TSR-042, XmAb20717 (anti-PD-1 / anti-CTLA-4), cilimab (JNJ-63723283), gemvitumab (for canine veterinary use), sintilimab (IBI308), tislelizumab, pildilizumab, and palolimab (BCD). 100), Camrelizumab (SHR-1210), XmAb23104 (anti-PD-1 / anti-ICOS), AK104 (anti-PD-1 / anti-CTLA-4), MGD019 (anti-PD-1 / anti-CTLA-4), XmAb20717 (anti-PD-1 / anti-CTLA-4), MEDI5752 (anti-PD-1 / anti-CTLA-4), MGD013 (anti-PD-1 / anti-LAG3), RO7121661(RG7769) (anti-PD-1 / anti-TIM3), or IBI318 (anti-PD-1 / undisclosed TAA). In some respects, bicistronic polynucleotides can encode anti-PD-L2, such as AMP-224. In some respects, bicistronic polynucleotides can encode anti-CTLA-4, such as ipilimumab, XmAb20717 (anti-PD-1 / anti-CTLA-4), trimemumab, AK104 (anti-PD-1 / anti-CTLA-4), MGD019 (anti-PD-1 / anti-CTLA-4), XmAb20717 (anti-PD-1 / anti-CTLA-4), MEDI5752 (anti-PD-1 / anti-CTLA-4), or KN046 (anti-PD-L1 / anti-CTLA-4).In some respects, bicistronic polynucleotides can encode anti-VEGF, such as varrilezumab, bevacizumab, nascizizumab (OMP-305B83) (anti-DLL4 / anti-VEGF), ABL101 (NOV1501) (anti-DLL4 / anti-VEGF), ranibizumab, farexizumab (anti-Ang2 / anti-VEGFA), varuscizumab (anti-Ang2 / anti-VEGF), BI836880 (anti-Ang2 / anti-VEGFA), or ABT165 (anti-DLL4 / anti-VEGF). In some respects, bicistronic polynucleotides can encode anti-VEGFR1, such as erucumab (IMC-18F1). In some respects, bicistronic polynucleotides can encode anti-VEGFR2, such as ramucirumab, aracizumab, or 33C3. In some respects, bicistronic polynucleotides can encode CAR-T therapies such as IMM-3, akirencin, AUTO, immunotoxins, sparX / ARC-T therapy, or BCMACAR-T. In some respects, bicistronic polynucleotides can encode angiopoietin 2 (Ang2) inhibitors such as vanucizumab (anti-Ang2 / anti-VEGF), fareximab (anti-Ang2 / anti-VEGFA), nevasumab, or BI836880 (anti-Ang2 / anti-VEGFA). In some respects, bicistronic polynucleotides can encode anti-FGFR1, such as BFKB8488A (RG7992) (anti-FGFR1 / anti-KLB). In some respects, bicistronic polynucleotides can encode anti-FGFR2, such as bematuzumab (FPA144) or apulutuzumab (BAY 1179470). In some respects, bicistronic polynucleotides can encode anti-DLL4 / anti-VEGF, such as nascizidumab (anti-DLL4 / anti-VEGF), ABL101(NOV1501) (anti-DLL4 / anti-VEGF), or ABT165 (anti-DLL4 / anti-VEGF). In some respects, bicistronic polynucleotides can encode anti-Notch, such as brontocilizumab or tarotuzumab. In some respects, bicistronic polynucleotides can encode anti-DLL4, such as nascizidumab (anti-DLL4 / anti-VEGF), ABL101(NOV1501) (anti-DLL4 / anti-VEGF), ABT165 (anti-DLL4 / anti-VEGF), or densizumab.

[0248] In some respects, the gene of interest comprises a polynucleotide sequence encoding a recombinant fusion protein comprising, for example, any of the proteins described above or a functional fragment thereof (e.g., an enzymatically active portion or an antigen-binding portion). For example, the methods of the present invention can be used to generate recombinant fusion proteins comprising one of the proteins described above or a functional portion thereof plus a polymerizing domain (such as a leucine zipper, a coiled helix, the Fc portion of an immunoglobulin, or substantially similar proteins). See, for example, WO94 / 10308; Lovejoy et al. (1993), Science 259:1288-1293; Harbury et al. (1993), Science 262:1401-05; Harbury et al. (1994), Nature 371:80-83; et al. (1999), Structure 7:255-64.

[0249] Such recombinant fusion proteins specifically include proteins in which a portion of the receptor is fused to the Fc portion of an antibody, such as etanercept (p75 TNFR:Fc), abatacept, or berazepam (CTLA4:Fc). In some respects, the genes of interest contain polynucleotide sequences encoding markers (e.g., selectable markers such as GFP or luciferase).

[0250] VIII. Indications

[0251] In some respects, the compositions disclosed herein, such as the bicistronic polynucleotides of this disclosure; carriers containing bicistronic polynucleotides; or cells containing them, may be used to prevent or treat diseases or conditions such as proliferative disorders (such as cancer or malignant tumors) or precancerous conditions (such as spinal dysplasia, myelodysplastic syndromes, or preleukemia).

[0252] “Cancer” refers to a broad class of various proliferative disorders characterized by the uncontrolled growth of abnormal cells in the body. Uncontrolled cell division and growth lead to the formation of malignant tumors that invade adjacent tissues and can also metastasize to distant parts of the body via the lymphatic system or bloodstream. As used herein, the term “proliferative” condition or disease refers to the unwanted proliferation of one or more subpopulations of cells in a multicellular organism, resulting in harm to the multicellular organism (i.e., discomfort or shortened life expectancy). For example, as used herein, proliferative conditions or diseases include neoplastic conditions and other proliferative disorders. As used herein, “neoplastic” refers to any form of disordered or uncontrolled cell growth (whether malignant or benign) that results in abnormal tissue growth. Therefore, “neoplastic cells” include both malignant and benign cells with disordered or uncontrolled cell growth. In some respects, cancer is a tumor. As used herein, “tumor” refers to all neoplastic cell growth and proliferation (whether malignant or benign), as well as all precancerous and cancerous cells and tissues.

[0253] In some respects, the disease is a solid or liquid tumor. In some respects, the cancer is pancreatic cancer. In some respects, the disease is a blood cancer. In some respects, the blood cancer is leukemia. In some respects, the cancer is selected from the group consisting of: one or more acute leukemias, including but not limited to B-cell acute lymphoblastic leukemia (BALL), T-cell acute lymphoblastic leukemia (TALL), small lymphoblastic leukemia (SLL), and acute lymphoblastic leukemia (ALL) (e.g., relapsed and refractory ALL); and one or more chronic leukemias, including but not limited to chronic myeloid leukemia (CML) and chronic lymphocytic leukemia (CLL). Additional hematologic malignancies or conditions include, but are not limited to, mantle cell lymphoma (MCL), B-cell prolymphocytic leukemia, blastoid plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, mucosa-associated lymphoid tissue lymphoma (MALT lymphoma), marginal zone lymphoma, multiple myeloma, myelodyplasia and myelodysplastic syndromes, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenström macroglobulinemia, and preleukemia. Preleukemia encompasses a variety of hematologic conditions resulting from ineffective (or dysplastic) production of myeloid blood cells. In some respects, the indications are atypical and / or nonclassical cancers, malignancies, precancerous conditions, or proliferative disorders; and any combination thereof.

[0254] In some respects, the disease is lymphoma, such as MCL or Hodgkin's lymphoma. In some respects, the disease is leukemia, such as SLL, CLL, and / or ALL. In some respects, the disease associated with the tumor antigen (e.g., the tumor antigen described herein) is selected from proliferative disorders (such as cancer or malignancy) or precancerous conditions (such as spinal dysplasia, myelodysplastic syndrome, or preleukemia), or non-cancer-related indications associated with the expression of the tumor antigen described herein. In some respects, the disease associated with the tumor antigen described herein is a solid tumor, such as the solid tumors described herein, such as prostate cancer, colorectal cancer, pancreatic cancer, cervical cancer, gastric cancer, ovarian cancer, head cancer, or lung cancer.

[0255] In some respects, cancer is selected from AML, ALL, B-ALL, T-ALL, B-cell prolymphocytic leukemia, chronic lymphocytic leukemia, CML, hairy cell leukemia, Hodgkin's lymphoma, mast cell disease, myelodysplastic syndrome, myeloproliferative neoplasm, plasma cell myeloma, plasmacytoid dendritic cell tumor, or combinations thereof.

[0256] In some aspects, the compositions disclosed herein (e.g., polynucleotides encoding the CARs of this disclosure, vectors containing polynucleotides encoding the CARs of this disclosure, the CARs of this disclosure, or cells expressing the CARs of this disclosure, such as CAR-T cells) are used to reduce or shrink tumor size or inhibit tumor growth in subjects in need. In some aspects, the tumor is cancer (i.e., cancer of epithelial origin). In some aspects, the tumor is selected, for example, from the group consisting of: gastric cancer, gastroesophageal junction cancer (GEJ), esophageal cancer, colorectal cancer, liver cancer (hepatocellular carcinoma, HCC), ovarian cancer, breast cancer, NSCLC, bladder cancer, lung cancer, pancreatic cancer, head and neck cancer, lymphoma, uterine cancer, kidney cancer or renal cancer, biliary tract cancer, prostate cancer, testicular cancer, urethral cancer, penile cancer, thymic cancer, rectal cancer, brain cancer (glioma and glioblastoma), cervical cancer, parotid gland cancer, laryngeal cancer, thyroid cancer, adenocarcinoma, neuroblastoma, melanoma, and Merkel cell carcinoma.

[0257] “Cancer” or “cancer tissue” can include tumors at different stages. In some respects, cancer or tumor is stage 0, meaning it is in a very early stage of development and has not yet metastasized. In some respects, cancer or tumor is stage I, meaning it is relatively small, has not spread to nearby tissues, and has not yet metastasized. In other respects, cancer or tumor is stage II or III, meaning it is larger than stage 0 or I and has grown into adjacent tissues, but has not yet metastasized except for the possibility of metastasis to lymph nodes. In still other respects, cancer or tumor is stage IV, meaning it has metastasized. Stage IV can also be referred to as advanced or metastatic cancer.

[0258] In some respects, cancer can include, but is not limited to, adrenocortical carcinoma, advanced cancer, anal cancer, aplastic anemia, bile duct cancer, bladder cancer, bone cancer, bone metastases, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of unknown primary cause, Castrmann disease, cervical cancer, colon / rectal cancer, endometrial cancer, esophageal cancer, Ewing family cancer, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin's disease, Kaposi's sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancer, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and chronic myelomonocytic leukemia. Diseases, liver cancer, non-small cell lung cancer, small cell lung cancer, lung carcinoid, cutaneous lymphoma, malignant mesothelioma, multiple myeloma, myelodysplastic syndrome, nasal cavity and sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, oral and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary adenoma, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, adult soft tissue sarcoma, basal and squamous cell skin cancer, melanoma, small intestine cancer, gastric cancer, testicular cancer, laryngeal cancer, thymic cancer, thyroid cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, Wilms' tumor, and secondary cancers caused by cancer treatment.

[0259] In some respects, a tumor is a solid tumor. "Solid tumors" include, but are not limited to, sarcomas, melanomas, carcinomas, or other solid tumor cancers. A "sarcoma" is a tumor composed of material similar to embryonic connective tissue and is typically composed of tightly packed cells embedded in fibrous or homogeneous material. Sarcomas include, but are not limited to, chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, and Abemethy's sarcoma. sarcoma), liposarcoma, alveolar soft tissue sarcoma, ameloblastic sarcoma, botryoid sarcoma, green tumor sarcoma, choriocarcinoma, embryonal sarcoma, nephroblastoma sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, B-cell immunoblastic sarcoma, lymphoma, T-cell immunoblastic sarcoma, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukemic sarcoma, malignant mesenchymal sarcoma, paraosteal sarcoma, reticulum cell sarcoma, Rous sarcoma, serous cystic sarcoma, synovial sarcoma, or capillary hemangiosarcoma.

[0260] The term "melanoma" refers to a tumor arising from the melanocyte system of the skin and other organs. Melanomas include, for example, acral lentigines melanoma, amelanoma, benign juvenile melanoma, Claudemann melanoma, S91 melanoma, Harding-Parcy melanoma, juvenile melanoma, malignant lentigines melanoma, malignant melanoma, metastatic melanoma, nodular melanoma, subungual melanoma, or superficial spreading melanoma.

[0261] The term "cancer" refers to a malignant new growth composed of epithelial cells that tend to infiltrate surrounding tissues and cause metastasis. Exemplary cancers include, for example, acinar carcinoma, acinar cystic carcinoma, adenoid cystic carcinoma, acinoid cystic carcinoma, adrenocortical carcinoma, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, basoid cell carcinoma, basoid carcinoma, basal squamous cell carcinoma, bronchioloalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, brain cancer, cholangiocarcinoma, choriocarcinoma, colloid carcinoma, comedo carcinoma, uterine endometrial cancer, cribriform carcinoma, armored carcinoma, skin cancer, cylindrical carcinoma, cylindrical cell carcinoma, ductal carcinoma, sclerosing carcinoma, embryonal carcinoma, brain-like carcinoma, epidermoid carcinoma, adenoid epithelial carcinoma, exophytic carcinoma, ulcerative carcinoma, fibrocarcinoma, colloid carcinoma, gel carcinoma, giant cell carcinoma, giant cell carcinoma, adenocarcinoma, granular cell carcinoma, dermal carcinoma, hemangiocarcinoma, hepatocellular carcinoma, Hütter cell carcinoma, hyalinoid carcinoma, renal-like carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepithelial carcinoma, and so on. Intradermal carcinoma, Crompcher carcinoma, Kurchitzky cell carcinoma, large cell carcinoma, lenticular carcinoma, bean-shaped carcinoma, lipoma-like carcinoma, lymphoepithelial carcinoma, medullary carcinoma, medullary carcinoma, melanoma, soft carcinoma, mucinous carcinoma, mucinous cell carcinoma, mucinous epidermoid carcinoma, colloid carcinoma, mucinous carcinoma, myxomatoid carcinoma, nasopharyngeal carcinoma, oat cell carcinoma, ossifying carcinoma, osteoid carcinoma, papillary carcinoma, periportal carcinoma, invasive precarcinoma, acanthosis nigra, medullary carcinoma, renal cell carcinoma, reserve cell carcinoma, carcinosarcoma-like carcinoma, Schneider's carcinoma, scleroderma, scrotal carcinoma, signet ring cell carcinoma, simple carcinoma, small cell carcinoma, potato-shaped carcinoma, spherical cell carcinoma, spindle cell carcinoma, cavernous carcinoma, squamous carcinoma, squamous cell carcinoma, cord carcinoma, telangiectatic carcinoma, telangiectatic carcinoma, transitional cell carcinoma, nodular carcinoma, nodular carcinoma, verrucous carcinoma, or villous carcinoma.

[0262] Additional cancers that can be treated with the compositions disclosed herein (e.g., polynucleotides encoding the CARs disclosed herein, vectors containing polynucleotides encoding the CARs disclosed herein, the CARs disclosed herein, or cells expressing the CARs disclosed herein, such as CAR-T cells) include, for example, leukemia, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, essential thrombocytosis, essential macroglobulinemia, small cell lung tumors, primary brain tumors, gastric cancer, colon cancer, malignant islet tumors, malignant carcinoid tumors, bladder cancer, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, papillary thyroid carcinoma, neuroblastoma, neuroendocrine carcinoma, esophageal cancer, urogenital tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenocortical carcinoma, prostate cancer, Müllerian duct carcinoma, ovarian cancer, peritoneal cancer, fallopian tube cancer, or papillary serous uterine carcinoma.

[0263] Other diseases, conditions, and illnesses that can be treated with the compositions disclosed herein include, for example, inflammatory diseases or illnesses, neurodegenerative diseases, enzyme deficiencies, hormone deficiencies, coagulation disorders, or infections.

[0264] IX. Nucleases

[0265] The bicistronic polypeptide of this disclosure can be inserted into a specific location (site) of a target gene using any method known in the art. In some aspects, a nuclease is used to insert the bicistronic polypeptide of this disclosure into the gene. As used herein, the term "nuclease" refers to an enzyme that has catalytic activity for DNA cleavage. In some aspects, the nuclease reagent can promote homologous recombination between the bicistronic construct (BC1-BC8) or the complete donor construct (FD1-FD8) disclosed herein and a gene (e.g., the B2M gene). In some aspects, the bicistronic construct to be integrated into the genome of a host cell line (e.g., T cells) contains a homologous region adjacent to a sequence (e.g., sites 1 to 4) targeted by a nuclease (e.g., CRISPR / Cas nuclease).

[0266] The size of the recognition sites of nucleases mediating homologous recombination can vary and includes, for example, recognition sites of the following lengths: at least about 4, at least about 6, at least about 8, at least about 10, at least about 12, at least about 14, at least about 16, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least... Approximately 41, at least approximately 42, at least approximately 43, at least approximately 44, at least approximately 45, at least approximately 46, at least approximately 47, at least approximately 48, at least approximately 49, at least approximately 50, at least approximately 51, at least approximately 52, at least approximately 53, at least approximately 54, at least approximately 55, at least approximately 56, at least approximately 57, at least approximately 58, at least approximately 59, at least approximately 60, at least approximately 61, at least approximately 62, at least approximately 63, at least approximately 64, at least approximately 65, at least approximately 66, at least approximately 67, at least approximately 68, at least approximately 69, at least approximately 70, at least approximately 80, at least approximately 90, at least approximately 100, at least approximately 110, at least approximately 120, at least approximately 1 30, at least approximately 140, at least approximately 150, at least approximately 160, at least approximately 170, at least approximately 180, at least approximately 190, at least approximately 200, at least approximately 210, at least approximately 220, at least approximately 230, at least approximately 240, at least approximately 250, at least approximately 260, at least approximately 270, at least approximately 280, at least approximately 290, at least approximately 300, at least approximately 310, at least approximately 320, at least approximately 330, at least approximately 340, at least approximately 350, at least approximately 360, at least approximately 370, at least approximately 380, at least approximately 390, at least approximately 400, at least approximately 410, at least approximately 420, at least approximately 430, at least approximately 440 1, at least approximately 450, at least approximately 460, at least approximately 470, at least approximately 480, at least approximately 490, at least approximately 500, at least approximately 510, at least approximately 520, at least approximately 530, at least approximately 540, at least approximately 550, at least approximately 560, at least approximately 570, at least approximately 580, at least approximately 590, at least approximately 600, at least approximately 610, at least approximately 620, at least approximately 630, at least approximately 640, at least approximately 650, at least approximately 660, at least approximately 670, at least approximately 680, at least approximately 690, at least approximately 700, at least approximately 710, at least approximately 720, at least approximately 730, at least approximately 740, at least approximately 750At least approximately 760, at least approximately 770, at least approximately 780, at least approximately 790, at least approximately 800, at least approximately 810, at least approximately 820, at least approximately 830, at least approximately 840, at least approximately 850, at least approximately 860, at least approximately 870, at least approximately 880, at least approximately 890, at least approximately 900, at least approximately 910, at least approximately 920, at least approximately 930, at least approximately 940, at least approximately 950, at least approximately 960, at least approximately 970, at least approximately 980, at least approximately 990, at least approximately 1000 or more nucleotides.

[0267] The size of the recognition sites of nucleases mediating homologous recombination can vary and includes, for example, recognition sites of the following lengths: approximately 4, approximately 6, approximately 8, approximately 10, approximately 12, approximately 14, approximately 16, approximately 18, approximately 19, approximately 20, approximately 21, approximately 22, approximately 23, approximately 24, approximately 25, approximately 26, approximately 27, approximately 28, approximately 29, approximately 30, approximately 31, approximately 32, approximately 33, approximately 34, approximately 35, approximately 36, approximately 37, approximately 38, approximately 39, approximately 40, approximately 41, approximately 42, approximately 43, approximately 44, approximately 45, approximately 46, approximately 47, approximately 48. Approximately 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, approximately 270, approximately 280, approximately 290, approximately 300, approximately 310, approximately 320, approximately 330, approximately 340, approximately 350, approximately 360, approximately 370, approximately 380, approximately 390, approximately 400, approximately 410, approximately 420, approximately 430, approximately 440, approximately 450, approximately 460, approximately 470, approximately 480, approximately 490, approximately 500, approximately 510, approximately 520, approximately 530, approximately 540, approximately 550, approximately 560, approximately 570, approximately 580, approximately 590, approximately 600, approximately 610, approximately 620, approximately 630, approximately 640 Approximately 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, approximately 1000 or more nucleotides.

[0268] In one aspect, each monomer of the nuclease reagent recognizes a recognition site of at least 9 nucleotides. In other aspects, the recognition site is about 9 to about 12 nucleotides in length, about 12 to about 15 nucleotides in length, about 15 to about 18 nucleotides in length, or about 18 to about 21 nucleotides in length, and any combination of such ranges (e.g., 9-18 nucleotides).

[0269] Recognition sites can be palindromic, meaning the sequence on one strand is identical to the sequence read in the opposite direction on the complementary strand. It should be understood that a given nuclease reagent can bind to and cleave the recognition site, or alternatively, the nuclease reagent can bind to a sequence different from the recognition site. Furthermore, the term recognition site includes both the nuclease reagent binding site and the nick / cleavage site, regardless of whether the nick / cleavage site is inside or outside the nuclease reagent binding site. In another variation, nuclease reagent cleavage can occur at directly opposite nucleotide positions to produce a blunt-end cut, or in other cases, the nicks can be staggered to produce a single-stranded overhang, also known as a "sticky end," which can be a 5' or 3' overhang.

[0270] Any nuclease reagent that induces a gap or double-strand break into the desired recognition site can be used in the methods and compositions disclosed herein. Naturally occurring or native nuclease reagents can be used, provided that the nuclease reagent induces a gap or double-strand break at the desired recognition site. Alternatively, modified or engineered nuclease reagents can be used. "Engineered nuclease reagents" include nucleases engineered (modified or derived) from their natural form to specifically recognize and induce gaps or double-strand breaks in the desired recognition site. Thus, engineered nuclease reagents can be derived from natural, naturally occurring nuclease reagents, or they can be artificially produced or synthesized. Modifications to the nuclease reagent can be as little as one amino acid in a protein cleaving reagent or one nucleotide in a nucleic acid cleaving reagent. In some aspects, engineered nucleases induce gaps or double-strand breaks at recognition sites where the recognition site is not a sequence to be recognized by a natural (unengineered or unmodified) nuclease reagent. The creation of gaps or double-strand breaks in recognition sites or other DNA may be referred to herein as "cleaving" or "cutting" the recognition site or other DNA.

[0271] Nuclease reagents can be introduced into cells by any means known in the art. A polypeptide encoding a nuclease reagent can be introduced directly into cells. Alternatively, a polynucleotide encoding a nuclease reagent can be introduced into cells. When a polynucleotide encoding a nuclease reagent is introduced into cells, the nuclease reagent can be transiently, conditionally, or constitutively expressed within the cells. Thus, the polynucleotide encoding a nuclease reagent can be contained in an expression cassette and operatively linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters of interest are discussed in further detail elsewhere herein. Alternatively, the nuclease reagent can be introduced into cells as mRNA encoding or containing the nuclease reagent.

[0272] Active variants and fragments of nuclease reagents (i.e., engineered nuclease reagents) are also provided. Such active variants may contain at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the native nuclease reagent, wherein the active variant retains the ability to cleave at the desired recognition site and thus retains nick or double-strand break inducing activity. For example, any of the nuclease reagents described herein may be modified from a native nuclease sequence and engineered to recognize and induce nicks or double-strand breaks at recognition sites not recognized by the native nuclease reagent. Thus, in some respects, engineered nucleases possess the specificity to induce nicks or double-strand breaks at recognition sites different from the corresponding native nuclease reagent recognition sites. The determination of nick or double-strand break inducing activity is known and is typically measured by measuring the overall activity and specificity of the nuclease on a DNA substrate containing a recognition site.

[0273] When a nuclease reagent is provided to a cell by introducing a polynucleotide encoding the nuclease reagent, this polynucleotide can be modified to replace a codon with a higher frequency of use in the cell of interest, compared to the naturally occurring polynucleotide sequence encoding the nuclease reagent. For example, the polynucleotide encoding the nuclease reagent can be modified to replace a codon with a higher frequency of use in a given prokaryotic or eukaryotic cell of interest (including bacterial cells, yeast cells, human cells, non-human cells, non-rat eukaryotic cells, mammalian cells, rodent cells, non-rat rodent cells, mouse cells, rat cells, hamster cells, or any other host cell of interest) compared to the naturally occurring polynucleotide sequence.

[0274] In some aspects of this disclosure, homologous recombination is mediated by the CRISPR / Cas system, the TALEN system, the ZFN system, a wide range of nucleases, or restriction endonucleases.

[0275] CRISPR / Cas

[0276] In some aspects, the nuclease reagents used in the various methods and compositions disclosed herein may comprise a CRISPR / Cas system. Such systems may employ, for example, a Cas9 nuclease, which in some cases is codon-optimized for the desired cell type to which it is to be expressed. Such systems may also employ a guide RNA (gRNA) comprising two separate molecules. An exemplary bimolecular gRNA comprises a crRNA-like molecule (“CRISPR RNA” or “target RNA” or “crRNA” or “crRNA repeat sequence”) and a corresponding tracrRNA-like molecule (“trans-activating CRISPR RNA” or “activator-RNA” or “tracrRNA” or “scaffold”).

[0277] crRNA comprises both the DNA targeting region (single-stranded) of gRNA and a segment of one half of a double-stranded RNA (dsRNA) that forms the protein-binding region of gRNA. The corresponding tracrRNA (activator-RNA) comprises the other half of the dsRNA double-stranded RNA that forms the protein-binding region of gRNA. Thus, a segment of crRNA is complementary to and hybridizes with a segment of tracrRNA to form the dsRNA double-stranded RNA of the protein-binding domain of gRNA. Therefore, it can be said that each crRNA has a corresponding tracrRNA. crRNA also provides a single-stranded DNA targeting region. Therefore, gRNA comprises a sequence that hybridizes with the target sequence and tracrRNA. Thus, crRNA and tracrRNA (as corresponding pairs) hybridize to form gRNA. If used for intracellular modification, the exact sequence and / or length of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule will be used.

[0278] Naturally occurring genes encoding three elements (Cas9, tracrRNA, and crRNA) are typically organized as operons. Naturally occurring CRISPR RNAs vary depending on the Cas9 system and the organism, but generally contain a target region of 21 to 72 nucleotides in length, flanked by two direct repeat sequences (DRs) of 21 to 46 nucleotides in length (see, for example, WO2014 / 131833). In the case of *Streptococcus pyogenes*, the DRs are 36 nucleotides long, and the target region is 30 nucleotides long. The DR at the 3' end is complementary to and hybridizes with the corresponding tracrRNA, which then binds to the Cas9 protein.

[0279] Alternatively, the system further employs a fused crRNA-tracrRNA construct (i.e., a single transcript) that functions in conjunction with a codon-optimized Cas9. This single RNA is often referred to as guide RNA or gRNA. Within the gRNA, the crRNA portion is identified as the “target sequence” for a given recognition site, and the tracrRNA is often referred to as the “scaffold.” In short, a short DNA fragment containing the target sequence is inserted into a guide RNA expression plasmid. The gRNA expression plasmid contains the target sequence (approximately 20 nucleotides in some respects), some form of tracrRNA sequence (scaffold), and a suitable promoter active in the cell and elements necessary for proper processing in eukaryotic cells. Many systems rely on custom-designed complementary oligonucleotides that are annealed to form double-stranded DNA, which are then cloned into the gRNA expression plasmid.

[0280] The gRNA expression cassette and the Cas9 expression cassette were then introduced into the cells. See, for example, Mali P et al. (2013) Science 2013 Feb. 15; 339(6121):823-6; Jinek M et al. Science 2012 Aug. 17; 337(6096):816-21; Hwang WY et al. Nat Biotechnol 2013 March; 31(3):227-9; Jiang W et al. Nat Biotechnol 2013 March; 31(3):233-9; and Cong L et al. Science 2013 Feb. 15; 339(6121):819-23, each of which is incorporated herein by reference. See also, for example, WO / 2013 / 176772A1, WO / 2014 / 065596A1, WO / 2014 / 089290A1, WO / 2014 / 093622A2, WO / 2014 / 099750A2 and WO / 2013142578A1, each of which is incorporated herein by reference.

[0281] In some respects, the Cas9 nuclease can be provided as a protein. In some respects, the Cas9 protein can be provided as a complex with gRNA. In other respects, the Cas9 nuclease can be provided as a nucleic acid encoding the protein. The nucleic acid encoding the Cas9 nuclease can be RNA (e.g., messenger RNA (mRNA)) or DNA. In some respects, the gRNA can be provided as RNA. In other respects, the gRNA can be provided as DNA encoding RNA. In some respects, the gRNA can be provided as separate crRNA and tracrRNA molecules or as separate DNA molecules encoding crRNA and tracrRNA, respectively.

[0282] In some respects, the gRNA contains a third nucleic acid sequence encoding a clustered regularly spaced short palindromic repeat (CRISPR) RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). In one respect, the Cas protein is a type I Cas protein. In another respect, the Cas protein is a type II Cas protein. In another respect, the type II Cas protein is Cas9. In another respect, type II Cas (e.g., Cas9) is a human codon-optimized Cas.

[0283] In some respects, Cas proteins are "gap enzymes" that can create single-strand breaks (i.e., "gaps") at target sites without cleaving either strand of double-stranded DNA (dsDNA). For example, Cas9 contains two nuclease domains, namely a RuvC-like nuclease domain and an HNH-like nuclease domain, which are responsible for cleaving opposite DNA strands. Mutations in either of these domains can produce gap enzymes. Examples of mutations that produce gap enzymes can be found, for example, in WO / 2013 / 176772A1 and WO / 2013 / 142578A1, each of which is incorporated herein by reference.

[0284] In some respects, two separate Cas proteins (e.g., nickases) specific to target sites on each strand of dsDNA can produce salient sequences complementary to salient sequences on another nucleic acid, or complementary to salient sequences in different regions on the same nucleic acid. The salients produced by contacting the nucleic acid with two nickases specific to target sites on both strands of dsDNA can be 5' or 3' salients. For example, a first nickase can produce a single-strand break on the first strand of dsDNA, while a second nickase can produce a single-strand break on the second strand of dsDNA, resulting in a salient sequence. The target site of each nickase that produces the single-strand break can be selected such that the resulting salient sequence is complementary to a salient sequence on a different nucleic acid molecule. The complementary salients of the two different nucleic acid molecules can be annealed using the methods disclosed herein. In some respects, the target site of the nickase on the first strand is different from the target site of the nickase on the second strand.

[0285] In some aspects, the first nucleic acid contains a mutation that disrupts at least one amino acid residue at the nuclease active site of the Cas protein, wherein the mutated Cas protein produces a break only in one strand of the target DNA region, and wherein the mutation reduces non-homologous recombination in the target DNA region. In one aspect, the first nucleic acid encoding the Cas protein also contains a nuclear localization signal (NLS). In one aspect, the nuclear localization signal is the SV40 nuclear localization signal.

[0286] TALEN

[0287] In some aspects, the nuclease reagents used in the various methods and compositions disclosed herein may comprise a TALEN system. Thus, in one aspect, the nuclease reagent is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to generate double-strand breaks at specific target sequences in the genome of prokaryotes or eukaryotes. TAL effector nucleases are produced by fusing a natural or engineered transcription activator-like (TAL) effector or its functional portion into the catalytic domain of a nuclease (e.g., FokI).

[0288] The unique modular DNA-binding domain of TAL effectors allows for the design of proteins with potential recognition specificity for any given DNA. Therefore, the DNA-binding domain of TAL effector nucleases can be engineered to recognize specific DNA target sites and thus be used to generate double-strand breaks at desired target sequences. See WO 2010 / 079430; Morbitzer et al. (2010) PNAS 10.1073 / pnas.1013133107; Scholze & Boch (2010) Virulence 1:428-432; Christian et al. Genetics (2010) 186:757-761; Li et al. (2010) Nuc. Acids Res. (2010) doi:10.1093 / nar / gkq704; and Miller et al. (2011) Nature Biotechnology 29:143-148; all of which are incorporated herein by reference.

[0289] Examples of suitable TAL nucleases and methods for preparing suitable TAL nucleases are disclosed, for example, in U.S. Patent Applications Nos. 2011 / 0239315A1, 2011 / 0269234A1, 2011 / 0145940A1, 2003 / 0232410A1, 2005 / 0208489A1, 2005 / 0026157A1, 2005 / 0064474A1, 2006 / 0188987A1 and 2006 / 0063231A1 (each incorporated herein by reference).

[0290] In various respects, TAL effector nucleases are engineered to cleave at or near a target nucleic acid sequence, for example, at a genomic locus of interest, wherein the target nucleic acid sequence is at or near a sequence to be modified with a targeting vector. TAL nucleases suitable for the various methods and compositions provided herein include those specifically designed to bind at or near a target nucleic acid sequence to be modified with a targeting vector as described herein.

[0291] In one aspect, each monomer of TALEN contains 12-25 TAL repeat sequences, wherein each TAL repeat sequence binds a 1 bp subsite. In one aspect, the nuclease reagent is a chimeric protein containing a TAL repeat-based DNA-binding domain operatively linked to an independent nuclease. In one aspect, the independent nuclease is a FokI endonuclease. In one aspect, the nuclease reagent comprises a first TAL repeat-based DNA-binding domain and a second TAL repeat-based DNA-binding domain, wherein each of the first and second TAL repeat-based DNA-binding domains is operatively linked to a FokI nuclease, wherein the first and second TAL repeat-based DNA-binding domains recognize two consecutive target DNA sequences separated by a cleavage site of about 6 bp to about 40 bp on each strand of the target DNA sequence, and wherein the FokI nuclease dimers and generates a double-strand break at the target sequence.

[0292] In one aspect, the nuclease reagent comprises a first TAL repeat-based DNA-binding domain and a second TAL repeat-based DNA-binding domain, wherein each of the first and second TAL repeat-based DNA-binding domains is operatively linked to a FokI nuclease, wherein the first and second TAL repeat-based DNA-binding domains recognize two consecutive target DNA sequences separated by a 5 bp to approximately 6 bp cleavage site in each strand of a target DNA sequence, and wherein the FokI nuclease dimers and produces a double-strand break.

[0293] Zinc finger nucleases (ZFNs)

[0294] In some aspects, the nuclease reagents used in the various methods and compositions disclosed herein may comprise a zinc finger nuclease (ZFN) system. In one aspect, each monomer of the ZFN comprises three or more zinc finger-based DNA-binding domains, wherein each zinc finger-based DNA-binding domain binds a 3 bp subsite. In other aspects, the ZFN is a chimeric protein comprising a zinc finger-based DNA-binding domain operatively linked to an independent nuclease. In one aspect, the independent nuclease is a FokI nuclease. In one aspect, the nuclease reagent comprises a first ZFN and a second ZFN, wherein each of the first and second ZFNs is operatively linked to a FokI nuclease, wherein the first and second ZFNs recognize two consecutive target DNA sequences separated by a cleavage site of about 6 bp to about 40 bp or a cleavage site of about 5 bp to about 6 bp on each strand of the target DNA sequence, and wherein the FokI nuclease dimers and produces a double-strand break. See, for example, US20060246567; US20080182332; US20020081614; US20030021776; WO / 2002 / 057308A2; US20130123484; US20100291048; and WO / 2011 / 017293A2, each of which is incorporated herein by reference.

[0295] Large-scale nucleases

[0296] In some respects, the nuclease reagents used in the various methods and compositions disclosed herein can encompass a wide range of nuclease systems. Based on conserved sequence motifs, wide range of nucleases (or homing endonucleases or HEases) have been classified into four families: the “LAGLIDADG”, “GIY-YIG”, “HNH”, and “His-Cys box” families. These motifs are involved in the coordination of metal ions and the hydrolysis of phosphodiester bonds.

[0297] HEases are noteworthy for their long recognition sites and tolerance to some sequence polymorphisms in their DNA substrates. A wide range of nuclease domains, structures, and functions are known, see, for example, Guhan and Muniyappa (2003) Crit RevBiochem Mol Biol 38:199-248; Lucas et al., (2001) Nucleic Acids Res 29:960-9; Jurica and Stoddard, (1999) Cell Mol Life Sci55:1304-26; Stoddard, (2006) Q RevBiophys 38:49-95; and Moure et al., (2002) Nat Struct Biol 9:764.

[0298] In some instances, a wide range of naturally occurring variants and / or engineered derivatives of nucleases are used. Methods for altering kinetics, cofactor interactions, expression, optimal conditions, and / or recognition site specificity and screening activity are known, see, for example, Epinat et al., (2003) Nucleic Acids Res 31:2952-62; Chevalier et al., (2002) Mol Cell 10:895-905; Gimble et al., (2003) Mol Biol 334:993-1008; Seligman et al., (2002) Nucleic Acids Res 30:3870-9; Sussman et al., (2004) J MolBiol 342:31-41; Rosen et al., (2006) Nucleic Acids Res 34:4791-800; Chames et al., (2005) Nucleic Acids Res 33:e178; Smith et al., (2006) Nucleic Acids Res 34:e149; Gruen et al., (2002) Nucleic Acids Res 30:e29; Chen and Zhao, (2005) Nucleic Acids Res 33:e154; WO2005105989; WO2003078619; WO2006097854; WO2006097853; WO2006097784; and WO2004031346.

[0299] Any of a wide range of nuclease can be used here, including but not limited to I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SecVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII, or any active variant or fragment thereof.

[0300] In one aspect, the broad-spectrum nuclease recognizes double-stranded DNA sequences having 12 to 40 base pairs. In another aspect, the broad-spectrum nuclease recognizes a perfectly matching target sequence in a heterologous plasmid described herein. In one aspect, the broad-spectrum nuclease is a homing nuclease. In one aspect, the homing nuclease is the "LAGLIDADG" family of homing nucleases. In one aspect, the "LAGLIDADG" family of homing nucleases is selected from I-SceI, I-CreI, and I-Dmol.

[0301] Restriction endonucleases

[0302] In some aspects, the nuclease reagents used for homologous recombination in the various methods and compositions disclosed herein may include restriction endonucleases, including type I, type II, type III, and type IV endonucleases. Type I and type III restriction endonucleases recognize specific recognition sites, but typically cleave at a variable distance from the nuclease binding site, which can be hundreds of base pairs away from the cleavage site (recognition site). In the type II system, restriction activity is independent of any methylase activity, and cleavage typically occurs at or near a specific site within the binding site. Most type II enzymes cleave palindromic sequences; however, type IIa enzymes recognize non-palindromic recognition sites and cleave outside the recognition site, type IIb enzymes cleave sequences twice, with both sites outside the recognition site, and type IIs enzymes recognize asymmetric recognition sites and cleave at a defined distance of approximately 1–20 nucleotides from one side of the recognition site. Type IV restriction endonucleases target methylated DNA. Restriction endonucleases have been further described and classified, for example, with reference to the REBASE database (website at rebase.neb.com; Roberts et al., (2003) Nucleic Acids Res 31:418-20); Roberts et al., (2003) Nucleic Acids Res 31:1805-12; and Belfort et al., (2002) in Mobile DNA II, pp.761-783, Eds. Craigie et al. (ASM Press, Washington, DC).

[0303] X. Reagent kits and products

[0304] This disclosure also provides kits and articles thereof, which contain, for example...

[0305] (i) The bicistronic polynucleotides disclosed herein;

[0306] (ii) a vector containing the bicistronic polynucleotide of the present disclosure;

[0307] (iii) A cell containing the bicistronic polynucleotide of the present disclosure; and optionally...

[0308] (iv) Instruction manual.

[0309] In some aspects, this disclosure provides kits and articles comprising, for example, cells genetically modified to express, for example, a CAR of this disclosure (i.e., cells containing one or more polynucleotides encoding, for example, a CAR of this disclosure, or one or more vectors encoding, for example, a CAR of this disclosure (e.g., T cells, natural killer (NK) cells, natural killer T (NKT) cells, or ILC cells)), or pharmaceutical compositions containing such cells, and optionally instructions for use.

[0310] In some aspects, this disclosure provides kits and articles comprising oligonucleotides for nuclease-mediated insertion in the B2M gene, the oligonucleotides being selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

[0311] In some aspects, this disclosure provides kits and articles comprising oligonucleotides for nuclease-mediated insertion in the B2M gene, wherein the oligonucleotides hybridize under stringent conditions with oligonucleotides selected from any of the following sites and their complementary sequences: site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

[0312] In some aspects, this disclosure provides kits and articles comprising a CRISPR / Cas9-mediated insertion gRNA for B2M, wherein the gRNA is selected from any of the following sites and their complementary sequences: site 1 gRNA (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 gRNA (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 gRNA (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); and site 4 gRNA (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

[0313] In some respects, the kit or article contains at least one or more containers a bicistronic polynucleotide encoding, for example, a CAR of the present disclosure, a vector containing a bicistronic polynucleotide encoding, for example, a CAR of the present disclosure, a cell genetically modified to express, for example, a CAR encoded by a bicistronic polynucleotide of the present disclosure, a composition (e.g., a pharmaceutical composition containing a bicistronic polynucleotide, a vector, or a cell disclosed herein), or an oligonucleotide for nuclease-mediated insertion.

[0314] In some respects, the kit or article of manufacture comprises at least a bicistronic polynucleotide encoding, for example, a CAR of the present disclosure, a vector comprising a bicistronic polynucleotide encoding, for example, a CAR of the present disclosure, a cell genetically modified to express, for example, a CAR encoded by a bicistronic polynucleotide of the present disclosure, a composition (e.g., a pharmaceutical composition comprising a bicistronic polynucleotide, a vector or a cell disclosed herein), or an oligonucleotide for nuclease-mediated insertion, and optionally a brochure.

[0315] In some respects, the kit or article comprises at least a bicistronic polynucleotide encoding, for example, a CAR of the present disclosure, a vector comprising a bicistronic polynucleotide encoding, for example, a CAR of the present disclosure, a cell genetically modified to express, for example, a CAR encoded by a bicistronic polynucleotide of the present disclosure, a composition (e.g., a pharmaceutical composition comprising a bicistronic polynucleotide, a vector, or a cell disclosed herein), or an oligonucleotide for nuclease-mediated insertion, and optionally a vial containing at least a solvent or reagent.

[0316] In some respects, the kit or article comprises at least one container containing a bicistronic polynucleotide, such as that disclosed herein, or a vector containing a bicistronic polypeptide of the present disclosure, and one or more other containers having a transfection reagent.

[0317] In some aspects, the kit or article contains at least one container of gRNA oligonucleotides selected from the following sites and their corresponding complementary sequences, and one or more other containers (e.g., CRISPR-Cas reagents) for nuclease-mediated insertion: site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

[0318] Those skilled in the art will readily recognize that bicistronic polynucleotides encoding the CARs of this disclosure, vectors containing bicistronic polynucleotides of this disclosure (e.g., encoding CARs), genetically modified cells to express, for example, CARs encoded by bicistronic polynucleotides of this disclosure, compositions (e.g., pharmaceutical compositions containing bicistronic polynucleotides, vectors, or cells disclosed herein), or oligonucleotides for nuclease-mediated insertion, or combinations thereof, can be readily incorporated into one of the well-established kit formats known in the art.

[0319] sequence

[0320] Sequence information:

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327] *CDR numbering scheme is IMGT

[0328]

[0329]

[0330] The CDR location is identified using Abysis Key Annotation version 3.4.1, which can be obtained from abysis.dot.org.

[0331] Example

[0332] Example 1

[0333] CRISPR-mediated B2M disruption reduces the cell surface expression of B2M and HLA-A / B / C.

[0334] Immune rejection of heterologous CAR-T cells is primarily due to HLA-I presenting donor cells as "non-self" material to the host immune system. HLA class I molecules (including HLA-A / B / C) are expressed as heterodimers on activated T cells, and these heterodimers contain the β2-microglobulin (B2M) subunit. Elimination of B2M on the cell surface, required for HLA expression, via nucleases (such as CRISPR / Cas), removes the cell's ability to recognize HLA mismatches as non-self material.

[0335] Four CRISPR reagents (guide RNA or gRNA) targeting four insertion sites in the B2M gene were designed to specifically target the Cas9 nuclease activity at those insertion sites. These four insertion sites were named site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1), site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2), site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3), and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4)).

[0336] All four insertion sites are located within the exon of the B2M locus in CD4+ T cells. Sites 1, 3, and 4 are on the sense strand, while site 2 is on the antisense strand. Figure 1 Flow cytometry analysis showed that disrupting the B2M locus with CRISPR reagents reduced the expression levels of B2M and HLA-A / B / C from the cell surface. Figures 2A to 2E Although all disruptions reduced B2M expression on the cell surface, the observed effects were site-dependent. Following the order of progressive B2M disruption, the four sites disclosed in this paper can be arranged as follows: site 3 > site 1 ≈ site 2 > site 4.

[0337] Example 2

[0338] Genetically engineered T-CAR cells.

[0339] The gene cassette is introduced at CRISPR break / insertion sites 1, 2, 3, or 4 of the aforementioned B2M gene. The DNA break inactivates the endogenous B2M gene and allows the introduction of the bicistronic gene cassette disclosed herein under the control of the native B2M promoter. The bicistronic construct contains a sequence fused within a polynucleotide frame encoding a non-functional portion of the B2M gene to the polynucleotide frame encoding the human leukocyte antigen-E (HLA-E) molecule. The bicistronic construct also contains a polynucleotide sequence encoding a specific CAR molecule derived from the anti-GD2 antibody dartuximab. scFv.

[0340] The loss of functional B2M expression in engineered T cells can trigger an immune response. Therefore, the bicistronic construct of this disclosure contains a polynucleotide sequence encoding HLA-E. HLA-E is almost non-polymorphic and ubiquitous in all humans. Expression of the construct encoding a partially but inactive B2M fused within the HLA-E molecular frame allows the immune system to perceive that the genetically engineered cells, although not expressing B2M, are still human and not dangerous. Because CAR-T cells expressing the HLA-E molecule are not considered foreign despite the lack of functional B2M expression, they do not trigger an immune response against therapeutic cells. Therefore, such cells would be suitable for allogeneic therapy.

[0341] Example 3

[0342] Design of chimeric antigen receptor (CAR) and B2M-HLA-E (ISMM) elements

[0343] The bicistronic polynucleotide constructs of this disclosure used in these experiments comprise a chimeric antigen receptor (CAR) and an immune surveillance masking molecule (ISMM). The CAR genetic element comprises a polynucleotide encoding, from the N-terminus to the C-terminus, the following operatively linked elements.

[0344] (1) Anti-GD2 scFv derived from dartuximab;

[0345] (2) CD8α hinge region (also referred to here as CD8a hinge region);

[0346] (3) The CD28 transmembrane domain (TM or CD28TM) and the CD28 intracellular domain (CD28IC) can be collectively referred to as CD28TM / IC;

[0347] (4) 4-1BB activation domain (4-1BBAD); and

[0348] (5) CD3ζ activation domain (CD3ζAD).

[0349] The structure of the CAR element of the bicistronic construct anti-GD2 scFv+CD8a H+CD28 TM / IC+4-1BB AD+CD3ζ AD (SEQ ID NO:5) is shown in Figure 3A in.

[0350] >CAR(SEQ ID NO:5)

[0351] ATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAGGGAG

[0352] TGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAAC

[0353] CTGGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCAC

[0354] CGGCTACAACATGAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGA

[0355] ATGGATCGGCGCCATCGATCCTTACTACGGCGGCACCAGCTACAACCA

[0356] GAAGTTCAAGGGCAGAGCCACACTGACCGTGGACAAGAGCAGCAGCAC

[0357] AGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGACAGCGCCGTGTA

[0358] CTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGTGAC

[0359] AGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGG

[0360] CGGATCTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCT

[0361] CTGGGAGATCAGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTG

[0362] CACAGAAACGGCAACACCTACCTGCACTGGTATCTGCAGAAGCCCGGC

[0363] CAGTCTCCTAAGCTGCTGATCCACAAGGTGTCCAACAGATTCAGCGGCG

[0364] TGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGACTTCACCCTGAA

[0365] GATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGCCA

[0366] GAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGA

[0367] ACTGAAAAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCC

[0368] CACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCA

[0369] GCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGAT

[0370] TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCT

[0371] AGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAG

[0372] GCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCC

[0373] ACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCT

[0374] ATCGCTCCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAAC

[0375] CATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCT

[0376] GCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGT

[0377] TCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGC

[0378] TCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG

[0379] ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGG

[0380] AAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATG

[0381] GCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGG

[0382] CAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGA

[0383] CACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC

[0384] The ISMM genetic element of the bicistronic construct disclosed herein comprises a polynucleotide encoding a B2M inactive fragment (fused within a polypeptide frame encoding the mature human leukocyte antigen-E molecule (HLE-E)) and a 4X glycine linker (Gly4Ser)4 inserted between the B2M and HLA-E portions of the molecule. The structure of the ISMM element of the bicistronic construct, B2M+Gly-linker+HLA-E (SEQ ID NO:6), is shown in [image / image / description]. Figure 3B middle.

[0385] >ISMM B2M-HLA-E(SEQ ID NO:6)

[0386] ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGA

[0387] ATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCCATCCATC

[0388] CGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGT

[0389] GGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGT

[0390] ACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGT

[0391] GAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGA

[0392] CATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAA

[0393] GCGGTGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTCCACACTTC

[0394] CGTGTCCCGGCCCGGCGCGGGGAGCCCCGCTTCATCTCTGTGGGCTAC

[0395] GTGGACGACACCCAGTTCGTGCGCTTCGACAACGACGCCGCGAGTCCG

[0396] AGGATGGTGCCGCGGCGCCGTGGATGGAGCAGGAGGGGTCAGAGTAT

[0397] TGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGATTTTCCGA

[0398] GTGAATCTGCGGACGCTGCGCGCTACTACAATCAGAGCGAGGCCGGG

[0399] TCTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGG

[0400] CGCTTCCTCCGCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATC

[0401] TCACCCTGAATGAGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGG

[0402] CTCAGATCTCCGAGCAAAAGTCAAATGATGCCTCTGAGGCGGAGCACC

[0403] AGAGAGCCTACCTGGAAGACACATGCGTGGAGTGGCTCCACAAATACC

[0404] TGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAAAGACAC

[0405] ACGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTG

[0406] GGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGAT

[0407] GGGGAGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCA

[0408] GGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGA

[0409] GAGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGGCTACCCGAG

[0410] CCCGTCACCCTGAGATGGAAGCCGGCTTCCCAGCCCACCATCCCCATCG

[0411] TGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCTCTGGAGCT

[0412] GTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGA

[0413] GGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAG

[0414] TCTCACAGCTTGTAA

[0415] Example 4

[0416] Design of CAR-ISMM bicistronic and complete donor constructs.

[0417] Bicistronic constructs were designed for insertion at the four B2M insertion sites mentioned above. Two different strategies were used to construct the bicistronic constructs. In the first strategy, a P2A box was introduced within the frame between the CAR and ISMM components. The P2A element allows the CAR and ISMM proteins to separate during translation from a single mRNA. In the second strategy, an internal ribosome entry site (IRES) was introduced within the frame between the CAR and ISMM components. The IRES element allows the two fusion proteins to be translated independently from a single mRNA. Therefore, in the first strategy, a single ribosome translates the entire bicistronic construct. In the second strategy, the first ribosome translates the CAR component, and the second ribosome translates the ISMM element. In both cases, a polyadenylation site (SV40 early polyadenylation signal) was introduced downstream of the 3' end of the bicistronic construct to ensure transcription cessation.

[0418] To prevent the donor DNA sequence encoding the B2M gene from being recognized and cleaved by CRISPR reagents, a silencing mutation is introduced into the donor B2M sequence (the dashed box in the schematic representation of the bicistronic construct). Silent mutations are introduced in the B2M coding regions of the constructs at insertion sites 1, 2, and 3. No CRISPR-protected silencing mutation is introduced in the B2M coding region of the construct at insertion site 4.

[0419] To achieve site-specific integration of the bicistronic donor sequence at the CRISPR-induced DNA break, a complete donor construct was generated. The 1000bp B2M gene flanking the CRISPR site (500bp on each side of the CRISPR site) generates homologous arms to drive site-specific recombination within the frame (homology-directed repair, or HDR). Corresponding to... Figures 4A to 6B The complete donor constructs of the bicistronic constructs are respectively depicted in Figures 7A to 9B middle.

[0420] The bicistronic constructs and complete donor constructs tested in the following embodiments are summarized in Table 1.

[0421] Table 1: Bicistronic and Donor Constructs. "2A" indicates the presence of P2A between the CAR and ISMM components in the bicistronic construct. "IRES" indicates the presence of IRES between the CAR and ISMM components in the bicistronic construct. BC diagrams and BC plots represent schematic representations of each construct within the construct.

[0422]

[0423] >BC1(SEQ ID NO:7)

[0424] GCTAGAAGCTATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGA

[0425] GAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATT

[0426] GAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTT

[0427] GTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACT

[0428] GAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATA

[0429] GTTAAGTGGGATCGAGACATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGG

[0430] CGGGGGAAGCGGTGGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTC

[0431] CGTGTCCCGGCCCGGCCGCGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGA

[0432] CACCCAGTTCGTGCGCTTCGACAACGACGCCGAGTCCGAGGATGGTGCCGCGGG

[0433] CGCCGTGGATGGAGCAGGAGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCC

[0434] AGGGACACCGCACAGATTTTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAAT

[0435] CAGAGCGAGGCCGGGTCTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCC

[0436] CGACGGGCGCTTCCTCCGCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCT

[0437] CACCCTGAATGAGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTC

[0438] CGAGCAAAAGTCAAATGATGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAG

[0439] ACACATGCGTGGAGTGGCTCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTT

[0440] CACCTGGAGCCCCCAAAGACACACGTGACTCACCACCCCATCTCTGACCATGAGGCC

[0441] ACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAG

[0442] CAGGATGGGGAGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGG

[0443] GGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGA

[0444] GATACACGTGCCATGTGCAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGG

[0445] AAGCCGGCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCC

[0446] TTGGATCTGTGGTCTCTGGAGCTGTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCT

[0447] CAGGTGGAAAAGGAGGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGG

[0448] TCTGAGTCTCACAGCTTGGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCT

[0449] GGAGACGTGGAGGAGAACCCTGGACCTATGGAACTGGGACTGTCATGGATCTTCTTG

[0450] CTGGCTATCCTGAAGGGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGA

[0451] ACTGGAAAAACCTGGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTT

[0452] CACCGGCTACAACATGAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGA

[0453] TCGGCGCCATCGATCCTTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCA

[0454] GAGCCACACTGACCGTGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCC

[0455] CTGACCAGCGAGGACAGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGC

[0456] CAGGGCACAAGCGTGACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAG

[0457] TGGTGGCGGCGGATCTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTC

[0458] TCTGGGAGATCAGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAA

[0459] ACGGCAACACCTACCTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGC

[0460] TGATCCACAAGGTGTCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTG

[0461] GAAGCGGCACCGACTTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGC

[0462] GTGTACTTCTGTAGCCAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACC

[0463] AAGCTGGAACTGAAAAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCC

[0464] CACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGG

[0465] GGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGT

[0466] GGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTC

[0467] TGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCC

[0468] CCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTT

[0469] CGCAGCCTATCGCTCCAAACGGGGCAGAAAGAAACTCCTGTATATTCAAAACAACC

[0470] ATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCC

[0471] AGAAGAAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGAC

[0472] GCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACG

[0473] AAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGG

[0474] GAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGA

[0475] TAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGC

[0476] AAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGA

[0477] CGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAGCTGCAGGGTCTGGCTGTTCTAGA

[0478] GGCTGGGTTTGGGAGGTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTATA

[0479] ATGGTTACAAAATAAGCAATAGCATCAAATTTCACAAATAAGCATTTTTTTCAC

[0480] TGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0481] >B2(SEQ ID NO:8)

[0482] GCTAGAAGCTATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGA

[0483] GAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATT

[0484] GAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTT

[0485] GTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACT

[0486] GAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATA

[0487] GTTAAGTGGGATCGAGACATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGG

[0488] CGGGGGAAGCGGTGGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTC

[0489] CGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGA

[0490] CACCCAGTTCGTGCGCTTCGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGG

[0491] CGCCGTGGATGGAGCAGGAGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCC

[0492] AGGGACACCGCACAGATTTTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAAT

[0493] CAGAGCGAGGCCGGGTCTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCC

[0494] CGACGGGCGCTTCCTCCGCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCT

[0495] CACCCTGAATGAGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTC

[0496] CGAGCAAAAGTCAAATGATGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAG

[0497] ACACATGCGTGGAGTGGCTCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTT

[0498] CACCTGGAGCCCCCAAAGACACACGTGACTCACCACCCCATCTCTGACCATGAGGCC

[0499] ACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAG

[0500] CAGGATGGGGAGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGG

[0501] GGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGA

[0502] GATACACGTGCCATGTGCAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGG

[0503] AAGCCGGCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCC

[0504] TTGGATCTGTGGTCTCTGGAGCTGTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCT

[0505] CAGGTGGAAAAGGAGGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGG

[0506] TCTGAGTCTCACAGCTTGTAATCCGGTTATTTTCCACCATATTGCCGTCTTTTGGCAA

[0507] TGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTC

[0508] CCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCT

[0509] GGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACC

[0510] CCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTG

[0511] CAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTC

[0512] AAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACC

[0513] CCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCG

[0514] AGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAA

[0515] CACGATGATAATAGGATCCATGATGGAACTGGGACTGTCATGGATCTTCTTGCTGGC

[0516] TATCCTGAAGGGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGG

[0517] AAAAACCTGGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCG

[0518] GCTACAACATGAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGC

[0519] GCCATCGATCCTTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGC

[0520] CACACTGACCGTGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGA

[0521] CCAGCGAGGACAGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAG

[0522] GGCACAAGCGTGACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGG

[0523] TGGCGGCGGATCTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCT

[0524] GGGAGATCAGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACG

[0525] GCAACACCTACCTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGA

[0526] TCCACAAGGTGTCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAA

[0527] GCGGCACCGACTTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTG

[0528] TACTTCTGTAGCCAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAG

[0529] CTGGAACTGAAAAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCAC

[0530] CATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGG

[0531] GCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGG

[0532] TTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTG

[0533] GGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCC

[0534] GCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCG

[0535] CAGCCTATCGCTCCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCAT

[0536] TTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAG

[0537] AAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGC

[0538] CCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAA

[0539] GAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGA

[0540] AAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATA

[0541] AGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAA

[0542] GGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACG

[0543] CCCTTCACATGCAGGCCCTGCCCCCTCGCTAGCTGCAGGGTCTGGCTGTTCTAGAGG

[0544] CTGGGTTTGGGAGGTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTATAAT

[0545] GGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTG

[0546] CATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0547] >BC3 / 5(SEQ ID NO:9)

[0548] ATGCCGCGTGAACCATGTGACTTTGTCACAGCCCAAGATCGTGAAATGGGATCGAGA

[0549] CATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGCGGTGGG

[0550] GGCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGCCCGGCC

[0551] GCGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGACACCCAGTTCGTGCGCT

[0552] TCGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATGGAGCAG

[0553] GAGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGA

[0554] TTTTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAATCAGAGCGAGGCCGGGT

[0555] CTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCTTCCTCC

[0556] GCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCTCACCCTGAATGAGGACC

[0557] TGCGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAGTCAAAT

[0558] GATGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAGACACATGCGTGGAGTG

[0559] GCTCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAA

[0560] AGACACACGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGG

[0561] CCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGGC

[0562] CATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCA

[0563] GAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATG

[0564] TGCAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTCCCAG

[0565] CCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCT

[0566] CTGGAGCTGTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGA

[0567] GGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTCACAG

[0568] CTTGGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGG

[0569] AGAACCCTGGACCTATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGA

[0570] AGGGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCT

[0571] GGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAAC

[0572] ATGAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGA

[0573] TCCTTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGA

[0574] CCGTGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAG

[0575] GACAGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAG

[0576] CGTGACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCG

[0577] GATCTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATC

[0578] AGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACC

[0579] TACCTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAG

[0580] GTGTCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACC

[0581] GACTTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGT

[0582] AGCCAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTG

[0583] AAAAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTC

[0584] GCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGC

[0585] ACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAG

[0586] TCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAG

[0587] TAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCG

[0588] GGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATC

[0589] GCTCCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGAC

[0590] CAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAA

[0591] GAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCCGTA

[0592] CCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGT

[0593] ACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGA

[0594] AGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGA

[0595] GGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGAT

[0596] GGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATG

[0597] CAGGCCCTGCCCCCTCGCTAGCGGTCTGGCTGTTCTAGAGGCTGGGTTTGGGAGGTG

[0598] AAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTAATGGTTACAAATAAAGCA

[0599] ATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTT

[0600] GTCCAAACTCATCAATGTATCTTATCATGTCTG

[0601] >BC4 / 6(SEQ ID NO:10)

[0602] ATGCCGCGTGAACCATGTGACTTTGTCACAGCCCAAGATCGTGAAATGGGATCGAGA

[0603] CATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGCGGTGGG

[0604] GGCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGCCCGGCC

[0605] GCGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGACACCCAGTTCGTGCGCT

[0606] TCGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATGGAGCAG

[0607] GAGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGA

[0608] TTTTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAATCAGAGCGAGGCCGGGT

[0609] CTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCTTCCTCC

[0610] GCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCTCACCCTGAATGAGGACC

[0611] TGCGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAGTCAAAT

[0612] GATGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAGACACATGCGTGGAGTG

[0613] GCTCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAA

[0614] AGACACACGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGG

[0615] CCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGGC

[0616] CATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCA

[0617] GAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATG

[0618] TGCAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTCCCAG

[0619] CCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCT

[0620] CTGGAGCTGTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGA

[0621] GGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTCACAG

[0622] CTTGTAATCCGGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGA

[0623] AACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGG

[0624] AATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAG

[0625] ACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACA

[0626] GGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAA

[0627] CCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCA

[0628] AGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATC

[0629] TGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGT

[0630] CTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATAG

[0631] GATCCATGATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAGGGAG

[0632] TGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCTGGCGCC

[0633] TCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAACATGAAC

[0634] TGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGATCCTTA

[0635] CTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGACCGTGG

[0636] ACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGACAGC

[0637] GCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGTGAC

[0638] AGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCGGATCTG

[0639] ATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATCAGGCCA

[0640] GCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACCTACCTG

[0641] CACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAGGTGTCC

[0642] AACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGACTTC

[0643] ACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGCCA

[0644] GAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTGAAAA

[0645] GGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAG

[0646] CCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACAC

[0647] GAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCT

[0648] GGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAG

[0649] AGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCC

[0650] ACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCC

[0651] AAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGT

[0652] ACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAG

[0653] GAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAG

[0654] CAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGA

[0655] TGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGA

[0656] AGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCC

[0657] TACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCT

[0658] TTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGC

[0659] CCTGCCCCCTCGCTAGCGGTCTGGCTGTTCTAGAGGCTGGGTTTGGGAGGTGAAACC

[0660] TAGTGGCAGGAGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGC

[0661] ATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCA

[0662] AACTCATCAATGTATCTTATCATGTCTG

[0663] >BC7(SEQ ID NO:11)

[0664] ATCGAGACATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGC

[0665] GGTGGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGC

[0666] CCGGCCGCGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGACACCCAGTTCG

[0667] TGCGCTTCGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATG

[0668] GAGCAGGAGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCCAGGGACACCG

[0669] CACAGATTTTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAATCAGAGCGAGG

[0670] CCGGGTCTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCT

[0671] TCCTCCGCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCTCACCCTGAATG

[0672] AGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAG

[0673] TCAAATGATGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAGACACATGCGT

[0674] GGAGTGGCTCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGC

[0675] CCCCAAAGACACACGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGT

[0676] GCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGG

[0677] AGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACC

[0678] TTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTG

[0679] CCATGTGCAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTC

[0680] CCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTG

[0681] GTCTCTGGAGCTGTGGTTGCTGCTGTGTATATGGAGGAAGAAGCTCAGGTGGAAA

[0682] AGGAGGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTC

[0683] ACAGCTTGGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTG

[0684] GAGGAGAACCCTGGACCTATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATC

[0685] CTGAAGGGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAA

[0686] ACCTGGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTA

[0687] CAACATGAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCA

[0688] TCGATCCTTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACA

[0689] CTGACCGTGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAG

[0690] CGAGGACAGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCA

[0691] CAAGCGTGACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGC

[0692] GGCGGATCTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGA

[0693] GATCAGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAA

[0694] CACCTACCTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCA

[0695] CAAGGTGTCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGG

[0696] CACCGACTTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTT

[0697] CTGTAGCCAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGA

[0698] ACTGAAAAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCG

[0699] CGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCA

[0700] GTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGT

[0701] GGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGA

[0702] GGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGC

[0703] CCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCC

[0704] TATCGCTCCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATG

[0705] AGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGA

[0706] AGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCC

[0707] GCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGA

[0708] GGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGC

[0709] CGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATG

[0710] GCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGC

[0711] ACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTC

[0712] ACATGCAGGCCCTGCCCCCTCGCTAGCTGCAGGGTCTGGCTGTTCTAGAGGCTGGGT

[0713] TTGGGAGGTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTATAATGGTTAC

[0714] AAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCT

[0715] AGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0716] >BC8(SEQ ID NO:12)

[0717] ATCGAGACATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGC

[0718] GGTGGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGC

[0719] CCGGCCGCGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGACACCCAGTTCG

[0720] TGCGCTTCGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATG

[0721] GAGCAGGAGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCCAGGGACACCG

[0722] CACAGATTTTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAATCAGAGCGAGG

[0723] CCGGGTCTCACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCT

[0724] TCCTCCGCGGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCTCACCCTGAATG

[0725] AGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAG

[0726] TCAAATGATGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAGACACATGCGT

[0727] GGAGTGGCTCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGC

[0728] CCCCAAAGACACACCGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGT

[0729] GCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGG

[0730] AGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACC

[0731] TTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTG

[0732] CCATGTGCAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTC

[0733] CCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTG

[0734] GTCTCTGGAGCTGTGGTTGCTGCTGTGTATATGGAGGAAGAAGCTCAGGTGGAAA

[0735] AGGAGGGAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTC

[0736] ACAGCTTGTAATCCGGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCC

[0737] CGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCA

[0738] AAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCGGAAGCTTCTT

[0739] GAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGC

[0740] GACAGGTGCCTCTGCGGCCAAAAGCCACGTGTAATAAGATACACCTGCAAAGGCGGC

[0741] ACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTC

[0742] CTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCATTGTATGG

[0743] GATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTTAGTCGAGGTTAAAAAA

[0744] ACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATA

[0745] ATAGGATCCATGATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAG

[0746] GGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCTGG

[0747] CGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAACAT

[0748] GAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGATC

[0749] CTTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGACC

[0750] GTGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGA

[0751] CAGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGT

[0752] GACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCGGAT

[0753] CTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATCAGG

[0754] CCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACCTAC

[0755] CTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAGGTG

[0756] TCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGAC

[0757] TTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGC

[0758] CAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTGAA

[0759] AAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGC

[0760] AGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCAC

[0761] ACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTC

[0762] CTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTA

[0763] AGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGG

[0764] CCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGC

[0765] TCCAAACGGGGCAGAAAGAAACTCCTGTATATTCAAACAACCATTTATGAGACCA

[0766] GTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGA

[0767] AGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCCAGACGCCCCCGCGTACC

[0768] AGCAGGGCCAGAACCAGCTCTAATAACGAGCTCAATCTAGGACGAAGAGAGGAGTAC

[0769] GATGTTTTGGGACAAGAGACGTGGCGGGACCCTGAGATGGGGGGAAAGCCGAGAG

[0770] GAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGG

[0771] CCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGG

[0772] CCTTTACCAGGGTCTCAGTACAGCCCACCAAGGACACCTACGACGCCCTTCACATGCA

[0773] GGCCCTGCCCCCTCGCTAGCTGCAGGGTCTGGCTGTTCTAGAGGCTGGGTTTGGGAG

[0774] GTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAA

[0775] GCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGG

[0776] TTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0777] >FD1(SEQ ID NO:13)

[0778] AGATCTTAATCTTCTGGGTTTCCGTTTTCTCGAATGAAAAATGCAGGTCCGAGCAGTT

[0779] AACTGGCTGGGGCACCATTAGCAAGTCACTTAGCATCTCTGGGGCCAGTCTGCAAAG

[0780] CGAGGGGGCAGCCTTAATGTGCCTCCAGCCTGAAGTCCTAGAATGAGCGCCCGGTGT

[0781] CCCAAGCTGGGGCGCGCACCCCAGATCGGAGGGCGCCGATGTACAGACAGCAAACT

[0782] CACCCAGTCTAGTGCATGCCTTCTTAAACATCACGAGACTCTAAGAAAAGGAAACTG

[0783] AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGT

[0784] GACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAG

[0785] GCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCT

[0786] CCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGGCTAGAAGCTATCCAGCG

[0787] TACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTT

[0788] CCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAG

[0789] AATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTG

[0790] GTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCC

[0791] TGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGAC

[0792] ATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGCGGTGGGG

[0793] GCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGCCCGGCCG

[0794] CGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGACACCCAGTTCGTGCGCTT

[0795] CGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATGGAGCAGG

[0796] AGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGATT

[0797] TTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAATCAGAGCGAGGCCGGGTCT

[0798] CACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCTTCCTCCGC

[0799] GGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCTCACCCTGAATGAGGACCTG

[0800] CGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAGTCAAATGA

[0801] TGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAGACACATGCGTGGAGTGGC

[0802] TCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAAAG

[0803] ACACACGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCC

[0804] CTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGGCCA

[0805] TACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGA

[0806] AGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATGTG

[0807] CAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTCCCAGCC

[0808] CACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCTCT

[0809] GGAGCTGTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGAGG

[0810] GAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTCACAGCTT

[0811] GGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGA

[0812] ACCCTGGACCTATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAGG

[0813] GAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCTGGC

[0814] GCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAACATG

[0815] AACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGATCC

[0816] TTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGACCG

[0817] TGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGAC

[0818] AGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGT

[0819] GACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCGGAT

[0820] CTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATCAGG

[0821] CCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACCTAC

[0822] CTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAGGTG

[0823] TCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGAC

[0824] TTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGC

[0825] CAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTGAA

[0826] AAGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGC

[0827] AGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCAC

[0828] ACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTC

[0829] CTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTA

[0830] AGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGG

[0831] CCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGC

[0832] TCCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCA

[0833] GTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGA

[0834] AGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCCAGACGCCCCCGCGTACC

[0835] AGCAGGGCCAGAACCAGCTCTAATAACGAGCTCAATCTAGGACGAAGAGAGGAGTAC

[0836] GATGTTTTGGGACAAGAGACGTGGCGGGACCCTGAGATGGGGGGAAAGCCGAGAG

[0837] GAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGG

[0838] CCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGG

[0839] CCTTTACCAGGGTCTCAGTACAGCCCACCAAGGACACCTACGACGCCCTTCACATGCA

[0840] GGCCCTGCCCCTCGCTAGCTGCAGGGTCTGGCTGTTCTTAGAGGCTGGGTTTGGGAG

[0841] GTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAA

[0842] GCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGG

[0843] TTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGAGGCTATCCAGCTGAGTCTC

[0844] TCCTACCCTCCCGCTCTGGTCCTTCCTCTCCGCCTCTGCACCCTCTGTGGCCCTCGCTG

[0845] TGCTCTCTCGCTCCGGACTTCCCTTCTCCAAGTTCTCCTTGGTGGCCCGCGCGTGGGG

[0846] CTAGTCCAGGGCTGGATCTCGGGGAAGCGGCGGGGTGGCCTGGGAGTGGGGAAGGG

[0847] GGTGCGCACCCGGGACGCGCGCTACTTGCCCCTTTCGGCGGGGAGCAGGGGAGACC

[0848] TTTGGCCTACGGCGACGGGAGGGTCGGGACAAAGTTTAGGGCGTCGATAAGCGTCA

[0849] GAGCGCCGAGGTTGGGGGAGGGTTTCTCTTCCGCTCTTTCGCGGGGCCTCTGGCTCC

[0850] CCCAGCGCAGCTGGAGTGGGGGACGGGTAGGCTCGTCCCAAAGGCGCGGCGCTGAG

[0851] GTTTGTGAACGCGTGGAGGGGCGCTTGGGGTCTGGGGGAGGCGTCGCCCGGGTAAG

[0852] CCTGTCTGCT

[0853] >FD2(SEQ ID NO:14)

[0854] AGATCTTAATCTTCTGGGTTTCCGTTTTCTCGAATGAAAAATGCAGGTCCGAGCAGTT

[0855] AACTGGCTGGGGCACCATTAGCAAGTCACTTAGCATCTCTGGGGCCAGTCTGCAAAG

[0856] CGAGGGGGCAGCCTTAATGTGCCTCCAGCCTGAAGTCCTAGAATGAGCGCCCGGTGT

[0857] CCCAAGCTGGGGCGCGCACCCCAGATCGGAGGGCGCCGATGTACAGACAGCAAACT

[0858] CACCCAGTCTAGTGCATGCCTTCTTAAACATCACGAGACTCTAAGAAAAGGAAACTG

[0859] AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGT

[0860] GACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAG

[0861] GCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCT

[0862] CCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGGCTAGAAGCTATCCAGCG

[0863] TACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTT

[0864] CCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAG

[0865] AATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTG

[0866] GTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCC

[0867] TGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGAC

[0868] ATGGGTGGAGGCGGTTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGCGGTGGGG

[0869] GCGGTTCCGGCTCCCACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGCCCGGCCG

[0870] CGGGGAGCCCCGCTTCATCTCTGTGGGCTACGTGGACGACACCCAGTTCGTGCGCTT

[0871] CGACAACGACGCCGCGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATGGAGCAGG

[0872] AGGGGTCAGAGTATTGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGATT

[0873] TTCCGAGTGAATCTGCGGACGCTGCGCGGCTACTACAATCAGAGCGAGGCCGGGTCT

[0874] CACACCCTGCAGTGGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCTTCCTCCGC

[0875] GGGTATGAACAGTTCGCCTACGACGGCAAGGATTATCTCACCCTGAATGAGGACCTG

[0876] CGCTCCTGGACCGCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAGTCAAATGA

[0877] TGCCTCTGAGGCGGAGCACCAGAGAGCCTACCTGGAAGACACATGCGTGGAGTGGC

[0878] TCCACAAATACCTGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAAAG

[0879] ACACACGTGACTCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCC

[0880] CTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGGCCA

[0881] TACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGA

[0882] AGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATGTG

[0883] CAGCATGAGGGGCTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTCCCAGCC

[0884] CACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCTCT

[0885] GGAGCTGTGGTTGCTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGAGG

[0886] GAGCTACTCTAAGGCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTCACAGCTT

[0887] GTAATCCGGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAAC

[0888] CTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAAT

[0889] GCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACA

[0890] AACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGT

[0891] GCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCC

[0892] CAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGC

[0893] GTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGAT

[0894] CTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAG

[0895] GCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATAGGATC

[0896] CATGATGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAGGGAGTGCA

[0897] GTGTGAAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCTGGCGCCTCCG

[0898] TGATGATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAACATGAACTGGG

[0899] TCCGACAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGATCCTTACTACG

[0900] GCGGCACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGACCGTGGACAAG

[0901] AGCAGCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGACAGCGCCGT

[0902] GTACTACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGTGACAGTCTC

[0903] TTCTGGCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCGGATCTGATGTGG

[0904] TCATGACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATCAGGCCAGCATCA

[0905] GCTGTAGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACCTACCTGCACTGG

[0906] TATCTGCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAGGTGTCCAACAGA

[0907] TTCAGCGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGACTTCACCCTG

[0908] AAGATTAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGCCAGAGCAC

[0909] ACACGTGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTGAAAAGGACCA

[0910] CGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGT

[0911] CCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGG

[0912] CTGGACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCT

[0913] ATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCA

[0914] GGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCA

[0915] AGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAAACGGG

[0916] GCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTA

[0917] CTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGT

[0918] GAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCA

[0919] GAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG

[0920] ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCC

[0921] TCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTG

[0922] AGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAG

[0923] GGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCC

[0924] CCTCGCTAGCTGCAGGGTCTGGCTGTTCTAGAGGCTGGGTTTGGGAGGTGAAACCTA

[0925] GTGGCAGGAGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCAT

[0926] CACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAA

[0927] CTCATCAATGTATCTTATCATGTCTGGAGGCTATCCAGCGTGAGTCTCTCCTACCCTC

[0928] CCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCG

[0929] CTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGTGGCCCGCCGTGGGGCTAGTCCAGG

[0930] GCTGGATCTCGGGGAAGCGGCGGGGTGGCCTGGGAGTGGGGAAGGGGGTGCGCACC

[0931] CGGGACGCGCGCTACTTGCCCCTTTCGGCGGGGAGCAGGGGAGACCTTTGGCCTACG

[0932] GCGACGGGAGGGTCGGGACAAAGTTTAGGGCGTCGATAAGCGTCAGAGCGCCGAGG

[0933] TTGGGGGAGGGTTTCTCTTCCGCTCTTTCGCGGGGCCTCTGGCTCCCCCAGCGCAGCT

[0934] GGAGTGGGGGACGGGTAGGCTCGTCCCAAAGGCGCGGCGCTGAGGTTTGTGAACGC

[0935] GTGGAGGGGCGCTTGGGGTCTGGGGGAGGCGTCGCCCGGGTAAGCCTGTCTGCT>FD3 / 5(SEQ IDNO:15)

[0936] TCTGCTAGAAAAAAAACAAAAAAGGCATGTATAGAGGAATTATGAGGGAAAGATAC

[0937] CAAGTCACGGTTTATTCTTCAAAATGGAGGTGGCTTGTTGGGAAGGTGGAAGCTCAT

[0938] TTGGCCAGAGTGGAAATGGAATTGGGAGAAATCGATGACCAAATGTAAACACTTGG

[0939] TGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAA

[0940] TGTGTCTTTTCCCGATATTCCTCAGGTACTCCAAAGATTCAGGTTTACTCACGTCATC

[0941] CAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCAT

[0942] CCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCAT

[0943] TCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCA

[0944] CCCCCACTGAAAAAGATGAGTATGCATGCCGCGTGAACCATGTGACTTTGTCACAGC

[0945] CCAAGATCGTGAAATGGGATCGAGACATGGGTGGAGGCGGTTCTGGAGGTGGCGGA

[0946] AGTGGCGGCGGGGAAGCGGTGGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTTC

[0947] CACACTTCCGTGTCCCGGCCCGGCGCGGGGAGCCCCGCTTCATCTCTGTGGGGCTAC

[0948] GTGGACGACACCCAGTTCGTGCGCTTCGACAACGACGCCGCGAGTCCGAGGATGGT

[0949] GCCGCGGGCGCCGTGGATGGAGCAGGAGGGGTCAGAGTATTGGGACCGGGAGACAC

[0950] GGAGCGCCAGGGACACCGCACAGATTTTCCGAGTGAATCTGCGGACGCTGCGCGGC

[0951] TACTACAATCAGAGCGAGGCCGGGTCTCACACCCTGCAGTGGATGCATGGCTGCGA

[0952] GCTGGGGCCCGACGGGCGCTTCCTCCCGGGGTATGAACAGTTCGCCTACGACGGCAA

[0953] GGATTATCTCACCCTGAATGAGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGGC

[0954] TCAGATCTCCGAGCAAAAGTCAAATGATGCCTCTGAGGCGGAGCACCAGAGAGCCCT

[0955] ACCTGGAAGACACATGCGTGGAGTGGCTCCACAAATACCTGGAGAAGGGGAAGGAG

[0956] ACGCTGCTTCACCTGGAGCCCCCAAAGACACACGTGACTCACCACCCCATCTCTGAC

[0957] CATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTG

[0958] ACCTGGCAGCAGGATGGGGAGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAG

[0959] GCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAG

[0960] AGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGGCTACCCGAGCCCGTCACC

[0961] CTGAGATGGAAGCCGGCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGC

[0962] CTGGTTCTCCTTGGATCTGTGGTCTCTGGAGCTGTGGTTGCTGCTGTGATATGGAGGA

[0963] AGAAGAGCTCAGGTGGAAAAGGAGGGAGCTACTCTAAGGCTGAGTGGAGCGACAGT

[0964] GCCCAGGGGTCTGAGTCTCACAGCTTGGGAAGCGGAGCTACTAACTTCAGCCTGCTG

[0965] AAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGAACTGGGACTGTCATG

[0966] GATCTTCTTGCTGGCTATCCTGAAGGGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAG

[0967] CGGACCCGAACTGGAAAAACCTGGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTG

[0968] GCAGCTCCTTCACCGGCTACAACATGAACTGGGTCCGACAGAACATCGGCAAGAGC

[0969] CTGGAATGGATCGGCGCCATCGATCCTTACTACGGCGGCACCAGCTACAACCAGAA

[0970] GTTCAAGGGCAGAGCCACACTGACCGTGGACAAGAGCAGCAGCACAGCCTACATGC

[0971] ATCTGAAGTCCCTGACCAGCGAGGACAGCGCCGTGTACTACTGTGTGTCCGGCATGG

[0972] AATACTGGGGCCAGGGCACAAGCGTGACAGTCTCTTCTGGCGGCGGTGGATCTGGC

[0973] GGAGGCGGAAGTGGTGGCGGCGGATCTGATGTGGTCATGACACAGACCCCTCTGAG

[0974] CCTGCCTGTGTCTCTGGGAGATCAGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCT

[0975] GGTGCACAGAAACGGCAACACCTACCTGCACTGGTATCTGCAGAAGCCCGGCCAGT

[0976] CTCCTAAGCTGCTGATCCACAAGGTGTCCAACAGATTCAGCGGCGTGCCCGACAGAT

[0977] TCTCTGGCTCTGGAAGCGGCACCGACTTCACCCTGAAGATTAGCAGAGTGGAAGCCG

[0978] AGGACCTGGGCGTGTACTTCTGTAGCCAGAGCACACACGTGCCACCTCTGACATTTG

[0979] GCGCTGGCACCAAGCTGGAACTGAAAAGGACCACGACGCCAGCGCCGCGACCACCA

[0980] ACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGG

[0981] CCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTG

[0982] GGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGC

[0983] CTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACAT

[0984] GAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCC

[0985] ACCACGCGACTTCGCAGCCTATCGCTCCAAACGGGGCAGAAAGAAACTCCTGTATAT

[0986] ATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTA

[0987] GCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGC

[0988] AGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCT

[0989] CAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACC

[0990] CTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGA

[0991] ACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGC

[0992] GCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAG

[0993] GACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAGCGGTCTGGCTGT

[0994] TCTAGAGGCTGGGTTTGGGAGGTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAG

[0995] CTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTT

[0996] TTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0997] GTAAGTCTTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATA

[0998] AAGCTGCTTTGATATAAAAAAGGTCTATGGCCATACTACCCTGAATGAGTCCCATCC

[0999] CATCTGATATAAACAATCTGCATATTGGGATTGTCAGGGAATGTTCTTAAAGATCAG

[1000] ATTAGTGGCACCTGCTGAGATACTGATGCACAGCATGGTTTCTGAACCAGTAGTTTC

[1001] CCTGCAGTTGAGCAGGGAGCAGCAGCAGCACTTGCACAAATACATATACACTCTTAA

[1002] CACTTCTTACCTACTGGCTTCCTCTAGCTTTTGTGGCAGCTTCAGGTATATTTAGCAC

[1003] TGAACGAACATCTCAAGAAGGTATAGGCCTTTGTTGTAAGTCCTGCTGTCCTAGCA

[1004] TCCTATAATCCTGGACTTCTCCAGTACTTTCTGGCTGGATTGGTATCTGAGGCTAGTA

[1005] GGAAGGGCTTGTTCCTGCTGGGTAGCTCTAAACAATGTATT

[1006] >FD4 / 6(SEQ ID NO:16)

[1007] TCTGCTAGAAAAAAAACAAAAAAGGCATGTATAGAGGAATTATGAGGGAAAGATAC

[1008] CAAGTCACGGTTTATTCTTCAAAATGGAGGTGGCTTGTTGGGAAGGTGGAAGCTCAT

[1009] TTGGCCAGAGTGGAAATGGAATTGGGAGAAATCGATGACCAAATGTAAACACTTGG

[1010] TGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAA

[1011] TGTGTCTTTTCCCGATATTCCTCAGGTACTCCAAAGATTCAGGTTTACTCACGTCATC

[1012] CAGCAGAGAATGGAAAGTCAAATTTTCCTGAATTGCTATGTGTCTGGGTTTCATCCAT

[1013] CCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCAT

[1014] TCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCA

[1015] CCCCCACTGAAAGATGAGTATTGCATGCCGCGTGAACCATGTGACTTTGTCACAGC

[1016] CCAAGATCGTGAAATGGGATCGAGACATGGGTGGAGGCGGTTCTGGAGGTGGCGGA

[1017] AGTGGCGGCGGGGAAGCGGTGGGGGCGGTTCCGGCTCCCACTCCTTGAAGTATTTC

[1018] CACACTTCCGTGTCCCGGCCCGGCGCGGGGAGCCCCGCTTCATCTCTGTGGGGCTAC

[1019] GTGGACGACACCCAGTTCGTGCGCTTCGACAACGACGCCGCGAGTCCGAGGATGGT

[1020] GCCGCGGGCGCCGTGGATGGAGCAGGAGGGGTCAGAGTATTGGGACCGGGAGACAC

[1021] GGAGCGCCAGGGACACCGCACAGATTTTCCGAGTGAATCTGCGGACGCTGCGCGGC

[1022] TACTACAATCAGAGCGAGGCCGGGTCTCACACCCTGCAGTGGATGCATGGCTGCGA

[1023] GCTGGGGCCCGACGGGCGCTTCCTCCCGGGGTATGAACAGTTCGCCTACGACGGCAA

[1024] GGATTATCTCACCCTGAATGAGGACCTGCGCTCCTGGACCGCGGTGGACACGGCGGC

[1025] TCAGATCTCCGAGCAAAAGTCAAATGATGCCTCTGAGGCGGAGCACCAGAGAGCCCT

[1026] ACCTGGAAGACACATGCGTGGAGTGGCTCCACAAATACCTGGAGAAGGGGAAGGAG

[1027] ACGCTGCTTCACCTGGAGCCCCCAAAGACACAGTGACTCACCACCCCATCTCTGAC

[1028] CATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTG

[1029] ACCTGGCAGCAGGATGGGGAGGGCCATACCCAGGACACGGAGCTCGTGGAGACCAG

[1030] GCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAG

[1031] AGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGGCTACCCGAGCCCGTCACC

[1032] CTGAGATGGAAGCCGGCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGC

[1033] CTGGTTCTCCTTGGATCTGTGGTCTCTGGAGCTGTGGTTGCTGCTGTGATATGGAGGA

[1034] AGAAGAGCTCAGGTGGAAAAGGAGGGAGCTACTCTAAGGCTGAGTGGAGCGACAGT

[1035] GCCCAGGGGTCTGAGTCTCACAGCTTGTAATCCGGTTATTTTCCACCATATTGCCGTC

[1036] TTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAG

[1037] GGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGC

[1038] AGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCA

[1039] GCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAG

[1040] ATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGG

[1041] AAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAG

[1042] AAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGT

[1043] GTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCC

[1044] TTTGAAAAACACGATGATAATAGGATCCATGATGGAACTGGGACTGTCATGGATCTT

[1045] CTTGCTGGCTATCCTGAAGGGAGTGCAGTGTGAAGTTCAGCTGCTGCAGAGCGGACC

[1046] CGAACTGGAAAAACCTGGCGCCTCCGTGATGATCAGCTGCAAGGCCTCTGGCAGCTC

[1047] CTTCACCGGCTACAACATGAACTGGGTCCGACAGAACATCGGCAAGAGCCTGGAAT

[1048] GGATCGGCGCCATCGATCCTTACTACGGCGGCACCAGCTACAACCAGAAGTTCAAG

[1049] GGCAGAGCCACACTGACCGTGGACAAGAGCAGCAGCACAGCCTACATGCATCTGAA

[1050] GTCCCTGACCAGCGAGGACAGCGCCGTGTACTACTGTGTGTCCGGCATGGAATACTG

[1051] GGGCCAGGGCACAAGCGTGACAGTCTCTTCTGGCGGCGGTGGATCTGGCGGAGGCG

[1052] GAAGTGGTGGCGGCGGATCTGATGTGGTCATGACACAGACCCCTCTGAGCCTGCCTG

[1053] TGTCTCTGGGAGATCAGGCCAGCATCAGCTGTAGAAGCAGCCAGAGCCTGGTGCAC

[1054] AGAAACGGCAACACCTACCTGCACTGGTATCTGCAGAAGCCCGGCCAGTCTCCTAAG

[1055] CTGCTGATCCACAAGGTGTCCAACAGATTCAGCGGCGTGCCCGACAGATTCTCTGGC

[1056] TCTGGAAGCGGCACCGACTTCACCCTGAAGATTAGCAGAGTGGAAGCCGAGGACCT

[1057] GGGCGTGTACTTCTGTAGCCAGAGCACACACGTGCCACCTCTGACATTTGGCGCTGG

[1058] CACCAAGCTGGAACTGAAAAGGACCACGACGCCAGCGCCGCGACCACCAACACCGG

[1059] CGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGG

[1060] CGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATTTTTGGGTGCTGG

[1061] TGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTAT

[1062] TTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGA

[1063] CTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCG

[1064] ACTTCGCAGCCTATCGCTCCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAAC

[1065] AACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGA

[1066] TTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGC

[1067] AGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAG

[1068] GACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATG

[1069] GGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGA

[1070] AAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAG

[1071] GGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCT

[1072] ACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAGCGGTCTGGCTGTTCTAGAG

[1073] GCTGGGTTTGGGAGGTGAAACCTAGTGGCAGGAGAACTTGTTTATTGCAGCTTATAA

[1074] TGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACT

[1075] GCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGTAAGTC

[1076] TTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATAAAGCTGC

[1077] TTTGATATAAAAAAGGTCTATGGCCATACTACCCTGAATGAGTCCCATCCCATCTGA

[1078] TATAAACAATCTGCATATTGGGATTGTCAGGGAATGTTCTTAAAGATCAGATTAGTG

[1079] GCACCTGCTGAGATACTGATGCACAGCATGGTTTCTGAACCAGTAGTTTCCCTGCAG

[1080] TTGAGCAGGGAGCAGCAGCAGCACTTGCACAAATACATATACACTCTTAACACTTCT

[1081] TACCTACTGGCTTCCTCTAGCTTTTGTGGCAGCTTCAGGTATATTTAGCACTGAACGA

[1082] ACATCTCAAGAAGGTATAGGCCTTTGTTTGTAAGTCCTGCTGTCCTAGCATCCTATAA

[1083] TCCTGGACTTCTCCAGTACTTTCTGGCTGGATTGGTATCTGAGGCTAGTAGGAAGGG

[1084] CTTGTTCCTGCTGGGTAGCTCTAAACAATGTATT

[1085] >FD7(SEQ ID NO:17)

[1086] TCTGCATATTGGGATTGTCAGGGAATGTTCTTAAAGATCAGATTAGTGGCACCTGCT

[1087] GAGATACTGATGCACAGCATGGTTTCTGAACCAGTAGTTTCCCTGCAGTTGAGCAGG

[1088] GAGCAGCAGCAGCACTTGCACAAATACATATACACTCTTAACACTTCTTACCTACTG

[1089] GCTTCCTCTAGCTTTTGTGGCAGCTTCAGGTATATTTAGCACTGAACGAACATCTCAA

[1090] GAAGGTATAGGCCTTTGTTTGTAAGTCCTGCTGTCCTAGCATCCTATAATCCTGGACT

[1091] TCTCCAGTACTTTCTGGCTGGATTGGTATCTGAGGCTAGTAGGAAGGGCTTGTTCCTG

[1092] CTGGGTAGCTCTAAACAATGTATTCATGGGTAGGAACAGCAGCCTATTCTGCCAGCC

[1093] TTATTTCTAACCATTTTAGACATTTGTTAGTACATGGTATTTTAAAAGTAAAACTTAA

[1094] TGTCTTCCTTTTTTTTCTCCACTGTCTTTTTCATAGATCGAGACATGGGTGGAGGCGG

[1095] TTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGCGGTGGGGGCGGTTCCGGCTCCC

[1096] ACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCT

[1097] TCATCTCTGTGGGCTACGTGGACGACACCCAGTTCGTGCGCTTCGACAACGACGCCG

[1098] CGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGTCAGAGTAT

[1099] TGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGATTTTCCGAGTGAATCT

[1100] GCGGACGCTGCGCGGCTACTACAATCAGAGCGAGGCCGGGTCTCACACCCTGCAGT

[1101] GGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAG

[1102] TTCGCCTACGACGGCAAGGATTATCTCACCCTGAATGAGGACCTGCGCTCCTGGACC

[1103] GCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAGTCAAATGATGCCTCTGAGGC

[1104] GGAGCACCAGAGAGCCTACCTGGAAGACACATGCGTGGAGTGGCTCCACAAATACC

[1105] TGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAAAGACACACGTGACT

[1106] CACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTAC

[1107] CCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGGCCATACCCAGGACAC

[1108] GGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTG

[1109] TGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGG

[1110] CTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTCCCAGCCCACCATCCCCATC

[1111] GTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCTCTGGAGCTGTGGTTG

[1112] CTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGAGGGAGCTACTCTAAG

[1113] GCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTCACAGCTTGGGAAGCGGAGC

[1114] TACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTA

[1115] TGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAGGGAGTGCAGTGTG

[1116] AAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCTGGCGCCTCCGTGATG

[1117] ATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAACATGAACTGGGTCCGA

[1118] CAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGATCCTTACTACGGCGG

[1119] CACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGACCGTGGACAAGAGCA

[1120] GCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGACAGCGCCGTGTACT

[1121] ACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGTGACAGTCTCTTCTG

[1122] GCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCGGATCTGATGTGGTCATG

[1123] ACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATCAGGCCAGCATCAGCTGT

[1124] AGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACCTACCTGCACTGGTATCT

[1125] GCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAGGTGTCCAACAGATTCAG

[1126] CGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGACTTCACCCTGAAGAT

[1127] TAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGCCAGAGCACACACG

[1128] TGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTGAAAAGGACCACGACG

[1129] CCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTG

[1130] CGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGG

[1131] ACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAG

[1132] CTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCT

[1133] CCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCA

[1134] TTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAAACGGGGCAG

[1135] AAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCA

[1136] AGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAAC

[1137] TGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAAC

[1138] CAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAA

[1139] GAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAG

[1140] GAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGAT

[1141] TGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTC

[1142] TCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTC

[1143] GCTAGCTGCAGGGTCTGGCTGTTCTAGAGGCTGGGTTTGGGAGGTGAAACCTAGTGG

[1144] CAGGAGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACA

[1145] AATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCA

[1146] TCAATGTATCTTATCATGTCTGAGGTAAGTTTTTGACCTTGAGAAAATGTTTTTGTTT

[1147] CACTGTCCTGAGGACTATTTATAGACAGCTCTAACATGATAACCCTCACTATGTGGA

[1148] GAACATTGACAGAGTAACATTTTAGCAGGGAAAGAAGAATCCTACAGGGTCATGTT

[1149] CCCTTCTCCTGTGGAGTGGCATGAAGAAGGTGTATGGCCCCAGGTATGGCCATATTA

[1150] CTGACCCTCTACAGAGAGGGCAAAGGAACTGCCAGTATGGTATTGCAGGATAAAGG

[1151] CAGGTGGTTACCCACATTACCTGCAAGGCTTTGATCTTTCTTCTGCCATTTCCACATT

[1152] GGACATCTCTGCTGAGGAGAGAAAATGAACCACTCTTTTCCTTTGTATAATGTTGTTT

[1153] TATTCTTCAGACAGAAGAGAGGAGTTATACAGCTCTGCAGACATCCCATTCCTGTAT

[1154] GGGGACTGTGTTTGCCTCTTAGAGGTTCCCAGGCCACTAGAGGAGATAAAGGGAAA

[1155] CAGATTGTT

[1156] >FD8(SEQ ID NO:18)

[1157] TCTGCATATTGGGATTGTCAGGGAATGTTCTTAAAGATCAGATTAGTGGCACCTGCT

[1158] GAGATACTGATGCACAGCATGGTTTCTGAACCAGTAGTTTCCCTGCAGTTGAGCAGG

[1159] GAGCAGCAGCAGCACTTGCACAAATACATATACACTCTTAACACTTCTTACCTACTG

[1160] GCTTCCTCTAGCTTTTGTGGCAGCTTCAGGTATATTTAGCACTGAACGAACATCTCAA

[1161] GAAGGTATAGGCCTTTGTTTGTAAGTCCTGCTGTCCTAGCATCCTATAATCCTGGACT

[1162] TCTCCAGTACTTTCTGGCTGGATTGGTATCTGAGGCTAGTAGGAAGGGCTTGTTCCTG

[1163] CTGGGTAGCTCTAAACAATGTATTCATGGGTAGGAACAGCAGCCTATTCTGCCAGCC

[1164] TTATTTCTAACCATTTTAGACATTTGTTAGTACATGGTATTTTAAAAGTAAAACTTAA

[1165] TGTCTTCCTTTTTTTTCTCCACTGTCTTTTTCATAGATCGAGACATGGGTGGAGGCGG

[1166] TTCTGGAGGTGGCGGAAGTGGCGGCGGGGGAAGCGGTGGGGGCGGTTCCGGCTCCC

[1167] ACTCCTTGAAGTATTTCCACACTTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCT

[1168] TCATCTCTGTGGGCTACGTGGACGACACCCAGTTCGTGCGCTTCGACAACGACGCCG

[1169] CGAGTCCGAGGATGGTGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGTCAGAGTAT

[1170] TGGGACCGGGAGACACGGAGCGCCAGGGACACCGCACAGATTTTCCGAGTGAATCT

[1171] GCGGACGCTGCGCGGCTACTACAATCAGAGCGAGGCCGGGTCTCACACCCTGCAGT

[1172] GGATGCATGGCTGCGAGCTGGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAG

[1173] TTCGCCTACGACGGCAAGGATTATCTCACCCTGAATGAGGACCTGCGCTCCTGGACC

[1174] GCGGTGGACACGGCGGCTCAGATCTCCGAGCAAAAGTCAAATGATGCCTCTGAGGC

[1175] GGAGCACCAGAGAGCCTACCTGGAAGACACATGCGTGGAGTGGCTCCACAAATACC

[1176] TGGAGAAGGGGAAGGAGACGCTGCTTCACCTGGAGCCCCCAAAGACACACGTGACT

[1177] CACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTAC

[1178] CCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGGCCATACCCAGGACAC

[1179] GGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTG

[1180] TGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGG

[1181] CTACCCGAGCCCGTCACCCTGAGATGGAAGCCGGCTTCCCAGCCCACCATCCCCATC

[1182] GTGGGCATCATTGCTGGCCTGGTTCTCCTTGGATCTGTGGTCTCTGGAGCTGTGGTTG

[1183] CTGCTGTGATATGGAGGAAGAAGAGCTCAGGTGGAAAAGGAGGGAGCTACTCTAAG

[1184] GCTGAGTGGAGCGACAGTGCCCAGGGGTCTGAGTCTCACAGCTTGGGAAGCGGAGC

[1185] TACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTA

[1186] TGGAACTGGGACTGTCATGGATCTTCTTGCTGGCTATCCTGAAGGGAGTGCAGTGTG

[1187] AAGTTCAGCTGCTGCAGAGCGGACCCGAACTGGAAAAACCTGGCGCCTCCGTGATG

[1188] ATCAGCTGCAAGGCCTCTGGCAGCTCCTTCACCGGCTACAACATGAACTGGGTCCGA

[1189] CAGAACATCGGCAAGAGCCTGGAATGGATCGGCGCCATCGATCCTTACTACGGCGG

[1190] CACCAGCTACAACCAGAAGTTCAAGGGCAGAGCCACACTGACCGTGGACAAGAGCA

[1191] GCAGCACAGCCTACATGCATCTGAAGTCCCTGACCAGCGAGGACAGCGCCGTGTACT

[1192] ACTGTGTGTCCGGCATGGAATACTGGGGCCAGGGCACAAGCGTGACAGTCTCTTCTG

[1193] GCGGCGGTGGATCTGGCGGAGGCGGAAGTGGTGGCGGCGGATCTGATGTGGTCATG

[1194] ACACAGACCCCTCTGAGCCTGCCTGTGTCTCTGGGAGATCAGGCCAGCATCAGCTGT

[1195] AGAAGCAGCCAGAGCCTGGTGCACAGAAACGGCAACACCTACCTGCACTGGTATCT

[1196] GCAGAAGCCCGGCCAGTCTCCTAAGCTGCTGATCCACAAGGTGTCCAACAGATTCAG

[1197] CGGCGTGCCCGACAGATTCTCTGGCTCTGGAAGCGGCACCGACTTCACCCTGAAGAT

[1198] TAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTTCTGTAGCCAGAGCACACACG

[1199] TGCCACCTCTGACATTTGGCGCTGGCACCAAGCTGGAACTGAAAAGGACCACGACG

[1200] CCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTG

[1201] CGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGG

[1202] ACTTCGCCTGTGATTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAG

[1203] CTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCT

[1204] CCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCA

[1205] TTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAAACGGGGCAG

[1206] AAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCA

[1207] AGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAAC

[1208] TGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAAC

[1209] CAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAA

[1210] GAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAG

[1211] GAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGAT

[1212] TGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTC

[1213] TCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTC

[1214] GCTAGCTGCAGGGTCTGGCTGTTCTAGAGGCTGGGTTTGGGAGGTGAAACCTAGTGG

[1215] CAGGAGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACA

[1216] AATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCA

[1217] TCAATGTATCTTATCATGTCTGAGGTAAGTTTTTGACCTTGAGAAAATGTTTTTGTTT

[1218] CACTGTCCTGAGGACTATTTATAGACAGCTCTAACATGATAACCCTCACTATGTGGA

[1219] GAACATTGACAGAGTAACATTTTAGCAGGGAAAGAAGAATCCTACAGGGTCATGTT

[1220] CCCTTCTCCTGTGGAGTGGCATGAAGAAGGTGTATGGCCCCAGGTATGGCCATATTA

[1221] CTGACCCTCTACAGAGAGGGCAAAGGAACTGCCAGTATGGTATTGCAGGATAAAGG

[1222] CAGGTGGTTACCCACATTACCTGCAAGGCTTTGATCTTTCTTCTGCCATTTCCACATT

[1223] GGACATCTCTGCTGAGGAGAGAAATGAACCACTCTTTTCCTTTGTATAATGTTGTTT

[1224] TATTCTTCAGACAGAAGAGAGGAGTTATACAGCTCTGCAGACATCCCATTCCTGTAT

[1225] GGGGACTGTGTTTGCCTCTTAGAGGTTCCCAGGCCACTAGAGGAGATAAAGGGAAA

[1226] CAGATTGTT

[1227] Example 5

[1228] HLA-E expression in cells lacking HLA-A / B / C

[1229] To determine HLA-E expression induced by the bicistronic construct (containing the CAR and ISMM components linked via IRES), HLA-E expression was determined one day prior to electroporation using an Amaxa 4D nuclear transfection instrument and P3 solution containing purified Cas9 protein (preloaded with CRISPR guide RNA targeting sites SEQ ID NO: 1, 3, or 4), at a concentration of 1 × 10⁶ cells per cell. 6 Primary isolated CD4+ T cells were transduced with one AAV6 genome (carrying a complete donor construct targeting sites 1, 3, or 4 on B2M and HLA-E, and HLA-E). Expression was determined by flow cytometry to analyze the loss of HLA-A / B / C expression while preserving HLA-E expression. The construct tested was complete donor 2 (… Figure 7B ), complete donor 6 ( Figure 8B ) and complete donor 8 ( Figure 9B The highest levels of HLA-E expression were observed in the bicistronic constructs targeting sites 1 and 3. (See also...) Figures 10A to 10D .

[1230] Similarly, HLA-E expression induced by a bicistronic construct comprising a CAR component and an ISMM component linked by a 2A element was investigated. One day prior to electroporation, cells were transfected using an Amaxa 4D nuclear transfection instrument and P3 solution containing purified Cas9 protein (preloaded with CRISPR guide RNA targeting the site of SEQ ID NO: 1 or 3) at 1 × 10⁻⁶ cells per cell.6 One AAV6 genome (carrying a complete donor construct targeting sites 1 or 3 on B2M and HLA-E, and HLA-E) was transduced into T cells. Expression was determined using flow cytometry to analyze the loss of HLA-A / B / C expression while preserving HLA-E expression. The construct tested was a complete donor 1 (… Figure 7A ), complete donor 5 ( Figure 8A ) and complete donor 6 ( Figure 8B The highest levels of HLA-E expression were consistently observed in the bicistronic constructs with CAR and ISMM components linked via 2A elements (P2A), compared to results obtained when both components were linked via IRES elements. See also Figures 11A to 11D .

[1231] Example 6

[1232] Anti-GD2 CAR engineered cells' anti-tumor efficacy.

[1233] To investigate the expression of bicistronic constructs (containing those derived from...) The cytotoxic efficacy of engineered CAR-T cells (containing truncated B2M and HLA-E) against GD2CAR and ISMM (containing truncated B2M and HLA-E) was investigated by co-culturing engineered T cells with GD2+ CHP134 neuroblastoma cells expressing the mKate2 fluorescent cell tracker at different ratios (1:1, 2:1, 4:1, 10:1). The mKate2+ cell population was measured hourly over 24 hours using a Sartorius Incucyte S3 live-cell imaging system. Cell numbers were normalized relative to the initial time point.

[1234] Using different bicistronic constructs: “site 1 2A CAR-HLAE” (corresponding to Figure 4A Bicistronic construct 1 and Figure 7A The whole donor 1), "site 3 2A CAR-HLAE" (corresponding to Figure 5A Bicistronic constructs 5 and Figure 8A The whole donor 5) and "site 3IRES CAR-HLAE" (corresponding to Figure 5B Bicistronic constructs 6 and Figure 8B 6) Full donors.

[1235] Co-culture of neuroblastoma cells with engineered CAR-T cells expressing the 3IRES CAR-HLAE bicistronic construct showed negligible effects, except at the highest CAR-T cell to neuroblastoma cell ratio (10:1). See also Figure 14Significantly better results were obtained when the bicistronic construct included a P2A element between the CAR and ISMM elements. See also Figure 12 and Figure 13 .

[1236] When using the site 1 2A CAR-HLAE bicistronic construct, a reduction in neuroblastoma cells relative to control conditions was observed at ratios of 2:1, 4:1, and 10:1. However, despite the reduced cell growth relative to control conditions, the reduction in total cell count relative to the initial cell count was only achieved at the highest ratio (10:1). See also Figure 12 .

[1237] When using the site 3 2A CAR-HLAE bicistronic construct, a reduction in the number of neuroblastoma cells relative to control conditions was observed at ratios of 2:1, 4:1, and 10:1. At ratios of 4:1 and 10:1, a reduction in the total cell count relative to the initial cell count was observed. For the site 1 2A CAR-HLAE bicistronic construct, the effect observed at a 4:1 ratio was similar to that observed at a 10:1 ratio. At a 10:1 ratio, the reduction in cell growth observed for site 3 2A CAR-HLAE was greater than that observed for site 1 2A CAR-HLAE at the same ratio. See also Figure 13 .

[1238] In summary, the most significant effects were observed in constructs that included a P2A element instead of an IRES element between the CAR and ISMM components of the bicistronic construct, and bicistronic constructs with a P2A element targeting insertion site 3 of B2M were more effective than those targeting site 1.

[1239] ***

[1240] It should be understood that the claims are intended to be interpreted using the Detailed Description section rather than the Summary and Abstract section. The Summary and Abstract section may set forth one or more, but not all, exemplary embodiments of the invention as contemplated by the inventors, and is therefore not intended to limit the invention and the appended claims in any way.

[1241] The invention has been described above using functional building blocks that illustrate the implementation of specific functions and their relationships. For ease of description, the boundaries of these functional building blocks have been arbitrarily defined herein. Alternative boundaries may be defined, provided that the specified functions and their relationships are properly performed.

[1242] The foregoing description of the specific embodiments so fully reveals the general nature of the invention that others, by applying knowledge within the scope of the art, can readily modify and / or adapt such specific embodiments for various applications without departing from the overall conception of the invention, without excessive experimentation. Therefore, based on the teachings and guidance presented herein, such modifications and alterations are intended to be within the meaning and scope of equivalents of the disclosed embodiments. It should be understood that the terminology or language used herein is for descriptive purposes and not for limitation, and therefore the terminology or language used in this specification should be interpreted by those skilled in the art based on the teachings and guidance.

[1243] The breadth and scope of this invention should not be limited by any of the exemplary embodiments described above, but should be defined solely by the appended claims and their equivalents.

[1244] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While similar or equivalent methods and materials may be used in the practice or testing of this invention, suitable methods and materials are described herein.

[1245] All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Database entries and electronic publications disclosed in this disclosure are incorporated herein by reference in their entirety. Versions of database entries or electronic publications incorporated herein by reference are the most recent versions publicly available at the time of filing of this application. Database entries disclosed in this application corresponding to gene or protein identifiers (e.g., genes or proteins identified by accession numbers or database identifiers of public databases such as Genbank, Refseq, or Uniprot) are incorporated herein by reference in their entirety. Incorporated information related to genes or proteins is not limited to sequence data contained in the database entries. Information incorporated by reference includes the entire contents of database entries in the most recent versions of databases publicly available at the time of filing of this application. In the event of conflict, this specification (including definitions) shall prevail. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be restrictive.

Claims

1. A bicistronic polynucleotide encoding (i) a therapeutic agent and (ii) an immune surveillance masking molecule (ISMM), wherein the ISMM comprises a nonfunctional β-2-microglobulin (B2M) polypeptide and human leukocyte antigen (HLA).

2. The bicistronic polynucleotide of claim 1, wherein the therapeutic agent is a chimeric antigen receptor (CAR) comprising an antigen-binding domain that specifically binds to an epitope on a tumor antigen on a target cell.

3. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain comprises an antibody or its antigen-binding portion.

4. The bicistronic polynucleotide of claim 2, wherein the tumor antigen is disialotetrahexosylganglioside GD2.

5. The bicistronic polynucleotide of claim 3, wherein the antibody is dartuximab or its antigen-binding moiety.

6. The bicistronic polynucleotide of claim 5, wherein the antibody is a single-chain variable fragment (scFv) comprising a variable region of the heavy chain (VH) and a variable region of the light chain (VL) of dartuximab.

7. The bicistronic polynucleotide of claim 6, wherein the dartuximab scFv comprises the protein sequence shown in SEQ ID NO:

22.

8. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain cross-competes with dartuximab.

9. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain binds to the same epitope as dartuximab.

10. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain comprises VH CDR3 of dartuximab.

11. The bicistronic polynucleotide of claim 10, wherein the antigen-binding domain further comprises VH CDR1 and VH CDR2.

12. The bicistronic polynucleotide of claim 11, wherein the VH CDR1 comprises VHCDR1 of dartuximab and / or the VH CDR2 comprises VH CDR2 of dartuximab.

13. The bicistronic polynucleotide of claims 10 to 12, wherein the antigen-binding domain further comprises VLCDR1, VL CDR2 and / or VL CDR3.

14. The bicistronic polynucleotide of claim 13, wherein VL CDR1 comprises VL CDR1 of dartuximab, VL CDR2 comprises VL CDR2 of dartuximab, and / or VL CDR3 comprises VLCDR3 of dartuximab.

15. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain comprises (i) VH CDR1 of SEQ ID NO:59; VH CDR2 of SEQ ID NO:63; and VH CDR3 of SEQ ID NO:67; and / or VL CDR1 of SEQ ID NO:71; VL CDR2 of SEQ ID NO:75; and VL CDR3 of SEQ ID NO:79; or (ii) VH CDR1 of SEQ ID NO:60; VH CDR2 of SEQ ID NO:64; and VH CDR3 of SEQ ID NO:68; and / or VL CDR1 of SEQ ID NO:72; VL CDR2 of SEQ ID NO:76; and VL CDR3 of SEQ ID NO:80; or (iii) VH CDR1 of SEQ ID NO:61; VH CDR2 of SEQ ID NO:65; and VH CDR3 of SEQ ID NO:69; and / or VL CDR1 of SEQ ID NO:73; VL CDR2 of SEQ ID NO:77; and VL CDR3 of SEQ ID NO:81; or (iv) VH CDR1 of SEQ ID NO:62; VH CDR2 of SEQ ID NO:66; and VH CDR3 of SEQ ID NO:70; and / or VL CDR1 of SEQ ID NO:74; VL CDR2 of SEQ ID NO:78; and VL CDR3 of SEQ ID NO:82; or (v) VH CDR1 of SEQ ID NO:53; VH CDR2 of SEQ ID NO:54; and VH CDR3 of SEQ ID NO:55; and / or VL CDR1 of SEQ ID NO:56; VL CDR2 of SEQ ID NO:57; and VL CDR3 of SEQ ID NO:58; 16. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain comprises VH and VL, and wherein the VH comprises the protein sequence shown in SEQ ID NO:44 or the VL comprises the protein sequence shown in SEQ ID NO:

46.

17. The bicistronic polynucleotide of claim 2, wherein the antigen-binding domain comprises VH and VL, wherein VH comprises the protein sequence shown in SEQ ID NO:44, and VL comprises the protein sequence shown in SEQ ID NO:

46.

18. The bicistronic polynucleotide of claim 17, wherein the VH and VL are linked via a linker.

19. The bicistronic polynucleotide of claim 18, wherein the VH and VL are linked in a VH-linker-VL or VL-linker-VH conformation.

20. The bicistronic polynucleotide of claim 18, wherein the linker is a Gly4-Ser linker.

21. The bicistronic polynucleotide of claim 18, wherein the Gly4-Ser adapter comprises the sequence shown in SEQ ID NO:

84.

22. The bicistronic polynucleotide of any one of claims 2 to 21, wherein the CAR construct is designed as a standard CAR, a split CAR, a turn-off CAR, a turn-on CAR, a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR.

23. The bicistronic polynucleotide of any one of claims 2 to 20, wherein the antigen-binding domain is 1g NAR, Fab, Fab', F(ab)'2, F(ab)'3, Fv, single-chain variable fragment (scFv), bisscFv, (scFv)2, microantibody, biantibody, triantibody, tetraantibody, intracellular antibody, disulfide-stabilized Fv protein (dsFv), monoantibody, nanobody, affinity compound, DARPin, monomeric antibody, adnectin, α-body, or a designed conjugate.

24. The bicistronic polynucleotide of any one of claims 2 to 21, wherein the CAR construct further comprises a transmembrane domain, an intracellular domain, and a spacer region located between the antigen-binding domain and the transmembrane domain.

25. The bicistronic polynucleotide of claim 24, wherein the intracellular domain of the CAR construct is a signal transduction domain derived from CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, or CD28.

26. The bicistronic polynucleotide of claim 25, wherein the intracellular domain of the CAR construct is derived from CD28.

27. The bicistronic polynucleotide of claim 24, wherein the transmembrane domain of the CAR construct is derived from CD28.

28. The bicistronic polynucleotide of claim 27, wherein the transmembrane domain is connected to the intracellular domain via a linker.

29. The bicistronic polynucleotide of claim 24, wherein the intracellular domain and transmembrane domain of the CAR construct are derived from the same molecule.

30. The bicistronic polynucleotide of claim 29, wherein the transmembrane domain and the intracellular domain are derived from CD28.

31. The bicistronic polynucleotide of claim 24, wherein the spacer region of the CAR construct is the CD8α hinge region.

32. The bicistronic polynucleotide of any one of claims 2 to 31, wherein the CAR construct further comprises a co-stimulatory domain or a combination thereof.

33. The bicistronic polynucleotide of claim 32, wherein the co-stimulatory domain is derived from 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, CD3ζ, and combinations thereof.

34. The bicistronic polynucleotide of claim 32, wherein the co-stimulatory domain comprises a 4-1BB activation domain.

35. The bicistronic polynucleotide of claim 32, wherein the co-stimulatory domain comprises a CD3ζ activation domain.

36. The bicistronic polynucleotide of claim 32, wherein the co-stimulatory domain comprises a 4-1BB activation domain and a CD3ζ activation domain.

37. The bicistronic polynucleotide of any one of claims 2 to 36, wherein the CAR construct comprises the nucleic acid sequence shown in SEQ ID NO:

19.

38. The bicistronic polynucleotide of any one of claims 2 to 36, wherein the CAR construct encodes the protein shown in SEQ ID NO:

20.

39. The bicistronic polynucleotide of claim 1, wherein the therapeutic agent comprises an antibody or its antigen-binding moiety, an enzyme, a receptor, a cytokine, a coagulation factor, or a hormone.

40. The bicistronic polynucleotide of claim 1, wherein the β-2-microglobulin (B2M) nonfunctional polypeptide is a B2M nonfunctional fragment.

41. The bicistronic polynucleotide of claim 40, wherein the β-2-microglobulin (B2M) nonfunctional polypeptide is a B2M nonfunctional variant.

42. The bicistronic polynucleotide of claim 1, wherein the human leukocyte antigen (HLA) is HLA-E or HLA-G.

43. The bicistronic polynucleotide of claim 1, wherein the β-2-microglobulin (B2M) polypeptide and the human leukocyte antigen (HLA) are linked by a linker.

44. The bicistronic polynucleotide of claim 43, wherein the linker is a Gly4-Ser linker.

45. The bicistronic polynucleotide of claim 44, wherein the Gly4-Ser adapter comprises the sequence shown in SEQ ID NO:

84.

46. ​​The bicistronic polynucleotide according to any one of claims 1 to 45, wherein (i) The nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the immune surveillance masking molecule (ISMM) are linked by a 2A element; or (ii) The nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the immune surveillance masking molecule (ISMM) are linked by an internal ribosome entry site (IRES).

47. The bicistronic polynucleotide of any one of claims 1 to 46, wherein the nucleic acid sequence encoding the therapeutic agent comprises the sequence shown in SEQ ID NO:

5.

48. The bicistronic polynucleotide of any one of claims 1 to 47, wherein the nucleic acid sequence encoding the ISMM comprises the sequence shown in SEQ ID NO:

6.

49. The bicistronic polynucleotide of any one of claims 1 to 48, wherein the nucleic acid sequence encoding the therapeutic agent comprises the sequence shown in SEQ ID NO:5, and the nucleic acid sequence encoding the ISMM comprises the sequence shown in SEQ ID NO:

6.

50. The bicistronic polynucleotide of claim 49, wherein the bicistronic polynucleotide is selected from the group consisting of: bicistronic construct 1, bicistronic construct 2, bicistronic construct 3, bicistronic construct 4, bicistronic construct 5, bicistronic construct 6, bicistronic construct 7 and bicistronic construct 8.

51. The bicistronic polynucleotide of claim 50, wherein the bicistronic polynucleotide further comprises a 5' sequence complementary to the B2M gene sequence upstream of the insertion site and a 3' sequence complementary to the B2M gene sequence downstream of the insertion site.

52. The bicistronic polynucleotide of claim 51, wherein the 5' sequence and the 3' sequence have the same length.

53. The bicistronic polynucleotide of claim 52, wherein the lengths of the 5' and 3' sequences are at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides.

54. The bicistronic polynucleotide of claim 53, wherein the bicistronic polynucleotide is selected from the group consisting of: complete donor 1, complete donor 2, complete donor 3, complete donor 4, complete donor 5, complete donor 6, complete donor 7 and complete donor 8.

55. The bicistronic polynucleotide of claim 54, wherein the bicistronic polynucleotide is inserted into the β-2-microglobulin (B2M) gene, and wherein the insertion into the B2M gene inactivates the gene.

56. The bicistronic polynucleotide of claim 55, wherein the insertion in the β-2-microglobulin (B2M) gene is mediated by a nuclease.

57. The bicistronic polynucleotide of claim 55, wherein the nuclease is a CRISPR / Cas nuclease.

58. The bicistronic polynucleotide of claim 57, wherein the CRISPR / Cas nuclease is CRISPR / Cas9.

59. The bicistronic polynucleotide of claim 58, wherein the insertion site in the β-2-microglobulin (B2M) gene is at an intron position.

60. The bicistronic polynucleotide of claim 58, wherein the insertion site in the β-2-microglobulin (B2M) gene is at an intron-exon junction.

61. The bicistronic polynucleotide of claim 58, wherein the insertion site in the β-2-microglobulin (B2M) gene is at an exon position.

62. The bicistronic polynucleotide of claim 61, wherein the exon is located at exon 1.

63. The bicistronic polynucleotide of claim 62, wherein the insertion site is site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1).

64. The bicistronic polynucleotide of claim 61, wherein the exon is located at exon 2.

65. The bicistronic polynucleotide of claim 64, wherein the insertion site is site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2) or site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3).

66. The bicistronic polynucleotide of claim 61, wherein the exon is located at exon 3.

67. The bicistronic polynucleotide of claim 66, wherein the insertion site is site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

68. The bicistronic polynucleotide of any one of claims 1 to 67, wherein the polynucleotide is a DNA molecule or an RNA molecule.

69. The bicistronic polynucleotide of any one of claims 2 to 68, wherein the CAR is an inducible CAR.

70. A vector comprising a bicistronic polynucleotide as described in any one of claims 1 to 69, operatively linked to a regulatory element.

71. The vector of claim 70, wherein the vector is a viral vector, a mammalian vector, or a bacterial vector.

72. The vector as described in claim 70 or 71, wherein the vector is a retroviral vector.

73. The vector according to any one of claims 70 to 72, wherein the vector is selected from the group consisting of: adenovirus vectors, lentiviruses, Sendai virus vectors, baculovirus vectors, Epstein-Barr virus vectors, multivaccinia virus vectors, vaccinia virus vectors, herpes simplex virus vectors, hybrid vectors and adeno-associated virus (AAV) vectors.

74. A composition comprising a bicistronic polynucleotide as described in any one of claims 1 to 69 or a vector as described in any one of claims 70 to 73.

75. A kit comprising a bicistronic polynucleotide as described in any one of claims 1 to 69, a vector as described in any one of claims 70 to 73, or a composition as described in claim 74.

76. A genetically modified cell for expressing a therapeutic agent and ISMM, said cell comprising a bicistronic polynucleotide as described in any one of claims 1 to 70, a vector as described in any one of claims 70 to 73, or a composition as described in claim 74.

77. The cell of claim 76, wherein the cell is a T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, an ILC cell, a macrophage, or an antigen-presenting cell.

78. The cell of claim 76 or 77, wherein the cell is an allogeneic cell.

79. A composition comprising a bicistronic polynucleotide as claimed in any one of claims 1 to 70, a vector as claimed in any one of claims 70 to 73, a composition as claimed in claim 74, or a cell as claimed in any one of claims 76 to 78.

80. The composition of claim 79, wherein the composition is used to treat a subject requiring therapy.

81. The composition of claim 79, wherein the therapy is CAR therapy.

82. A pharmaceutical composition comprising cells as described in any one of claims 76 to 78 or a composition as described in claim 79 or 81, said pharmaceutical composition for treating cancer in a subject in need.

83. A kit comprising cells as described in any one of claims 76 to 78, a composition as described in claims 79 to 81, or a pharmaceutical composition as described in claim 82.

84. Use as a medicament by any of the following: the bicistronic polynucleotide as claimed in any one of claims 1 to 70; the vector as claimed in any one of claims 70 to 73; the composition as claimed in claim 74; the kit as claimed in claim 75; the cell as claimed in any one of claims 76 to 78; the composition as claimed in any one of claims 79 to 81; the pharmaceutical composition as claimed in claim 82; or the kit as claimed in claim 83.

85. Use as a medicament for treating a subject with cancer or an inflammatory disease or condition in any of the following claims: any one of claims 1 to 70, any one of claims 70 to 73, any one of claims 74, any one of claims 75, any one of claims 76 to 78, any one of claims 79 to 81, any one of claims 82, or any one of claims 83.

86. Use of the bicistronic polynucleotide of any one of claims 1 to 70, the vector of any one of claims 70 to 73, the composition of claim 74, the kit of claim 75, the cell of any one of claims 76 to 78, the composition of any one of claims 79 to 81, the pharmaceutical composition of claim 82, or the kit of claim 83 for the manufacture of a medicament for the treatment of a subject in need of cancer or an inflammatory disease or condition.

87. A method for stimulating a subject to a T-cell-mediated immune response against a target cell population or tissue, the method comprising administering to the subject an effective amount of the cells as described in any one of claims 76 to 78.

88. A method of providing antitumor immunity to a subject in need, the method comprising administering to the subject an effective amount of cells as described in any one of claims 76 to 78.

89. A method of treating cancer in a subject in need, the method comprising administering to the subject an effective amount of cells as described in any one of claims 76 to 78.

90. A method for preparing a cell population for a therapy, the method comprising transducing a cell population isolated from a subject with a bicistronic polynucleotide as described in any one of claims 1 to 70, a vector as described in any one of claims 70 to 73, or a composition as described in claim 74.

91. The method of claim 90, wherein the transduction comprises culturing the cells under suitable conditions.

92. The method of claim 91, wherein the therapy is an allogeneic cell therapy.

93. A method for generating a durable population of genetically engineered cells in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject cells genetically engineered to express bicistronic polynucleotides as described in any one of claims 1 to 69.

94. A method for expanding a population of genetically engineered cells in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject cells genetically engineered to express bicistronic polynucleotides as described in any one of claims 1 to 69.

95. The method of any one of claims 93 and 94, wherein the cell is a T cell.

96. The method of claim 95, wherein the T cell is an allogeneic T cell.

97. The method of any one of claims 85 to 96, wherein the subject is a human subject.

98. A method for generating allogeneic cells for gene therapy, the method comprising inserting a bicistronic construct comprising a nucleic acid encoding a therapeutic agent and a nucleic acid encoding an immune surveillance masking molecule (ISMM) into a β-2-microglobulin (B2M) gene, wherein the insertion of the bicistronic construct inactivates the B2M gene.

99. The method of claim 98, wherein the nucleic acid encoding the ISMM comprises a nucleic acid encoding a human leukocyte antigen (HLA) selected from HLA-E or HLA-G.

100. The method of claim 98, wherein the gene therapy is CAR-T therapy.

101. The method of claim 98, wherein the insertion site in the B2M gene is selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); or site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

102. An allogeneic CAR-T cell, said allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7 or B7, wherein the nucleic acid sequence encoding HLA-E has been replaced by a nucleic acid sequence encoding HLA-G.

103. An allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7 or B7, wherein the nucleic acid sequence encoding the B2M fragment has been replaced by a nucleic acid sequence encoding the TRAC fragment, and wherein the bicistronic construct is inserted into the TRAC gene.

104. An allogeneic CAR-T cell comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7 or B7, wherein the nucleic acid sequence encoding the B2M fragment has been replaced by a nucleic acid sequence encoding the CD52 fragment, and wherein the bicistronic construct is inserted into the CD52 gene.

105. A kit comprising a gRNA for CRISPR / Cas9-mediated insertion into a B2M, wherein the gRNA is selected from site 1 gRNA (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO:1); site 2 gRNA (AGTCACATGGTTCACACGGC; SEQ ID NO:2); site 3 gRNA (CACAGCCCAAGATAGTTAAG; SEQ ID NO:3); and site 4 gRNA (GAGACATGTAAGCAGCATCA; SEQ ID NO:4).

Images